miRTarBase - #MIRT654577 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PXMP4   
Synonyms PMP24
Description peroxisomal membrane protein 4
Transcript NM_183397   
Other Transcripts NM_007238   
Putative miRNA Targets on PXMP4
3'UTR of PXMP4
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
                | | || |||||||| 
Target 5' tgcttcCAACTG-CACACTCCa 3'
4878 - 4898 151.00 -18.20
            |:: |||||   |||||:| 
Target 5' atAGTTCCATT---ACACTTCa 3'
2869 - 2887 141.00 -13.80
             ||:||| |   :|||||| 
Target 5' atcACGCCACT---GCACTCCa 3'
968 - 986 140.00 -18.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM1025975 4 COSMIC
COSM8265769 21 COSMIC
COSM9106426 31 COSMIC
COSM8841747 32 COSMIC
COSM9892691 49 COSMIC
COSM8993512 50 COSMIC
COSM9783241 53 COSMIC
COSM5927070 54 COSMIC
COSM4719590 55 COSMIC
COSM5028680 62 COSMIC
COSM6899388 72 COSMIC
COSM8263217 79 COSMIC
COSM6240430 95 COSMIC
COSM7799090 105 COSMIC
COSM6760671 108 COSMIC
COSM8399118 109 COSMIC
COSM443677 112 COSMIC
COSM9198107 117 COSMIC
COSM9239178 117 COSMIC
COSM6021935 127 COSMIC
COSM8475207 135 COSMIC
COSM724001 136 COSMIC
COSM7075855 152 COSMIC
COSM9757933 152 COSMIC
COSM6092802 159 COSMIC
COSM7161018 163 COSMIC
COSM8993051 173 COSMIC
COSM4619496 177 COSMIC
COSM7075854 182 COSMIC
COSM8543390 189 COSMIC
COSM9394852 191 COSMIC
COSM4097724 194 COSMIC
COSM3758528 195 COSMIC
COSM8309882 211 COSMIC
COSN30184588 243 COSMIC
COSN30157755 256 COSMIC
COSN30146197 298 COSMIC
COSN23071113 315 COSMIC
COSN9126217 317 COSMIC
COSN31566529 333 COSMIC
COSN30137677 376 COSMIC
COSN9126216 382 COSMIC
COSN30131231 419 COSMIC
COSN23705415 1176 COSMIC
COSN1870033 1933 COSMIC
COSN26930184 1996 COSMIC
COSN22770276 2073 COSMIC
COSN7089582 2215 COSMIC
COSN7089581 2282 COSMIC
COSN18754175 2326 COSMIC
COSN31961844 2458 COSMIC
COSN23899473 2931 COSMIC
COSN16738745 3234 COSMIC
COSN17037984 3428 COSMIC
COSN5133823 3593 COSMIC
COSN17689136 3629 COSMIC
COSN26368825 3729 COSMIC
COSN14669820 3935 COSMIC
COSN19477486 4239 COSMIC
COSN26340423 4284 COSMIC
COSN32014634 4517 COSMIC
COSN20166829 4901 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751272352 3 dbSNP
rs1187656160 4 dbSNP
rs140983338 20 dbSNP
rs929230040 25 dbSNP
rs752670735 32 dbSNP
rs1215526257 33 dbSNP
rs147675500 35 dbSNP
rs150332702 36 dbSNP
rs1156806785 37 dbSNP
rs1254373614 38 dbSNP
rs368952284 39 dbSNP
rs1235482311 44 dbSNP
rs35264133 49 dbSNP
rs773378277 50 dbSNP
rs768022356 55 dbSNP
rs551682855 56 dbSNP
rs1288144173 60 dbSNP
rs376487621 67 dbSNP
rs148199728 68 dbSNP
rs796079380 72 dbSNP
rs745324683 74 dbSNP
rs776381344 76 dbSNP
rs938911391 79 dbSNP
rs1430316357 80 dbSNP
rs777554766 81 dbSNP
rs1188472502 83 dbSNP
rs770423521 84 dbSNP
rs1245326097 95 dbSNP
rs146069372 98 dbSNP
rs1446401585 102 dbSNP
rs142285216 104 dbSNP
rs201904586 108 dbSNP
rs182672515 109 dbSNP
rs748134905 111 dbSNP
rs866752198 112 dbSNP
rs147652577 113 dbSNP
rs755107015 114 dbSNP
rs931509155 115 dbSNP
rs753817815 118 dbSNP
rs766624753 119 dbSNP
rs1334420435 121 dbSNP
rs1000293581 123 dbSNP
rs758120687 126 dbSNP
rs1401777003 127 dbSNP
rs756230752 128 dbSNP
rs1399791416 132 dbSNP
rs1463644796 136 dbSNP
rs750627574 137 dbSNP
rs767911987 140 dbSNP
rs1424019176 141 dbSNP
rs1186536547 144 dbSNP
rs762146417 148 dbSNP
rs1387579620 152 dbSNP
rs1341080283 160 dbSNP
rs774864320 166 dbSNP
rs764549910 167 dbSNP
rs145235084 168 dbSNP
rs1197164074 173 dbSNP
rs746707723 176 dbSNP
rs772966200 177 dbSNP
rs1246683038 178 dbSNP
rs1361529655 180 dbSNP
rs1254318829 183 dbSNP
rs1257680082 184 dbSNP
rs1312749115 184 dbSNP
rs1244993598 186 dbSNP
rs772041080 188 dbSNP
rs1202317330 194 dbSNP
rs910397 195 dbSNP
rs1255289432 202 dbSNP
rs779024301 210 dbSNP
rs200916380 211 dbSNP
rs1307525345 213 dbSNP
rs1320587490 214 dbSNP
rs1425338454 215 dbSNP
rs1271188981 225 dbSNP
rs114550658 230 dbSNP
rs780052694 242 dbSNP
rs1472705996 252 dbSNP
