miRTarBase - #MIRT658796 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EIF2B2   
Synonyms EIF-2Bbeta, EIF2B
Description eukaryotic translation initiation factor 2B subunit beta
Transcript NM_014239   
Expression
Putative miRNA Targets on EIF2B2
3'UTR of EIF2B2
(miRNA target sites are highlighted)
>EIF2B2|NM_014239|3'UTR
   1 CCGACCACACGTGTCCTAAGCAGATTGCTTAGGCAGATACAGAATGAAGAGGAGACTTGAGTGTTGCTGCTGAAGCACAT
  81 CCTTGCAATGTGGGAGTGCACAGGAGTCCACCTAAAAAAAAAATCCTTGATACTGTTGCCTGCCTTTTTAGTCACCCCGT
 161 AACAAGGGCACACATCCAGGACTGTGTCTTGCCTTTCAGATCTTAACAGAGCAGCAGGGCTTAACTTGTTGATTTTGGAG
 241 CCTCTTAGTGACCTGGTTGCGTCTGTGTCAGGAACTTAAACTTTCTGGTTCAGTAGTGTGTTAAACATAACACTGAATAC
 321 CTTACTGGGATACAGATTTTTGCTCAGAAATGGCTATGACACTTTTTCTAGGCTCTACCAATAAAAGCCACTTGAAGGTT
 401 CCAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGG--UAAUACACGACGAu 5'
             |:||:  | |:| ||||||| 
Target 5' aggAGACTTGAGTGT-TGCTGCTg 3'
50 - 72 152.00 -15.00
2
miRNA  3' gugUUUGGUAA-UA-CACGACGau 5'
             |||:| || ||  ||:|||  
Target 5' aaaAAATCCTTGATACTGTTGCct 3'
118 - 141 123.00 -7.80
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||:: | | |  ||:|| | 
Target 5' agCAGGGCTTAACTTGTTGATt 3'
213 - 234 104.00 -6.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
260364 4 ClinVar
314339 49 ClinVar
314340 57 ClinVar
314341 170 ClinVar
314342 181 ClinVar
887059 242 ClinVar
887060 284 ClinVar
314343 389 ClinVar
COSN30507253 12 COSMIC
COSN30150348 24 COSMIC
COSN32053255 24 COSMIC
COSN15619072 28 COSMIC
COSN5750810 29 COSMIC
COSN13596465 43 COSMIC
COSN30642159 46 COSMIC
COSN32053256 47 COSMIC
COSN31491628 48 COSMIC
COSN30524191 60 COSMIC
COSN24313417 76 COSMIC
COSN19668124 77 COSMIC
COSN31567128 81 COSMIC
COSN30188471 91 COSMIC
COSN30150674 109 COSMIC
COSN1171122 124 COSMIC
COSN29635343 124 COSMIC
COSN30101353 136 COSMIC
COSN2515981 153 COSMIC
COSN30126618 157 COSMIC
COSN19660039 181 COSMIC
COSN30512546 184 COSMIC
COSN9617936 240 COSMIC
COSN26548156 249 COSMIC
COSN26635037 329 COSMIC
COSN23251247 579 COSMIC
COSN16729042 894 COSMIC
COSN8156990 921 COSMIC
COSN21545788 942 COSMIC
COSN22985970 1370 COSMIC
COSN21700526 1397 COSMIC
COSN19596045 1569 COSMIC
COSN14945023 1637 COSMIC
COSN7026458 1694 COSMIC
COSN8156991 1728 COSMIC
COSN26860795 2150 COSMIC
COSN25762089 2306 COSMIC
COSN27670841 2349 COSMIC
COSN8849938 2488 COSMIC
COSN29631116 2723 COSMIC
COSN20772542 3139 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs373439468 3 dbSNP
rs112087431 4 dbSNP
rs773328951 6 dbSNP
rs747070752 7 dbSNP
rs770918340 11 dbSNP
rs370756093 12 dbSNP
