miRTarBase - #MIRT654122 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPS6KA5   
Synonyms MSK1, MSPK1, RLPK
Description ribosomal protein S6 kinase A5
Transcript NM_004755   
Other Transcripts NM_182398   
Expression
Putative miRNA Targets on RPS6KA5
3'UTR of RPS6KA5
(miRNA target sites are highlighted)
>RPS6KA5|NM_004755|3'UTR
   1 GCATGGTAGGAGTGTATCAGTGATCCATTGCACCTTTATTCCCTCAGCATATGCCTGAGGCGATCTTTTATGCTTTTAAA
  81 AATGTTTCCCGTTGGTCTCATTGGAATCTGCCTCCTAATGATTTTTTTCAGGAAAACCTGTTTGGTTATCCTCATTCAAA
 161 AGCACTGGACAGAGAATGTTACTGTGAATAGAGCACATATTACTCTTTTTAGCAACCTAGCATGATGCCAACAAGACTAT
 241 TCTTGAAAGAGCAAAGGTTCCTGTAAATTTAATTAGGGCTAGATTTGAGCTGCTTGTAAGTCACAGGTTTTCCAGATGTC
 321 TGCCAACAAGAAATGACTCATACTGTGATGATACCTTTTGCTTTGCCTTGTGGACAATGTGGGTTTTTGAAATTTGCACC
 401 CTTCAAACAATGATTTATCAGAGAAAGGGGTCTGTTTTCAAAAAAGATTCTGTAATGAATTTTATGTGTGGCATATACTT
 481 ATTTCTTGAGAGAAGATTTTAACTTATTGTTTTTATTTTATGGTTACATATGATGATAACCTGCTATTATTAAACTTTTT
 561 CTAAAAAGTGAAAAAAAAAAAAAAAGATATAAGAACTCAAGGTCCCATACTCTGTATTCGGGATCCATCTGAGATGCATG
 641 CTAAGCTATGTGTATGTTTTTAATTTTGCACTGCTCTTTCCTGGCAATTTGTTTTAATGGTTATTGCAGAATATTAAGGT
 721 ACATGTCTCTCTGTTTTAAGTAATATTGCACTTTATAAAAAAGTATGAATAAAGCAAACTATTTTATAAAGTGCACTGTT
 801 TAAAGCATTTGCACTGTATTTTTGCCATTTATTTTCATTTTCTACTTTAAATTTGTCCTCACATTCCTCTTCTACTTTGT
 881 ATGCAACAAGTAGAATGGGGCATGTTGTGTCATGTAGTCAGCCACTTATGCACCAATGTGAGGAAAACCTAAAGGGAAAT
 961 TAAACTAAACACTGTGCTTCATATTTGTACACTGTGTTGTACTACAGTGAGGAATTTCCTCCTGTAGTCATATATTATGT
1041 ACATAATATTTTAGAATCATACCTATGACTTGTTTGGAAATTTTTCTGTTAAATTTTAAATCCAGAAAGCATATTTTATA
1121 AACTTATGCAGAGCACTTTTATTGCTCAAAAGTTCTGAATTCATACAGAAAACAAGTACTATGTGATGAAAACATTTCAT
1201 TAAAAGATTGCTGCATTTAAAAATACAATTAATTCGTTCCCTATGCAAAAAAAAAAAAAAAAAAAAAAGAAGTGATAGGG
1281 TTTGTGTGTTATATTTTCTTTTAAAGCCATCATGTGAAATGTCAGGACTGAGAAAAGTGATTTTTTTGCTTTGTTTACAG
1361 GAATCATGCTTAAAGAGATAATGCCCAACATGTTTATTTTATAGTTTTTGTTAATGATAACCTTTTGAGCATTAGTTTGG
1441 AATTTGGACATGATATTTATTTATTCCTTTCTTGAGGTTATAGCAGCATTAATTTCAACCAGTTATGAATACTAAAAATA
1521 TTGCACTCTATGTAATAGTAGTATATTTATTACTAAATCAATGTATATATTAATAGCACAGGCAAAAAATGGCAAATATT
1601 AAAATATTTTCAAAATATTATATTATCCTGTTCACATTTTGTCCACAGTGGTTATTGGGAATAATATTTTACACTTTTTG
1681 CTGGCCCAAATGGCTACATAATATTGAGTTAATGAAAGTTTTCTACTCCCAGCTTTCAGTTATTCCTAGTAATTATGGGA
1761 AATTTTGTGTGAATTATTACCAAACTATTGCTAATTCACAAAATGTGATTCCATCAGGCACAGATCTCTAGTAATCAAGA
1841 AAATGACCATATTTATAATTATATTGGACATATTGGGAACATATTTGGCTCTTCAAGCCATTTTTTAAACTGTGCATCCT
1921 GGTAGAAAATACTAGTTATAAAGTACAAACTAAAGGGACTATGTTGCTAATAGAAAATGATCCAGAAAAATGGTCAGACA
2001 GTATACAGATTGATGATGTGATTGATTTCATTGTGAATATTGGAAATTAATGGGTTTCATTTTCATTTATTTCCCTTGCC
2081 TCTTCTTGAGGAGGATTCGACAGGCGATGAAATGGGTAAAAAGGCAGTCAGACTAACAGGAAGAAGGAAAGATAGGCTAG