rs1364730672 254 dbSNP
rs756212003 263 dbSNP
rs752754562 268 dbSNP
rs750696158 269 dbSNP
rs1460671128 281 dbSNP
rs1174466681 300 dbSNP
rs943159264 302 dbSNP
rs772378372 308 dbSNP
rs1311648428 309 dbSNP
rs1441422471 322 dbSNP
rs761857751 332 dbSNP
rs1342903440 333 dbSNP
rs1216066001 338 dbSNP
rs1340019427 339 dbSNP
rs1060683 343 dbSNP
rs1277993717 344 dbSNP
rs35467119 344 dbSNP
rs1226327906 346 dbSNP
rs1021360867 352 dbSNP
rs1306073719 355 dbSNP
rs1385080093 357 dbSNP
rs1257393510 376 dbSNP
rs985578189 385 dbSNP
rs769147084 387 dbSNP
rs539267772 388 dbSNP
rs1489240733 398 dbSNP
rs1194222713 410 dbSNP
rs922596900 411 dbSNP
rs1357578631 412 dbSNP
rs1426511974 418 dbSNP
rs1331332177 428 dbSNP
rs1056684334 430 dbSNP
rs1201351860 431 dbSNP
rs368818640 432 dbSNP
rs1002499855 433 dbSNP
rs956506148 434 dbSNP
rs1420856987 439 dbSNP
rs1167255468 461 dbSNP
rs1298057837 482 dbSNP
rs887362009 491 dbSNP
rs1047805231 500 dbSNP
rs1388878294 508 dbSNP
rs931482283 512 dbSNP
rs1386573486 519 dbSNP
rs978966276 520 dbSNP
rs145370322 522 dbSNP
rs1233043606 523 dbSNP
rs1039909830 525 dbSNP
rs1235335074 525 dbSNP
rs942739184 528 dbSNP
rs1206425338 529 dbSNP
rs775868477 541 dbSNP
rs1273916587 542 dbSNP
rs1202922824 546 dbSNP
rs556876013 549 dbSNP
rs912653464 550 dbSNP
rs1013997611 553 dbSNP
rs986790456 554 dbSNP
rs895525792 557 dbSNP
rs1278664953 561 dbSNP
rs956960420 563 dbSNP
rs1440395994 570 dbSNP
rs770080150 575 dbSNP
rs1315829554 580 dbSNP
rs538372965 597 dbSNP
rs1459859599 600 dbSNP
rs1294507817 602 dbSNP
rs993149460 609 dbSNP
rs1377278157 622 dbSNP
rs1439713672 622 dbSNP
rs977768702 623 dbSNP
rs1281457903 629 dbSNP
rs899096817 656 dbSNP
rs1037644582 659 dbSNP
rs968676369 666 dbSNP
rs1240211362 675 dbSNP
rs1306253630 682 dbSNP
rs943254053 684 dbSNP
rs567750440 688 dbSNP
rs1012704355 689 dbSNP
rs193109215 697 dbSNP
rs114862868 698 dbSNP
rs780682171 700 dbSNP
rs1002493432 702 dbSNP
rs1240251791 710 dbSNP
rs1458313399 715 dbSNP
rs570458427 728 dbSNP
rs567059284 729 dbSNP
rs1426085777 731 dbSNP
rs1166019553 735 dbSNP
rs925935428 737 dbSNP
rs1460190894 742 dbSNP
rs1323536400 747 dbSNP
rs1401983864 750 dbSNP
rs777422968 753 dbSNP
rs1447013045 754 dbSNP
rs1297128959 765 dbSNP
rs1404220875 772 dbSNP
rs1411236362 773 dbSNP
rs1313345847 777 dbSNP
rs1333970542 789 dbSNP
rs1231206782 800 dbSNP
rs996134270 812 dbSNP
rs1318899719 813 dbSNP
rs11699664 814 dbSNP
rs1470423356 816 dbSNP
rs758351034 819 dbSNP
rs898767062 824 dbSNP
rs1484274226 828 dbSNP
rs1183011454 830 dbSNP
rs1257406022 838 dbSNP
rs866520359 845 dbSNP
rs11699663 848 dbSNP
rs552090520 849 dbSNP
rs960072538 853 dbSNP
rs141510542 854 dbSNP
rs912648429 869 dbSNP
rs1490830108 876 dbSNP
rs1026039455 882 dbSNP
rs1449571272 886 dbSNP
rs563124558 891 dbSNP
rs1354710391 899 dbSNP
rs1292349832 902 dbSNP
rs752701402 907 dbSNP
rs1220975886 908 dbSNP
rs993635901 909 dbSNP
rs550879291 923 dbSNP
rs370892459 924 dbSNP
rs561418753 929 dbSNP
rs898859998 930 dbSNP
rs1314070074 931 dbSNP
rs765040618 933 dbSNP
rs2747543 941 dbSNP
rs935332409 946 dbSNP
rs753716191 948 dbSNP
rs979474061 949 dbSNP
rs1475291291 953 dbSNP
rs1286678335 957 dbSNP
rs1185635042 961 dbSNP
rs1224552248 967 dbSNP
rs572466543 971 dbSNP
rs563917748 973 dbSNP
rs1176181073 974 dbSNP
rs914495845 975 dbSNP
rs889003177 989 dbSNP
rs991271821 992 dbSNP
rs958573040 994 dbSNP
rs1035386781 995 dbSNP
rs1360993236 996 dbSNP
rs546128436 999 dbSNP
rs1429740083 1000 dbSNP
rs575429798 1009 dbSNP
rs1346748415 1013 dbSNP
rs933147015 1014 dbSNP
rs1293427533 1016 dbSNP
rs1457030904 1017 dbSNP
rs1347598718 1020 dbSNP
rs892277620 1021 dbSNP
rs1053239416 1031 dbSNP
rs1219521275 1031 dbSNP
rs1248781787 1031 dbSNP
rs934735303 1033 dbSNP
rs951177619 1033 dbSNP
rs1025709552 1041 dbSNP
rs557157866 1042 dbSNP
rs537392275 1043 dbSNP
rs1160434001 1055 dbSNP
rs898709401 1058 dbSNP
rs1408584630 1085 dbSNP
rs1018577271 1113 dbSNP
rs766488469 1114 dbSNP