rs770275347 14 dbSNP
rs372474383 20 dbSNP
rs776033447 26 dbSNP
rs761530281 27 dbSNP
rs1166256313 29 dbSNP
rs1309433700 32 dbSNP
rs375056192 34 dbSNP
rs750077642 39 dbSNP
rs760167860 41 dbSNP
rs765822635 46 dbSNP
rs1336520701 47 dbSNP
rs199523469 49 dbSNP
rs766944047 49 dbSNP
rs984607853 52 dbSNP
rs116393177 57 dbSNP
rs560892827 67 dbSNP
rs971977552 69 dbSNP
rs1469545756 78 dbSNP
rs1231146832 80 dbSNP
rs1028392498 90 dbSNP
rs954066524 98 dbSNP
rs1256546264 105 dbSNP
rs1208272724 107 dbSNP
rs3208685 111 dbSNP
rs1286078448 114 dbSNP
rs878922788 114 dbSNP
rs1347957228 118 dbSNP
rs1286422561 122 dbSNP
rs1246185789 125 dbSNP
rs1340179237 136 dbSNP
rs760892259 137 dbSNP
rs984061062 140 dbSNP
rs1311517881 152 dbSNP
rs1356711402 154 dbSNP
rs1443371703 155 dbSNP
rs1051612401 156 dbSNP
rs530228507 159 dbSNP
rs187228528 160 dbSNP
rs1398985052 169 dbSNP
rs566966733 170 dbSNP
rs542050883 175 dbSNP
rs4556 181 dbSNP
rs552563342 182 dbSNP
rs1283940247 184 dbSNP
rs1324187167 185 dbSNP
rs1185587021 206 dbSNP
rs1478578743 208 dbSNP
rs917444452 220 dbSNP
rs1263403149 221 dbSNP
rs1214662990 225 dbSNP
rs763277044 226 dbSNP
rs950237622 230 dbSNP
rs904219710 237 dbSNP
rs1046595426 242 dbSNP
rs541027518 242 dbSNP
rs1291796419 243 dbSNP
rs1220892496 253 dbSNP
rs1276398331 260 dbSNP
rs569575124 261 dbSNP
rs904920315 262 dbSNP
rs1486914916 270 dbSNP
rs937674386 278 dbSNP
rs1053417390 285 dbSNP
rs746045033 288 dbSNP
rs1428892145 289 dbSNP
rs1324348456 299 dbSNP
rs1405855277 308 dbSNP
rs893731760 312 dbSNP
rs1162740911 314 dbSNP
rs1478650973 315 dbSNP
rs1424092024 348 dbSNP
rs896076459 361 dbSNP
rs1009940184 367 dbSNP
rs1058367 369 dbSNP
rs1250659007 380 dbSNP
rs1247940074 383 dbSNP
rs141381011 389 dbSNP
rs901033133 394 dbSNP
rs998007996 399 dbSNP
rs3180290 402 dbSNP
rs758861979 412 dbSNP
rs555158437 415 dbSNP
rs568593225 416 dbSNP
rs1422245785 424 dbSNP
rs1410908401 429 dbSNP
rs1272827216 430 dbSNP
rs1213012858 433 dbSNP
rs1370066333 442 dbSNP
rs1275477805 446 dbSNP
rs1440208897 449 dbSNP
rs1368896613 452 dbSNP
rs1323745955 454 dbSNP
rs866429489 462 dbSNP
rs139949391 464 dbSNP
rs1400757890 464 dbSNP
rs970621931 464 dbSNP
rs1016850358 466 dbSNP
rs1406923091 473 dbSNP
rs1426879507 473 dbSNP
rs1172834230 485 dbSNP
rs1453218621 487 dbSNP
rs1017415169 489 dbSNP
rs961356499 497 dbSNP
rs973429018 498 dbSNP
rs1232642511 503 dbSNP
rs1026982183 506 dbSNP
rs534380563 507 dbSNP
rs917495242 509 dbSNP
rs117738433 528 dbSNP
rs1345737754 542 dbSNP
rs980266058 543 dbSNP
rs1311645373 550 dbSNP
rs1273044752 560 dbSNP
rs141905238 562 dbSNP