2161 CTGTCAACTGATGAGCCTGCCTGAATAATCTCAAATGGGCTTTTGAAAAGACCTTAACAAACACTGTTGCACTCTTGTCA
2241 AATATCTTTATCTACACCCTACTTATAAGTACCAAAAAGACAGCATTTGATGCCAAGTTTGAAGCAGTTAGGTCCTATGC
2321 AGGCTGTGTATTAACATACAGTGAATTGCACTTTAAAATTCAGAAAGCTTTCATTTGGTCACATCAAAAATAAACACTAC
2401 AAAATATATAAAAAGTTAAATGATAGGACTCTTTTTTTGGTATTAAGAGTAAAATAGAAGAAGATCTAAGAAATACAAAT
2481 ACTTACATTATTTCTCCTTATGACATTAACTTTGGGACTAGAGCCACACCACCCCCTCCCTTCTTCACTTACTGATTGTA
2561 TTGCATATAATTTTCATGCCAACATAAATCCTGATTCATATATTTTGTAACTGTATATGACAAATTGAGAGGCAAGAATA
2641 AGAAAAGGAAGATAATAGAGGAAAGATGTTAAGAAAGACCAGTTTCTTCTAATTACTCTGCCAGATCGTGTGTCTGAAAG
2721 AGGTTAATTAGCATTTTGAAATTGATTGGCTGAGTGTGGTGGCTCAGGCCTGTAATCCTTGTGCTTTGGGAGTATAAGAC
2801 TGGAGAATCACTTGAAACCAGGAGTTAGAGACCAACCTGGGCAACATAGTGAGACACTGTCTCTCCAAAAATAAAAATAA
2881 AAATTAGCTGAGCATGGTGGCTCATGGGAGGCCAACATGTGGAGGATCGCTTGAGCCCAGGAGTTCGAGGCTGCAGTGAG
2961 CTGTGATCACACCACTGCACTCCAGCCTGGGCAACAGAGCGAGACCCTGTCTTAAGAAAAAAAGAAATTCATTAATTCTT
3041 CCAAACCTTTATAAAGTAAGAAACCACTGAATTACTAGAATAGAAAGTCAGTCTCCTGAGTTAATTTCCACATTGTTGTC
3121 TGTCTTGGAGTCACAGGTTCATTACCCAAGAAAACTGCCTTTTAATTTTTTTAGATTACTGTTGATTTCTTAAGTATGTA
3201 AATGACTAACTTTTAAATATAAGGTAAGTTATTTTAAAGAAATCTACTAAGATAGAAGTCACTTTTTTTAAAGTAAGGAA
3281 ATTCCTTTTGTATCTCAGTTTATGTTCTCAAATACACTACTTTATAAAAGTATACAATTGACTGGATACTTATTCACCTT
3361 GCCCCCATTTCAAGCGCCTGTTATTGTCATATTTATTAAAAACAGGGTACCTCATAATGGTGAAAATTTCTAAATTATTG
3441 GGTCTATATGTGCCTTAGACTGCCTGATTACTTTGGCTGTTCTCCCAGTGACTGATAATAATAGCATGATTTGAGTGTTC
3521 ATGTGAGAATACATCTAATATTCCTTAAGATCTAAGTAAATAAGTTAAATTCTGATATGCCACTTATGTCAAAATAATTG
3601 TTATATAGATGAATTATTACTGTAACATCATGAAGTATCTTAAAATTATATGACTTTTGGCCTCTCAAATGTCTTACATG
3681 ATAATACCCCAATTTCCAGTCTTTAATTGATTGTATACCTCACGTAAGTGTCTGTCATCACTTGATACCTGTATCTGGCA
3761 CTAAAACAAATGTAGCCGGCTCTAATGAAATTTGAAGTTTGGATAGGAGACATTGTAAAACTCAAGAATGGGAAAAAAAA
3841 ATTTTAACAGAAGTATGTATGAAGGAAATATTTTAAGTATAATCTACCCAAAGAAAATAACTGCTACAGCCAACATTAAA
3921 GGTTTTATTCCCTGTTTTGTTAAGTAACTTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||||| |   :|||||| 
Target 5' atcACACCACT---GCACTCCa 3'
2966 - 2984 144.00 -18.50
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||  :::|  |||||:||| 
Target 5' ttAAATTTGTCCTCACATTCCt 3'
847 - 868 140.00 -11.80
3
miRNA  3' guUUG-UGGUAACAGUGUGAGGu 5'
            ||| | || |||::|||||: 
Target 5' ttAACAAACACTGTTGCACTCTt 3'
2214 - 2236 140.00 -19.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30490620 9 COSMIC
COSN510492 10 COSMIC
COSN30483091 42 COSMIC
COSN30158894 49 COSMIC
COSN31520034 54 COSMIC
COSN30119420 60 COSMIC
COSN30181790 70 COSMIC
COSN30193764 78 COSMIC
COSN30458265 88 COSMIC
COSN30509892 102 COSMIC