rs1481284357 1125 dbSNP
rs1269600985 1127 dbSNP
rs1190536559 1130 dbSNP
rs1487429865 1131 dbSNP
rs1243919759 1132 dbSNP
rs1216538636 1134 dbSNP
rs1351347041 1137 dbSNP
rs1437464524 1140 dbSNP
rs1325470867 1151 dbSNP
rs959144 1152 dbSNP
rs1242383655 1154 dbSNP
rs891327344 1154 dbSNP
rs948979792 1156 dbSNP
rs1222504910 1161 dbSNP
rs764173933 1180 dbSNP
rs1452541382 1184 dbSNP
rs574182330 1188 dbSNP
rs763403329 1210 dbSNP
rs1301256570 1211 dbSNP
rs1180003205 1216 dbSNP
rs902598072 1216 dbSNP
rs117336275 1217 dbSNP
rs946770399 1230 dbSNP
rs188874459 1237 dbSNP
rs566902948 1240 dbSNP
rs991391188 1242 dbSNP
rs746200368 1243 dbSNP
rs147958863 1261 dbSNP
rs928444730 1266 dbSNP
rs1015944791 1282 dbSNP
rs1335173612 1303 dbSNP
rs1318115152 1311 dbSNP
rs777116357 1312 dbSNP
rs981317327 1319 dbSNP
rs1357549416 1321 dbSNP
rs1377998969 1323 dbSNP
rs1175002659 1329 dbSNP
rs951167381 1333 dbSNP
rs1025399998 1336 dbSNP
rs1421508952 1353 dbSNP
rs1331954046 1361 dbSNP
rs1189349011 1366 dbSNP
rs540159277 1367 dbSNP
rs770636992 1369 dbSNP
rs1200074354 1374 dbSNP
rs1250619723 1382 dbSNP
rs746669160 1385 dbSNP
rs777366008 1395 dbSNP
rs1246494958 1398 dbSNP
rs997832210 1399 dbSNP
rs1415336045 1404 dbSNP
rs1467380121 1406 dbSNP
rs1168704707 1408 dbSNP
rs1395932355 1414 dbSNP
rs892335719 1415 dbSNP
rs1052693620 1436 dbSNP
rs758011801 1437 dbSNP
rs569415345 1445 dbSNP
rs747732285 1448 dbSNP
rs1291836357 1452 dbSNP
rs1342696589 1476 dbSNP
rs550783889 1479 dbSNP
rs998950203 1481 dbSNP
rs529400517 1487 dbSNP
rs1043049602 1488 dbSNP
rs1280082642 1488 dbSNP
rs1187069755 1490 dbSNP
rs1485973554 1490 dbSNP
rs77076242 1490 dbSNP
rs1372685860 1493 dbSNP
rs915893036 1493 dbSNP
rs1057399932 1499 dbSNP
rs1376085352 1500 dbSNP
rs938924156 1500 dbSNP
rs755000598 1506 dbSNP
rs142431317 1507 dbSNP
rs374464066 1513 dbSNP
rs1231480162 1514 dbSNP
rs1309810142 1517 dbSNP
rs902585396 1518 dbSNP
rs1228553458 1520 dbSNP
rs1325524011 1521 dbSNP
rs1224732564 1523 dbSNP
rs972608810 1525 dbSNP
rs1305011478 1527 dbSNP
rs1347963297 1535 dbSNP
rs963174419 1541 dbSNP
rs1278070760 1543 dbSNP
rs538212040 1546 dbSNP
rs1489169670 1547 dbSNP
rs1363809496 1552 dbSNP
rs1205532358 1557 dbSNP
rs1260715759 1558 dbSNP
rs528171080 1560 dbSNP
rs1201187608 1572 dbSNP
rs946691208 1578 dbSNP
rs895182415 1588 dbSNP
rs34167978 1589 dbSNP
rs1055062324 1593 dbSNP
rs985861382 1598 dbSNP
rs1382670295 1603 dbSNP
rs953054402 1612 dbSNP
rs1402418485 1624 dbSNP
rs1302069397 1626 dbSNP
rs1288681519 1641 dbSNP
rs937237202 1643 dbSNP
rs564138456 1648 dbSNP
rs1029997277 1658 dbSNP
rs545468118 1659 dbSNP
rs997484650 1661 dbSNP
rs1169135474 1663 dbSNP
rs753571273 1670 dbSNP
rs574221622 1671 dbSNP
rs1239606799 1690 dbSNP
rs929860459 1692 dbSNP
rs1484767960 1696 dbSNP
rs1215851932 1703 dbSNP
rs112943567 1704 dbSNP
rs1030839327 1711 dbSNP
rs1255680422 1713 dbSNP
rs1240054403 1717 dbSNP
rs542052558 1722 dbSNP
rs574723879 1724 dbSNP
rs183823435 1725 dbSNP
rs1459745941 1727 dbSNP
rs148782209 1736 dbSNP
rs1394798734 1739 dbSNP
rs1205088599 1740 dbSNP
rs1340571561 1741 dbSNP
rs1294804777 1744 dbSNP
rs867127991 1749 dbSNP
rs1247471016 1751 dbSNP
rs894514901 1753 dbSNP
rs1391961215 1755 dbSNP
rs1311528652 1757 dbSNP
rs1057440971 1763 dbSNP
rs1234873557 1766 dbSNP
rs1273540091 1768 dbSNP
rs938954596 1784 dbSNP
rs1211998513 1794 dbSNP
rs573239847 1798 dbSNP
rs558147413 1812 dbSNP
rs955573582 1817 dbSNP
rs898043704 1827 dbSNP
rs1036552381 1841 dbSNP
rs1029946141 1845 dbSNP
rs1308347839 1849 dbSNP
rs1000097820 1851 dbSNP
rs1248991084 1852 dbSNP
rs751805011 1855 dbSNP
rs1189121052 1856 dbSNP
rs375881950 1857 dbSNP
rs1010918019 1871 dbSNP
rs909368300 1878 dbSNP
rs569537460 1879 dbSNP
rs557191516 1890 dbSNP
rs1458458823 1892 dbSNP
rs1355833114 1895 dbSNP
rs1462030813 1901 dbSNP
rs931719275 1901 dbSNP
rs1055010561 1902 dbSNP
rs1293696248 1932 dbSNP
rs1185689108 1941 dbSNP
rs976118443 1942 dbSNP