rs1341341633 563 dbSNP
rs1374036981 563 dbSNP
rs1214968958 564 dbSNP
rs1273584765 565 dbSNP
rs1339644661 569 dbSNP
rs1439707580 569 dbSNP
rs1224340331 570 dbSNP
rs1433784843 571 dbSNP
rs72121477 571 dbSNP
rs754875512 571 dbSNP
rs778753425 571 dbSNP
rs934320127 572 dbSNP
rs117592087 574 dbSNP
rs1392704722 574 dbSNP
rs1450591630 575 dbSNP
rs1196093066 576 dbSNP
rs116955879 577 dbSNP
rs71415786 577 dbSNP
rs879762913 577 dbSNP
rs1238417632 578 dbSNP
rs143391390 578 dbSNP
rs57238980 578 dbSNP
rs76434335 578 dbSNP
rs869156835 579 dbSNP
rs1210435242 581 dbSNP
rs1475992941 583 dbSNP
rs1188332183 586 dbSNP
rs1388774172 594 dbSNP
rs139657443 595 dbSNP
rs1484847736 597 dbSNP
rs922572610 598 dbSNP
rs951587984 600 dbSNP
rs141279494 607 dbSNP
rs987792982 620 dbSNP
rs1306144337 622 dbSNP
rs1390246341 632 dbSNP
rs910421055 639 dbSNP
rs575519792 642 dbSNP
rs1313318103 650 dbSNP
rs564104566 652 dbSNP
rs943186648 653 dbSNP
rs1328147269 654 dbSNP
rs1431308310 657 dbSNP
rs1042838283 659 dbSNP
rs925713874 663 dbSNP
rs544146931 665 dbSNP
rs937705480 666 dbSNP
rs190049648 684 dbSNP
rs529892679 690 dbSNP
rs1052772031 691 dbSNP
rs914946918 694 dbSNP
rs945051008 705 dbSNP
rs181892985 706 dbSNP
rs1265562711 708 dbSNP
rs11621533 712 dbSNP
rs1285665949 714 dbSNP
rs1045028872 719 dbSNP
rs1042718278 729 dbSNP
rs1334940750 745 dbSNP
rs1485553390 752 dbSNP
rs560574493 752 dbSNP
rs901064012 754 dbSNP
rs998438840 769 dbSNP
rs1049515102 772 dbSNP
rs1323478066 789 dbSNP
rs889869564 795 dbSNP
rs1353353456 799 dbSNP
rs1279634996 800 dbSNP
rs150350101 801 dbSNP
rs1383615099 805 dbSNP
rs1016966480 812 dbSNP
rs1286673049 813 dbSNP
rs1459878684 820 dbSNP
rs1395905182 828 dbSNP
rs114491634 830 dbSNP
rs1446862949 834 dbSNP
rs1426254920 837 dbSNP
rs994158138 849 dbSNP
rs961448729 861 dbSNP
rs17183320 863 dbSNP
rs971639399 870 dbSNP
rs1488864001 873 dbSNP
rs980269624 877 dbSNP
rs531714960 878 dbSNP
rs1332319465 883 dbSNP
rs1259825498 884 dbSNP
rs1227689861 891 dbSNP
rs927485854 900 dbSNP
rs957520797 904 dbSNP
rs1385850772 913 dbSNP
rs1456764848 919 dbSNP
rs989259578 922 dbSNP
rs1371128068 926 dbSNP
rs1325757760 927 dbSNP
rs955549776 938 dbSNP
rs914977795 945 dbSNP
rs1319864706 947 dbSNP
rs1168902138 953 dbSNP
rs1461640181 954 dbSNP
rs987436770 955 dbSNP
rs1178529933 957 dbSNP
rs1454721431 961 dbSNP
rs945052409 963 dbSNP
rs1192928775 964 dbSNP
rs910442829 967 dbSNP
rs1386325612 972 dbSNP
rs1454406638 974 dbSNP
rs1252380414 980 dbSNP
rs548628774 983 dbSNP
rs1338541443 987 dbSNP
rs769187717 994 dbSNP
rs979017603 1003 dbSNP
rs1347891374 1006 dbSNP