rs145337269 1945 dbSNP
rs568362828 1951 dbSNP
rs546770109 1956 dbSNP
rs979354863 1957 dbSNP
rs528225839 1958 dbSNP
rs570420829 1960 dbSNP
rs1045689468 1961 dbSNP
rs929785236 1962 dbSNP
rs918398080 1964 dbSNP
rs1179804754 1969 dbSNP
rs967882883 1973 dbSNP
rs372880011 1974 dbSNP
rs1169165544 1976 dbSNP
rs1023416656 1980 dbSNP
rs1436514888 1981 dbSNP
rs1313408753 1984 dbSNP
rs1356429312 1994 dbSNP
rs1412662169 1996 dbSNP
rs190632266 1996 dbSNP
rs201016282 1997 dbSNP
rs1214142261 2004 dbSNP
rs201715023 2004 dbSNP
rs894531114 2004 dbSNP
rs149913566 2005 dbSNP
rs1264550228 2012 dbSNP
rs749433825 2018 dbSNP
rs374064992 2035 dbSNP
rs1337094546 2036 dbSNP
rs1035707997 2038 dbSNP
rs1288785097 2038 dbSNP
rs1243009479 2040 dbSNP
rs985114778 2048 dbSNP
rs1485999521 2050 dbSNP
rs1185510251 2054 dbSNP
rs1387859415 2055 dbSNP
rs1455186394 2055 dbSNP
rs563262229 2064 dbSNP
rs752874341 2069 dbSNP
rs542189491 2073 dbSNP
rs978397769 2074 dbSNP
rs967380057 2078 dbSNP
rs529992490 2093 dbSNP
rs1011034274 2097 dbSNP
rs139174709 2098 dbSNP
rs1320057918 2100 dbSNP
rs541192311 2106 dbSNP
rs1037051888 2131 dbSNP
rs1287318795 2134 dbSNP
rs1373349758 2143 dbSNP
rs1033759762 2148 dbSNP
rs1390120677 2150 dbSNP
rs1003496834 2155 dbSNP
rs776800091 2156 dbSNP
rs1048206146 2163 dbSNP
rs1346372158 2171 dbSNP
rs1455563600 2176 dbSNP
rs146204648 2178 dbSNP
rs1158953399 2179 dbSNP
rs897065735 2190 dbSNP
rs1316695219 2201 dbSNP
rs1471796774 2205 dbSNP
rs1245797245 2209 dbSNP
rs931725751 2213 dbSNP
rs1271763232 2223 dbSNP
rs922983193 2228 dbSNP
rs1251768509 2229 dbSNP
rs975790670 2230 dbSNP
rs1160218868 2235 dbSNP
rs1408512787 2237 dbSNP
rs935012990 2246 dbSNP
rs1038173767 2251 dbSNP
rs941206857 2252 dbSNP
rs1200182548 2260 dbSNP
rs1441856647 2261 dbSNP
rs1325319727 2267 dbSNP
rs1368796962 2273 dbSNP
rs910969730 2291 dbSNP
rs1445080953 2292 dbSNP
rs943149520 2309 dbSNP
rs1049526328 2311 dbSNP
rs1373123660 2311 dbSNP
rs1336505935 2313 dbSNP
rs557919325 2313 dbSNP
rs1213851853 2314 dbSNP
rs546188118 2315 dbSNP
rs1272061060 2316 dbSNP
rs1330797555 2318 dbSNP
rs1449363195 2319 dbSNP
rs1268350964 2323 dbSNP
rs78931545 2324 dbSNP
rs1183963963 2326 dbSNP
rs772158398 2326 dbSNP
rs77310664 2326 dbSNP
rs1227605827 2327 dbSNP
rs1419672412 2327 dbSNP
rs112170731 2328 dbSNP
rs1462174718 2331 dbSNP
rs1164460317 2339 dbSNP
rs1388747059 2340 dbSNP
rs1326812420 2342 dbSNP
rs575590472 2344 dbSNP
rs1276609009 2346 dbSNP
rs990584718 2347 dbSNP
rs1295517738 2357 dbSNP
rs978181853 2361 dbSNP
rs556933935 2363 dbSNP
rs945611337 2364 dbSNP
rs1356493738 2366 dbSNP
rs1233598096 2368 dbSNP
rs915487999 2369 dbSNP
rs989600883 2370 dbSNP
rs1197060486 2371 dbSNP
rs576077703 2376 dbSNP
rs1330406021 2380 dbSNP
rs1321690555 2396 dbSNP
rs959571323 2412 dbSNP
rs1033707442 2414 dbSNP
rs982131885 2421 dbSNP
rs1389710836 2432 dbSNP
rs535774919 2435 dbSNP
rs185780546 2436 dbSNP
rs1366908262 2438 dbSNP
rs1476483473 2447 dbSNP
rs1431918008 2449 dbSNP
rs1173455554 2455 dbSNP
rs993913266 2460 dbSNP
rs897060657 2461 dbSNP
rs141546725 2463 dbSNP
rs1315350862 2464 dbSNP
rs1376487334 2464 dbSNP
rs534880998 2472 dbSNP
rs1248332586 2473 dbSNP
rs1332551370 2488 dbSNP
rs1338369502 2503 dbSNP
rs889650393 2512 dbSNP
rs570545795 2513 dbSNP
rs1463217037 2527 dbSNP
rs1338165100 2529 dbSNP
rs369399516 2534 dbSNP
rs182595639 2536 dbSNP
rs1485902550 2544 dbSNP
rs537130055 2557 dbSNP
rs552252994 2559 dbSNP
rs1448974367 2562 dbSNP
rs1194156000 2565 dbSNP
rs1372647464 2568 dbSNP
rs569716918 2576 dbSNP
rs897857265 2577 dbSNP
rs548201051 2581 dbSNP
rs1176134045 2582 dbSNP
rs1014926191 2587 dbSNP
rs1230790163 2592 dbSNP
rs546173297 2602 dbSNP
rs1296893505 2605 dbSNP
rs887992766 2608 dbSNP
rs879871836 2616 dbSNP
rs559640132 2625 dbSNP
rs113971832 2626 dbSNP
rs1348536866 2631 dbSNP
rs71349730 2634 dbSNP
rs117436827 2636 dbSNP
rs1254091027 2637 dbSNP
rs1352572109 2638 dbSNP
rs66890990 2640 dbSNP
rs1463674475 2641 dbSNP
rs1195612310 2645 dbSNP
rs1253630559 2646 dbSNP
rs139788640 2650 dbSNP
rs1450859242 2651 dbSNP
rs1365979020 2658 dbSNP
rs1454599990 2659 dbSNP
rs71333795 2660 dbSNP
rs1158832440 2671 dbSNP
rs1387476783 2672 dbSNP
rs1390271387 2673 dbSNP
rs923640421 2676 dbSNP
rs1043334869 2678 dbSNP
rs1386209860 2682 dbSNP
rs1299070077 2688 dbSNP
rs1337364429 2689 dbSNP
rs1447302515 2693 dbSNP
rs1238820039 2694 dbSNP
rs933262988 2697 dbSNP
rs575330266 2700 dbSNP
rs924616653 2711 dbSNP
rs1215724800 2712 dbSNP
rs1273953607 2713 dbSNP
rs12624912 2720 dbSNP
rs1190020082 2721 dbSNP
rs1253257100 2733 dbSNP
rs1420149431 2738 dbSNP
rs1181576550 2739 dbSNP
rs1276485781 2743 dbSNP
rs1207226475 2744 dbSNP
rs1342701900 2751 dbSNP
rs1166644715 2759 dbSNP
rs1274054101 2768 dbSNP
rs541779369 2769 dbSNP
rs1456950887 2774 dbSNP
rs933732884 2784 dbSNP
rs1398586549 2791 dbSNP
rs1391831684 2797 dbSNP
rs141783065 2807 dbSNP
rs553221081 2811 dbSNP
rs1348380965 2813 dbSNP
rs1447849688 2814 dbSNP
rs374897667 2818 dbSNP
rs1321244354 2827 dbSNP
rs1219492068 2831 dbSNP
rs1253107587 2835 dbSNP
rs1310180976 2836 dbSNP
rs900923958 2848 dbSNP
rs1481246535 2863 dbSNP
rs148043361 2865 dbSNP
rs1370429449 2866 dbSNP
rs1167467467 2880 dbSNP
rs1251103581 2881 dbSNP
rs1418152246 2884 dbSNP
rs1422840814 2887 dbSNP
rs1162095830 2892 dbSNP
rs1374236652 2897 dbSNP
rs1340886842 2898 dbSNP
rs1462484211 2903 dbSNP
rs1307333042 2908 dbSNP
rs1415595947 2913 dbSNP
rs1182070422 2914 dbSNP
rs1368514069 2915 dbSNP
rs1472227297 2916 dbSNP
rs746205211 2917 dbSNP
rs1378757145 2918 dbSNP
rs1226752932 2919 dbSNP
rs1184033301 2924 dbSNP
rs1308150864 2926 dbSNP
rs981974434 2927 dbSNP
rs962115436 2928 dbSNP
rs1014943480 2929 dbSNP
rs1006194868 2930 dbSNP
rs200748876 2931 dbSNP
rs6057883 2932 dbSNP
rs1354431686 2933 dbSNP
rs1263305779 2934 dbSNP
rs1449507041 2934 dbSNP
rs952290187 2935 dbSNP
rs1388269125 2936 dbSNP
rs1436459187 2937 dbSNP
rs1029270211 2938 dbSNP
rs1446182130 2939 dbSNP
rs1491419645 2939 dbSNP
rs1187419872 2940 dbSNP
rs1191689495 2940 dbSNP
rs1207636483 2940 dbSNP
rs1243465484 2940 dbSNP
rs1245591885 2940 dbSNP
rs1278430942 2940 dbSNP
rs1290826131 2940 dbSNP
rs1295448344 2940 dbSNP
rs1310803903 2940 dbSNP
rs1350691597 2940 dbSNP
rs1362813018 2940 dbSNP
rs1387228456 2940 dbSNP
rs1434496926 2940 dbSNP
rs1491564164 2940 dbSNP
rs1410798825 2942 dbSNP
rs1424256230 2944 dbSNP
rs1350455621 2960 dbSNP
rs1042023964 2961 dbSNP
rs945071308 2962 dbSNP
rs1160962677 2968 dbSNP
rs1346048709 2973 dbSNP
rs36074515 2977 dbSNP
rs902042500 2977 dbSNP
rs6059418 2978 dbSNP
rs1373270989 2984 dbSNP
rs989715399 2996 dbSNP
rs938278048 2997 dbSNP
rs1365989782 3017 dbSNP
rs548211640 3022 dbSNP
rs902226911 3024 dbSNP
rs1043391816 3029 dbSNP
rs946409662 3036 dbSNP
rs536226171 3044 dbSNP
rs778551554 3056 dbSNP
rs1207643061 3058 dbSNP
rs565996264 3058 dbSNP
rs527793035 3061 dbSNP
rs1222284473 3062 dbSNP
rs1246078862 3066 dbSNP
rs1178734815 3073 dbSNP
rs1476979133 3073 dbSNP
rs1472779264 3083 dbSNP
rs1412364330 3103 dbSNP
rs1472420272 3106 dbSNP
rs180675174 3121 dbSNP
rs1396833322 3131 dbSNP
rs939281999 3138 dbSNP
rs757216946 3141 dbSNP
rs1026848340 3142 dbSNP
rs1179914114 3144 dbSNP
rs189169081 3145 dbSNP
rs972561159 3156 dbSNP
rs1220862279 3169 dbSNP
rs962448800 3180 dbSNP
rs1350236322 3196 dbSNP
rs963730609 3200 dbSNP
rs984852997 3205 dbSNP
rs372093247 3212 dbSNP
rs1270212293 3225 dbSNP
rs1229465286 3228 dbSNP
rs1328890926 3230 dbSNP
rs1005445524 3234 dbSNP
rs73261870 3235 dbSNP
rs996870428 3239 dbSNP
rs1028123391 3251 dbSNP
rs549936840 3256 dbSNP
rs900913612 3272 dbSNP
rs1420321837 3287 dbSNP
rs1293629246 3298 dbSNP
rs1042570137 3304 dbSNP
rs1411638629 3311 dbSNP
rs945044453 3314 dbSNP
rs1412184944 3316 dbSNP
rs1412252155 3329 dbSNP
rs902672380 3331 dbSNP
rs1022029880 3339 dbSNP
rs1408413809 3342 dbSNP
rs1435098769 3348 dbSNP
rs1341900765 3372 dbSNP