rs1302145106 1009 dbSNP
rs1439311124 1011 dbSNP
rs1242240165 1012 dbSNP
rs1379811166 1013 dbSNP
rs922517494 1014 dbSNP
rs1350819175 1016 dbSNP
rs934434569 1020 dbSNP
rs1207514886 1028 dbSNP
rs933883122 1028 dbSNP
rs1304738523 1033 dbSNP
rs568734821 1037 dbSNP
rs1052846557 1043 dbSNP
rs1171906961 1047 dbSNP
rs1452468432 1049 dbSNP
rs1049628974 1053 dbSNP
rs534169655 1077 dbSNP
rs1266813465 1090 dbSNP
rs1182466678 1093 dbSNP
rs1463010696 1095 dbSNP
rs1212576817 1099 dbSNP
rs138185384 1109 dbSNP
rs1255832865 1118 dbSNP
rs566232911 1152 dbSNP
rs1352241340 1155 dbSNP
rs146716605 1157 dbSNP
rs868617743 1157 dbSNP
rs1238964572 1168 dbSNP
rs1364578486 1169 dbSNP
rs1472329506 1171 dbSNP
rs1038440198 1194 dbSNP
rs897209140 1197 dbSNP
rs941587843 1218 dbSNP
rs1038505714 1225 dbSNP
rs1409679742 1231 dbSNP
rs994583522 1235 dbSNP
rs1385786273 1236 dbSNP
rs562636207 1238 dbSNP
rs866621318 1239 dbSNP
rs1361840231 1249 dbSNP
rs748849131 1250 dbSNP
rs1256301769 1251 dbSNP
rs907196719 1253 dbSNP
rs1029690165 1260 dbSNP
rs1001821993 1267 dbSNP
rs1284426008 1268 dbSNP
rs1350680287 1273 dbSNP
rs1227266942 1278 dbSNP
rs1285847570 1279 dbSNP
rs1034589657 1283 dbSNP
rs957551679 1291 dbSNP
rs1349219387 1298 dbSNP
rs1326288920 1300 dbSNP
rs1224736994 1315 dbSNP
rs185424432 1317 dbSNP
rs558148320 1333 dbSNP
rs1355249978 1337 dbSNP
rs1022474903 1339 dbSNP
rs1007322166 1342 dbSNP
rs966450494 1349 dbSNP
rs34980480 1354 dbSNP
rs978162423 1363 dbSNP
rs770400324 1364 dbSNP
rs190227308 1373 dbSNP
rs182127050 1385 dbSNP
rs1400021388 1401 dbSNP
rs911119616 1408 dbSNP
rs767918201 1412 dbSNP
rs1482824718 1435 dbSNP
rs1180110693 1450 dbSNP
rs1382640192 1461 dbSNP
rs1232962737 1465 dbSNP
rs1167036179 1466 dbSNP
rs149592611 1468 dbSNP
rs941211222 1469 dbSNP
rs1032876578 1474 dbSNP
rs1038134278 1475 dbSNP
rs555917745 1500 dbSNP
rs1176767326 1501 dbSNP
rs4026173 1516 dbSNP
rs4026174 1520 dbSNP
rs1185339823 1527 dbSNP
rs1476222631 1554 dbSNP
rs577586761 1556 dbSNP
rs955843889 1562 dbSNP
rs988581951 1567 dbSNP
rs1275544422 1569 dbSNP
rs1464382391 1571 dbSNP
rs930114086 1582 dbSNP
rs1334539087 1592 dbSNP
rs540428512 1602 dbSNP
rs1046222647 1609 dbSNP
rs1271743576 1611 dbSNP
rs560358060 1622 dbSNP
rs917003328 1628 dbSNP
rs1340384192 1631 dbSNP
rs949800292 1639 dbSNP
rs980183583 1640 dbSNP
rs1428660929 1654 dbSNP
rs532668494 1655 dbSNP
rs1327755319 1658 dbSNP
rs1441630304 1660 dbSNP
rs926939349 1661 dbSNP
rs369829643 1662 dbSNP
rs759099157 1662 dbSNP
rs1166988962 1663 dbSNP
rs1419743053 1663 dbSNP
rs1001515850 1671 dbSNP
rs1474107872 1677 dbSNP
rs544142640 1679 dbSNP
rs1034617351 1688 dbSNP
rs1468474741 1692 dbSNP
rs1251501771 1694 dbSNP
rs546353797 1695 dbSNP
rs897358315 1697 dbSNP
rs1272483738 1699 dbSNP
rs1011761502 1712 dbSNP
rs1305795309 1713 dbSNP
rs930127823 1718 dbSNP
rs1350135723 1721 dbSNP
rs144218397 1727 dbSNP
rs138828005 1728 dbSNP
rs1301234700 1730 dbSNP
rs1291746047 1734 dbSNP
rs1370207363 1734 dbSNP
rs1006945197 1739 dbSNP
rs1230105095 1740 dbSNP
rs977903529 1741 dbSNP
rs1341891306 1743 dbSNP
rs1327689183 1744 dbSNP
rs184966581 1748 dbSNP
rs1396352266 1755 dbSNP
rs1173775912 1756 dbSNP
rs1454197022 1758 dbSNP
rs1393752732 1759 dbSNP
rs1179474851 1761 dbSNP
rs770313835 1765 dbSNP
rs1232728298 1767 dbSNP
rs1029814138 1768 dbSNP
rs1486804694 1771 dbSNP
rs1281088076 1774 dbSNP
rs568670330 1778 dbSNP
rs142228472 1781 dbSNP
rs985068371 1798 dbSNP
rs1225400306 1805 dbSNP
rs1373783578 1808 dbSNP
rs1032909193 1813 dbSNP
rs775153260 1822 dbSNP
rs941242241 1823 dbSNP
rs974394099 1834 dbSNP
rs918460235 1835 dbSNP
rs929784933 1838 dbSNP
rs1045837465 1846 dbSNP
rs1356930217 1849 dbSNP
rs1024108074 1852 dbSNP
rs1420261733 1856 dbSNP
rs982892320 1859 dbSNP
rs1490544668 1872 dbSNP
rs1190641574 1879 dbSNP
rs1407687017 1880 dbSNP
rs928684940 1885 dbSNP
rs979873633 1898 dbSNP
rs1350693562 1900 dbSNP
rs937340598 1904 dbSNP
rs547609859 1905 dbSNP
rs1258430537 1908 dbSNP
rs1266612303 1914 dbSNP
rs893397536 1915 dbSNP
rs1484693967 1919 dbSNP
rs146407752 1924 dbSNP
rs1011875988 1926 dbSNP
rs1317501135 1935 dbSNP
rs764148149 1959 dbSNP
rs1226307229 1971 dbSNP
rs903381464 1978 dbSNP
rs753802452 1987 dbSNP
rs1390633786 1992 dbSNP
rs775918541 1998 dbSNP
rs1290166680 2001 dbSNP
rs555125445 2001 dbSNP
rs974321114 2003 dbSNP
rs1345074196 2020 dbSNP
rs918859496 2022 dbSNP
rs1463290855 2027 dbSNP
rs1419038146 2030 dbSNP
rs376240464 2037 dbSNP
rs552016019 2043 dbSNP
rs1051215486 2044 dbSNP
rs912693477 2045 dbSNP
rs1241403051 2048 dbSNP
rs1206743708 2050 dbSNP
rs540420445 2060 dbSNP
rs955091511 2062 dbSNP
rs1006513651 2063 dbSNP
rs1017934417 2064 dbSNP
rs1319594067 2068 dbSNP
rs1297312588 2070 dbSNP
rs1366134225 2073 dbSNP
rs139760641 2079 dbSNP
rs750713093 2085 dbSNP
rs1319053127 2090 dbSNP
rs758558758 2091 dbSNP
rs1000885496 2094 dbSNP
rs754693434 2095 dbSNP
rs891724352 2102 dbSNP
rs1456557353 2108 dbSNP
rs1374967249 2125 dbSNP
rs1010117310 2127 dbSNP
rs918480130 2132 dbSNP
rs537450773 2133 dbSNP
rs1294253560 2134 dbSNP
rs190838035 2135 dbSNP
rs1469803619 2138 dbSNP
rs142902502 2142 dbSNP
rs1253360807 2147 dbSNP
rs951262592 2156 dbSNP
rs1487395523 2167 dbSNP
rs534046868 2186 dbSNP