rs530919298 3389 dbSNP
rs1010605387 3392 dbSNP
rs1322133523 3395 dbSNP
rs1457627106 3399 dbSNP
rs894855235 3405 dbSNP
rs1410977062 3409 dbSNP
rs1053401822 3410 dbSNP
rs938225464 3413 dbSNP
rs187653084 3414 dbSNP
rs926885869 3418 dbSNP
rs755935343 3421 dbSNP
rs182044154 3422 dbSNP
rs1477078084 3423 dbSNP
rs1169250707 3426 dbSNP
rs750261818 3427 dbSNP
rs919328925 3428 dbSNP
rs777952935 3434 dbSNP
rs574454146 3439 dbSNP
rs1396317724 3440 dbSNP
rs972585973 3443 dbSNP
rs963504740 3444 dbSNP
rs909191421 3445 dbSNP
rs1266660196 3448 dbSNP
rs986134923 3456 dbSNP
rs1212625351 3457 dbSNP
rs1226005006 3465 dbSNP
rs1282269902 3479 dbSNP
rs939891702 3481 dbSNP
rs1200131930 3483 dbSNP
rs909702005 3484 dbSNP
rs559680037 3487 dbSNP
rs1028280439 3488 dbSNP
rs998027450 3500 dbSNP
rs541157954 3503 dbSNP
rs541409712 3506 dbSNP
rs974736696 3507 dbSNP
rs1378616752 3517 dbSNP
rs1465837343 3519 dbSNP
rs1020690271 3523 dbSNP
rs1171134163 3549 dbSNP
rs1299108353 3552 dbSNP
rs966708428 3567 dbSNP
rs758708732 3579 dbSNP
rs1019217500 3580 dbSNP
rs577458250 3581 dbSNP
rs1303275505 3587 dbSNP
rs1467357458 3593 dbSNP
rs1232303526 3598 dbSNP
rs1272796387 3602 dbSNP
rs1331507747 3604 dbSNP
rs1209585648 3606 dbSNP
rs572590409 3608 dbSNP
rs1053351251 3609 dbSNP
rs1268694303 3610 dbSNP
rs1010615359 3612 dbSNP
rs1001858781 3623 dbSNP
rs905448346 3626 dbSNP
rs143540897 3627 dbSNP
rs765367845 3631 dbSNP
rs1365851138 3634 dbSNP
rs1392104188 3636 dbSNP
rs576227153 3641 dbSNP
rs1186864638 3646 dbSNP
rs1159432839 3659 dbSNP
rs759907350 3661 dbSNP
rs754397065 3665 dbSNP
rs554671833 3668 dbSNP
rs942056119 3673 dbSNP
rs909306175 3677 dbSNP
rs986125081 3678 dbSNP
rs1483781743 3680 dbSNP
rs1386091963 3682 dbSNP
rs953399010 3683 dbSNP
rs1208661769 3684 dbSNP
rs1344856823 3689 dbSNP
rs1036977847 3690 dbSNP
rs2626524 3696 dbSNP
rs977104245 3697 dbSNP
rs1247121222 3701 dbSNP
rs1266038414 3705 dbSNP
rs372248395 3712 dbSNP
rs1021167380 3716 dbSNP
rs189193507 3722 dbSNP
rs1009410615 3724 dbSNP
rs957775167 3731 dbSNP
rs1182509576 3741 dbSNP
rs1410794933 3744 dbSNP
rs1471369074 3757 dbSNP
rs1397620808 3760 dbSNP
rs1379634665 3770 dbSNP
rs1301971758 3774 dbSNP
rs975214706 3780 dbSNP
rs567384865 3781 dbSNP
rs1457408075 3785 dbSNP
rs1291682523 3794 dbSNP
rs1001804753 3805 dbSNP
rs1372276914 3806 dbSNP
rs538595103 3807 dbSNP
rs1046075770 3808 dbSNP
rs1348863284 3815 dbSNP
rs571476472 3818 dbSNP
rs1313602502 3825 dbSNP
rs1321190047 3826 dbSNP
rs1277365465 3828 dbSNP
rs867306398 3831 dbSNP
rs898081775 3833 dbSNP
rs773769915 3835 dbSNP
rs142791405 3843 dbSNP
rs536990118 3844 dbSNP
rs1424558798 3850 dbSNP
rs887861636 3854 dbSNP
rs754147895 3857 dbSNP
rs1256297667 3862 dbSNP
rs569828157 3863 dbSNP
rs368913232 3884 dbSNP
rs773678361 3894 dbSNP
rs931956604 3897 dbSNP
rs923237138 3899 dbSNP
rs1391986367 3901 dbSNP
rs976129091 3908 dbSNP
rs970452550 3912 dbSNP
rs1015671135 3914 dbSNP
rs768236075 3916 dbSNP
rs548307412 3926 dbSNP
rs888330089 3938 dbSNP
rs1048270306 3941 dbSNP
rs996658386 3945 dbSNP
rs1366579970 3947 dbSNP
rs1205329559 3948 dbSNP
rs530133352 3974 dbSNP
rs1228297746 3977 dbSNP
rs1340824123 3979 dbSNP
rs943917380 3980 dbSNP
rs1246537648 3985 dbSNP
rs899651280 3987 dbSNP
rs1256250656 3989 dbSNP
rs1482702422 3999 dbSNP
rs1181222762 4000 dbSNP
rs184428116 4001 dbSNP
rs1450070036 4017 dbSNP
rs987931315 4017 dbSNP
rs957887676 4018 dbSNP
rs1417177989 4020 dbSNP
rs1415936010 4029 dbSNP
rs1032036337 4031 dbSNP
rs1176455719 4036 dbSNP
rs1358833352 4039 dbSNP
rs766454208 4048 dbSNP
rs1308559331 4051 dbSNP
rs541378170 4053 dbSNP
rs1409352790 4054 dbSNP
rs969127048 4062 dbSNP
rs1394439701 4066 dbSNP
rs1025024614 4073 dbSNP
rs1435068853 4082 dbSNP
rs1458635934 4090 dbSNP
rs1370298406 4093 dbSNP
rs1220209361 4097 dbSNP
rs1013260817 4098 dbSNP
rs1300941121 4099 dbSNP
rs1311261833 4105 dbSNP
rs1163291332 4107 dbSNP
rs911901819 4114 dbSNP
rs1464930534 4128 dbSNP