rs1263691959 2192 dbSNP
rs554092942 2200 dbSNP
rs1294843343 2203 dbSNP
rs577138015 2212 dbSNP
rs1372415926 2223 dbSNP
rs1325866463 2225 dbSNP
rs962413606 2226 dbSNP
rs973724347 2227 dbSNP
rs1298951744 2231 dbSNP
rs1206891283 2240 dbSNP
rs1248549918 2242 dbSNP
rs1448687745 2243 dbSNP
rs560031073 2244 dbSNP
rs1454787571 2254 dbSNP
rs1055887954 2265 dbSNP
rs914611652 2268 dbSNP
rs115835 2269 dbSNP
rs1431166711 2270 dbSNP
rs1252489800 2272 dbSNP
rs1196005724 2275 dbSNP
rs987060525 2280 dbSNP
rs1041996786 2285 dbSNP
rs183888468 2289 dbSNP
rs1212359422 2290 dbSNP
rs1348007949 2292 dbSNP
rs903410073 2299 dbSNP
rs1231785349 2316 dbSNP
rs1337885870 2326 dbSNP
rs751896489 2327 dbSNP
rs942862570 2343 dbSNP
rs1368903231 2344 dbSNP
rs1315033929 2345 dbSNP
rs1040251839 2350 dbSNP
rs1052324878 2356 dbSNP
rs1374929192 2357 dbSNP
rs1171923125 2358 dbSNP
rs925370383 2360 dbSNP
rs936704560 2362 dbSNP
rs1472161668 2368 dbSNP
rs1249104877 2372 dbSNP
rs889279468 2373 dbSNP
rs188967341 2374 dbSNP
rs1353515231 2375 dbSNP
rs1261854640 2380 dbSNP
rs1010192231 2388 dbSNP
rs1433374643 2394 dbSNP
rs1349030241 2403 dbSNP
rs1317535781 2413 dbSNP
rs1017965087 2416 dbSNP
rs75320578 2428 dbSNP
rs1228034550 2431 dbSNP
rs1354886178 2436 dbSNP
rs1332330757 2440 dbSNP
rs1394186301 2451 dbSNP
rs995555177 2453 dbSNP
rs1456457359 2474 dbSNP
rs1409498605 2486 dbSNP
rs764302343 2488 dbSNP
rs562086597 2491 dbSNP
rs1475357133 2494 dbSNP
rs1025571504 2500 dbSNP
rs1184725251 2509 dbSNP
rs1448244662 2519 dbSNP
rs139079312 2524 dbSNP
rs981302766 2525 dbSNP
rs1327522211 2527 dbSNP
rs928494088 2539 dbSNP
rs149912718 2542 dbSNP
rs1025306269 2543 dbSNP
rs1044232383 2546 dbSNP
rs1229055480 2553 dbSNP
rs991601008 2554 dbSNP
rs543389434 2556 dbSNP
rs781695839 2560 dbSNP
rs947428949 2566 dbSNP
rs1461792741 2567 dbSNP
rs1412556333 2574 dbSNP
rs1161107745 2577 dbSNP
rs542220127 2581 dbSNP
rs555459910 2585 dbSNP
rs1373212519 2589 dbSNP
rs1188472310 2592 dbSNP
rs1238923719 2593 dbSNP
rs371694682 2596 dbSNP
rs564421193 2607 dbSNP
rs912830336 2616 dbSNP
rs1411140037 2618 dbSNP
rs1287923392 2625 dbSNP
rs1420386928 2632 dbSNP
rs1013314 2634 dbSNP
rs1411888967 2646 dbSNP
rs1297018184 2647 dbSNP
rs1456047213 2655 dbSNP
rs925402432 2667 dbSNP
rs533396853 2677 dbSNP
rs1305560201 2681 dbSNP
rs936778101 2682 dbSNP
rs1349092526 2689 dbSNP
rs144886319 2692 dbSNP
rs988215708 2706 dbSNP
rs1339267314 2707 dbSNP
rs1360169548 2714 dbSNP
rs748652704 2717 dbSNP
rs774715090 2728 dbSNP
rs949396110 2732 dbSNP
rs1447738705 2733 dbSNP
rs1397376908 2751 dbSNP
rs977796469 2757 dbSNP
rs560412948 2766 dbSNP
rs933606144 2767 dbSNP
rs193093590 2771 dbSNP
rs907131909 2772 dbSNP
rs183157866 2775 dbSNP
rs369801821 2777 dbSNP
rs1039444848 2779 dbSNP
rs1203046272 2781 dbSNP
rs1287742300 2782 dbSNP
rs1328399196 2783 dbSNP
rs1226558441 2790 dbSNP
rs898334060 2797 dbSNP
rs898219649 2804 dbSNP
rs1443884114 2809 dbSNP
rs547890008 2814 dbSNP
rs1312594664 2832 dbSNP
rs777593305 2833 dbSNP
rs746992062 2834 dbSNP
rs1376752229 2839 dbSNP
rs1003237944 2840 dbSNP
rs1483798539 2845 dbSNP
rs1182273278 2850 dbSNP
rs1423482961 2853 dbSNP
rs886834544 2854 dbSNP
rs1007905015 2861 dbSNP
rs1035593930 2862 dbSNP
rs1250512715 2871 dbSNP
rs1180293725 2874 dbSNP
rs1471317533 2875 dbSNP
rs1486691539 2878 dbSNP
rs958552630 2880 dbSNP
rs1281212953 2886 dbSNP
rs991298552 2887 dbSNP
rs1019663141 2890 dbSNP
rs1021732219 2892 dbSNP
rs568097024 2895 dbSNP
rs175046 2896 dbSNP
rs1174343652 2898 dbSNP
rs1407672774 2905 dbSNP
rs1356807769 2907 dbSNP
rs977530579 2912 dbSNP
rs554154499 2913 dbSNP
rs1357894007 2921 dbSNP
rs767760379 2924 dbSNP
rs1161924284 2930 dbSNP
rs958180181 2941 dbSNP
rs1348757189 2956 dbSNP
rs988248347 2957 dbSNP
rs933322165 2965 dbSNP
rs1173074190 2972 dbSNP
rs1157214197 2975 dbSNP
rs1476333339 2976 dbSNP
rs757225102 2986 dbSNP
rs914006670 3007 dbSNP
rs1181303217 3010 dbSNP
rs139134256 3016 dbSNP
rs1235598582 3020 dbSNP
rs1276572733 3027 dbSNP
rs987705249 3028 dbSNP
rs1267340997 3034 dbSNP
rs1368148227 3036 dbSNP
rs982144056 3041 dbSNP
rs926579750 3046 dbSNP
rs937316204 3049 dbSNP
rs141999872 3050 dbSNP
rs1055632416 3051 dbSNP
rs1276159905 3056 dbSNP
rs1344033461 3057 dbSNP
rs1205499958 3059 dbSNP
rs1388324840 3061 dbSNP
rs943552253 3065 dbSNP
rs1037798912 3066 dbSNP
rs150018652 3067 dbSNP
rs531938482 3067 dbSNP
rs539996248 3067 dbSNP
rs60567470 3067 dbSNP
rs898355439 3071 dbSNP
rs1200323964 3077 dbSNP
rs1247829171 3079 dbSNP
rs931164223 3079 dbSNP
rs1465318444 3083 dbSNP
rs1477957477 3086 dbSNP
rs1189847860 3090 dbSNP
rs1206550311 3092 dbSNP
rs1469657009 3101 dbSNP
rs760595324 3107 dbSNP
rs187084915 3141 dbSNP
rs556278239 3147 dbSNP
rs175047 3149 dbSNP
rs1229761553 3161 dbSNP
rs1365042016 3164 dbSNP
rs79425287 3165 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000266126.5 | 3UTR | UACAGAAUGAAGAGGAGACUUGAGUGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE26953 Aortic valvular endothelial cells 0.558 2.3e-3 0.589 1.2e-3 24 Click to see details
GSE21032 Prostate cancer 0.246 1.2e-2 0.224 2.1e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.402 2.3e-2 -0.383 2.9e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.357 4.7e-2 -0.181 2.0e-1 23 Click to see details