rs1208078492 4135 dbSNP
rs898066638 4141 dbSNP
rs1042749139 4145 dbSNP
rs73261865 4149 dbSNP
rs1413414976 4153 dbSNP
rs374661125 4158 dbSNP
rs915472472 4166 dbSNP
rs989671069 4167 dbSNP
rs1182104198 4181 dbSNP
rs78067214 4184 dbSNP
rs576745505 4186 dbSNP
rs1412862878 4188 dbSNP
rs1456800194 4189 dbSNP
rs1318578565 4191 dbSNP
rs1050597615 4200 dbSNP
rs191837407 4201 dbSNP
rs901934030 4203 dbSNP
rs1293367497 4205 dbSNP
rs1365921641 4211 dbSNP
rs1488630789 4216 dbSNP
rs1272111928 4217 dbSNP
rs1015268231 4218 dbSNP
rs542790379 4219 dbSNP
rs952626293 4221 dbSNP
rs75390814 4222 dbSNP
rs370273960 4229 dbSNP
rs913789204 4230 dbSNP
rs1288687562 4231 dbSNP
rs1227716774 4232 dbSNP
rs769775059 4235 dbSNP
rs996758023 4238 dbSNP
rs745652813 4239 dbSNP
rs1472349667 4248 dbSNP
rs1156911398 4250 dbSNP
rs1387408287 4255 dbSNP
rs899702852 4261 dbSNP
rs1390344430 4263 dbSNP
rs781036806 4264 dbSNP
rs980573847 4267 dbSNP
rs1308970696 4281 dbSNP
rs12624609 4294 dbSNP
rs1408775916 4300 dbSNP
rs1024762455 4302 dbSNP
rs1277334079 4310 dbSNP
rs1357817062 4321 dbSNP
rs1389845120 4322 dbSNP
rs890506188 4325 dbSNP
rs1357145044 4331 dbSNP
rs1207047457 4338 dbSNP
rs1252205293 4351 dbSNP
rs1482886756 4360 dbSNP
rs1042386441 4362 dbSNP
rs992233718 4365 dbSNP
rs752982547 4370 dbSNP
rs2752939 4378 dbSNP
rs915231658 4379 dbSNP
rs1015172217 4382 dbSNP
rs1006450384 4385 dbSNP
rs1379854711 4386 dbSNP
rs1200424098 4387 dbSNP
rs1433261842 4394 dbSNP
rs1473151999 4396 dbSNP
rs556386537 4397 dbSNP
rs778814788 4402 dbSNP
rs1029127908 4408 dbSNP
rs188521427 4412 dbSNP
rs773528135 4413 dbSNP
rs1432095071 4417 dbSNP
rs755051630 4418 dbSNP
rs901921641 4425 dbSNP
rs75654689 4426 dbSNP
rs1010638476 4435 dbSNP
rs1348519502 4437 dbSNP
rs1341841893 4441 dbSNP
rs1448167242 4444 dbSNP
rs891764068 4445 dbSNP
rs567173190 4455 dbSNP
rs1230507246 4475 dbSNP
rs1276515655 4488 dbSNP
rs1341153550 4494 dbSNP
rs1194338710 4501 dbSNP
rs766977982 4502 dbSNP
rs1054402766 4511 dbSNP
rs982656306 4516 dbSNP
rs1209510651 4521 dbSNP
rs368696859 4522 dbSNP
rs2626525 4539 dbSNP
rs1451938133 4543 dbSNP
rs184368592 4543 dbSNP
rs1189742774 4549 dbSNP
rs116481344 4556 dbSNP
rs1301254115 4565 dbSNP
rs1044870981 4566 dbSNP
rs1403916249 4567 dbSNP
rs554924360 4568 dbSNP
rs1320361520 4569 dbSNP
rs547496694 4571 dbSNP
rs917642625 4572 dbSNP
rs1173657072 4574 dbSNP
rs1465929476 4578 dbSNP
rs1298210077 4580 dbSNP
rs1325732178 4584 dbSNP
rs756751235 4588 dbSNP
rs1345992283 4589 dbSNP
rs962114611 4595 dbSNP
rs1261386802 4600 dbSNP
rs1466292398 4602 dbSNP
rs1432359594 4603 dbSNP
rs1209386674 4615 dbSNP
rs1450971430 4620 dbSNP
rs1364031081 4624 dbSNP
rs1247985707 4625 dbSNP
rs192793879 4634 dbSNP
rs1378564512 4638 dbSNP
rs565119106 4647 dbSNP
rs536428757 4664 dbSNP
rs902995237 4670 dbSNP
rs1021021206 4673 dbSNP
rs544155640 4674 dbSNP
rs1426651807 4698 dbSNP
rs566921841 4700 dbSNP
rs1280398788 4702 dbSNP
rs1384167482 4703 dbSNP
rs1380398919 4704 dbSNP
rs1325346031 4718 dbSNP
rs1200965700 4725 dbSNP
rs984459488 4727 dbSNP
rs893849872 4736 dbSNP
rs565916619 4740 dbSNP
rs951738668 4742 dbSNP
rs938285427 4746 dbSNP
rs532039690 4750 dbSNP
rs1260164384 4759 dbSNP
rs546769272 4763 dbSNP
rs1025975610 4767 dbSNP
rs370592888 4770 dbSNP
rs1268549588 4771 dbSNP
rs145705893 4775 dbSNP
rs1197648303 4780 dbSNP
rs1019541997 4782 dbSNP
rs543201981 4785 dbSNP
rs1473328099 4794 dbSNP
rs891881870 4795 dbSNP
rs1054348666 4799 dbSNP
rs572048457 4800 dbSNP
rs1000188738 4801 dbSNP
rs560163525 4803 dbSNP
rs150281167 4805 dbSNP
rs1391305177 4806 dbSNP
rs1404143038 4808 dbSNP
rs919598579 4809 dbSNP
rs1300990173 4821 dbSNP
rs780291618 4823 dbSNP
rs1171259329 4826 dbSNP
rs1431077542 4831 dbSNP
rs975046026 4847 dbSNP
rs1410655959 4860 dbSNP
rs1044986993 4886 dbSNP
rs1390460322 4889 dbSNP
rs577598481 4894 dbSNP
rs964010374 4898 dbSNP
rs1220719398 4903 dbSNP
rs1474191779 4907 dbSNP
rs1019970736 4915 dbSNP