GSE32688 Pancreatic cancer 0.24 9.3e-2 0.364 2.0e-2 32 Click to see details
GSE17306 Multiple myeloma 0.19 9.6e-2 0.191 9.4e-2 49 Click to see details
GSE28260 Renal cortex and medulla -0.259 2.0e-1 -0.159 3.0e-1 13 Click to see details
GSE27834 Pluripotent stem cells 0.228 2.0e-1 0.150 2.9e-1 16 Click to see details
GSE14794 Lymphoblastoid cells -0.086 2.1e-1 -0.070 2.6e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.149 2.4e-1 0.114 2.9e-1 25 Click to see details
GSE19536 Breast cancer 0.066 2.6e-1 0.094 1.8e-1 100 Click to see details
GSE19783 ER- ER- breast cancer 0.068 2.8e-1 0.025 4.1e-1 79 Click to see details
GSE38226 Liver fibrosis 0.134 2.8e-1 0.084 3.6e-1 21 Click to see details
GSE17498 Multiple myeloma -0.045 3.9e-1 -0.160 1.6e-1 40 Click to see details
GSE21687 Ependynoma primary tumors -0.032 4.0e-1 -0.059 3.2e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.054 4.3e-1 -0.140 3.3e-1 12 Click to see details
GSE28544 Breast cancer 0.033 4.4e-1 0.272 9.9e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.019 4.7e-1 0.113 3.2e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.008 4.9e-1 0.299 1.0e-1 20 Click to see details
GSE21849 B cell lymphoma 0.004 4.9e-1 -0.042 4.1e-1 29 Click to see details
GSE21849 B cell lymphoma 0.004 4.9e-1 -0.042 4.1e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.259 0.04 -0.188 0.1 49 Click to see details
HNSC 0.275 0.04 0.294 0.03 42 Click to see details
PAAD -0.904 0.05 -1.000 0.5 4 Click to see details
LUSC -0.268 0.05 -0.317 0.03 38 Click to see details
BRCA 0.158 0.08 0.085 0.22 84 Click to see details
PCPG -0.959 0.09 -0.500 0.33 3 Click to see details
THCA -0.158 0.12 -0.164 0.11 59 Click to see details
PRAD -0.17 0.12 -0.175 0.11 50 Click to see details
BLCA -0.238 0.17 -0.253 0.16 18 Click to see details
LUAD -0.235 0.23 -0.329 0.15 12 Click to see details
KIRP -0.117 0.26 0.022 0.45 32 Click to see details
KIRC -0.072 0.28 -0.047 0.35 68 Click to see details
UCEC -0.132 0.3 -0.111 0.33 19 Click to see details
STAD 0.085 0.32 0.111 0.27 32 Click to see details
CHOL 0.154 0.35 0.000 0.5 9 Click to see details
CESC -0.413 0.36 -0.500 0.33 3 Click to see details
KICH -0.063 0.38 -0.003 0.49 25 Click to see details
COAD 0.04 0.46 0.286 0.25 8 Click to see details
ESCA 0.011 0.49 -0.036 0.46 11 Click to see details
ESCA 0.011 0.49 -0.036 0.46 11 Click to see details
ESCA 0.011 0.49 -0.036 0.46 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*