rs1483864902 4922 dbSNP
rs774085073 4924 dbSNP
rs555739984 4925 dbSNP
rs537791964 4926 dbSNP
rs573561082 4927 dbSNP
rs1020074256 4929 dbSNP
rs1423866037 4929 dbSNP
rs1372175429 4930 dbSNP
rs940413787 4933 dbSNP
rs1297803130 4936 dbSNP
rs1009611409 4942 dbSNP
rs1397889340 4948 dbSNP
rs907634361 4950 dbSNP
rs555147380 4953 dbSNP
rs1342957657 4954 dbSNP
rs1272296494 4958 dbSNP
rs1213040480 4959 dbSNP
rs951715504 4961 dbSNP
rs1285187585 4964 dbSNP
rs1233019998 4966 dbSNP
rs1343277465 4969 dbSNP
rs905174852 4974 dbSNP
rs922165112 4984 dbSNP
rs1047115073 4995 dbSNP
rs1250446014 5001 dbSNP
rs974991752 5003 dbSNP
rs949658840 5006 dbSNP
rs966711640 5008 dbSNP
rs376204966 5010 dbSNP
rs1201689851 5017 dbSNP
rs887275648 5020 dbSNP
rs1181650417 5026 dbSNP
rs1391837291 5029 dbSNP
rs1047226700 5033 dbSNP
rs1019072450 5037 dbSNP
rs1354630348 5044 dbSNP
rs931062035 5050 dbSNP
rs919650851 5051 dbSNP
rs1303556244 5052 dbSNP
rs1405434066 5058 dbSNP
rs1451144899 5064 dbSNP
rs1300416519 5071 dbSNP
rs565459083 5073 dbSNP
rs1214357185 5082 dbSNP
rs1010826928 5083 dbSNP
rs1293807857 5084 dbSNP
rs1327549627 5096 dbSNP
rs187544854 5104 dbSNP
rs1033098086 5111 dbSNP
rs528631278 5112 dbSNP
rs912219790 5117 dbSNP
rs1474751414 5118 dbSNP
rs1415673092 5128 dbSNP
rs987164726 5136 dbSNP
rs141089015 5145 dbSNP
rs1417107213 5157 dbSNP
rs1435197384 5162 dbSNP
rs1177379604 5166 dbSNP
rs151097040 5171 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             :||| | |   :|||||| 
Target 5' ---GCACGACU---GCACUCCa 3'
1 - 16
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000344022.3 | 3UTR | GCACGACUGCACUCCAGCCUGGGCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084065
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000344022.3 | 3UTR | GCACGACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.717 4.0e-5 0.716 4.2e-5 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.555 2.0e-3 0.523 3.7e-3 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.57 2.3e-3 -0.485 9.5e-3 23 Click to see details
GSE27834 Pluripotent stem cells -0.531 1.7e-2 -0.453 3.9e-2 16 Click to see details
GSE28260 Renal cortex and medulla 0.547 2.7e-2 0.467 5.4e-2 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.319 6.0e-2 -0.188 1.8e-1 25 Click to see details
GSE17498 Multiple myeloma -0.241 6.7e-2 -0.192 1.2e-1 40 Click to see details
GSE38226 Liver fibrosis 0.327 7.4e-2 0.468 1.6e-2 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.29 1.1e-1 0.254 1.4e-1 20 Click to see details
GSE21849 B cell lymphoma 0.23 1.2e-1 0.194 1.6e-1 29 Click to see details
GSE17306 Multiple myeloma -0.143 1.6e-1 -0.037 4.0e-1 49 Click to see details
GSE19350 CNS germ cell tumors -0.276 1.9e-1 0.087 3.9e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.093 2.3e-1 0.138 1.4e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.217 3.4e-1 -0.086 4.4e-1 6 Click to see details
GSE14794 Lymphoblastoid cells 0.028 4.0e-1 0.002 4.9e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells -0.024 4.6e-1 -0.081 3.5e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.002 5.0e-1 -0.003 4.9e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.215 0.13 -0.135 0.24 29 Click to see details
THCA 0.428 0.24 0.000 0.5 5 Click to see details
STAD 0.296 0.24 0.190 0.33 8 Click to see details
LIHC 0.097 0.25 -0.014 0.46 49 Click to see details
HNSC 0.592 0.3 1.000 0.5 3 Click to see details
CHOL -0.129 0.37 0.183 0.32 9 Click to see details
KICH 0.132 0.38 0.214 0.31 8 Click to see details
ESCA 0.129 0.42 0.100 0.44 5 Click to see details
KIRP 0.017 0.48 -0.400 0.14 9 Click to see details
KIRP 0.017 0.48 -0.400 0.14 9 Click to see details
KIRP 0.017 0.48 -0.400 0.14 9 Click to see details
KIRP 0.017 0.48 -0.400 0.14 9 Click to see details
KIRP 0.017 0.48 -0.400 0.14 9 Click to see details
KIRP 0.017 0.48 -0.400 0.14 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 <