COSN30189432 117 COSMIC
COSN30511379 149 COSMIC
COSN30160958 235 COSMIC
COSN5392983 253 COSMIC
COSN505784 570 COSMIC
COSN20111603 571 COSMIC
COSN8589075 669 COSMIC
COSN30544156 775 COSMIC
COSN1666090 887 COSMIC
COSN21308627 907 COSMIC
COSN8388078 913 COSMIC
COSN30541597 922 COSMIC
COSN14619346 1076 COSMIC
COSN31516090 1149 COSMIC
COSN8589074 1230 COSMIC
COSN31552673 1235 COSMIC
COSN26640539 1240 COSMIC
COSN26644308 1245 COSMIC
COSN20567806 1855 COSMIC
COSN17031056 2219 COSMIC
COSN26820707 2578 COSMIC
COSN15326329 2689 COSMIC
COSN4760327 3777 COSMIC
COSN7033479 3841 COSMIC
COSN17574418 4182 COSMIC
COSN17677805 4377 COSMIC
COSN27585606 4726 COSMIC
COSN29382830 5061 COSMIC
COSN32147332 6072 COSMIC
COSN21143998 6178 COSMIC
COSN28321639 6415 COSMIC
COSN20320558 6751 COSMIC
COSN6264276 6771 COSMIC
COSN29826748 7331 COSMIC
COSN21945980 7432 COSMIC
COSN7033478 7638 COSMIC
COSN5752097 7898 COSMIC
COSN32147331 8620 COSMIC
COSN19363665 8733 COSMIC
COSN17980839 8743 COSMIC
COSN26651872 8995 COSMIC
COSN25427582 9078 COSMIC
COSN1666089 9480 COSMIC
COSN1666088 9616 COSMIC
COSN16624162 9619 COSMIC
COSN16537108 9639 COSMIC
COSN7033477 9766 COSMIC
COSN7033476 10222 COSMIC
COSN30070311 10850 COSMIC
COSN6639403 11060 COSMIC
COSN15059766 11437 COSMIC
COSN9620588 12019 COSMIC
COSN9620587 12729 COSMIC
COSN8461626 12793 COSMIC
COSN26311454 12948 COSMIC
COSN8461625 12999 COSMIC
COSN9620586 13038 COSMIC
COSN20142660 13156 COSMIC
COSN16695604 13231 COSMIC
COSN15840807 13351 COSMIC
COSN14626739 13520 COSMIC
COSN8812360 13653 COSMIC
COSN8159398 13691 COSMIC
COSN6264275 13905 COSMIC
COSN21018204 14404 COSMIC
COSN29698850 14727 COSMIC
COSN1172794 14730 COSMIC
COSN21321444 15465 COSMIC
COSN1172793 15500 COSMIC
COSN28078218 15554 COSMIC
COSN5392982 15971 COSMIC
COSN6264274 16129 COSMIC
COSN7033475 16138 COSMIC
COSN22662068 16536 COSMIC
COSN21503944 16886 COSMIC
COSN24485336 16956 COSMIC
COSN23178327 16963 COSMIC
COSN5172772 17051 COSMIC
COSN1666087 17353 COSMIC
COSN16579948 17442 COSMIC
COSN22291545 17634 COSMIC
COSN14537201 17648 COSMIC
COSN22245364 17651 COSMIC
COSN1666086 17727 COSMIC
COSN1666085 17909 COSMIC
COSN4760326 18315 COSMIC
COSN16815544 18452 COSMIC
COSN20985437 18505 COSMIC
COSN27261660 18581 COSMIC
COSN29526239 19047 COSMIC
COSN22816382 19161 COSMIC
COSN22354408 19233 COSMIC
COSN8461624 19428 COSMIC
COSN20214310 19479 COSMIC
COSN1666084 19482 COSMIC
COSN7033474 19604 COSMIC
COSN16493449 19826 COSMIC
COSN22513009 20325 COSMIC
COSN7033473 20422 COSMIC
COSN5392980 20700 COSMIC
COSN16704871 21272 COSMIC
COSN27549649 21593 COSMIC
COSN8812359 21735 COSMIC
COSN29831551 22058 COSMIC
COSN25371510 22493 COSMIC
COSN5392979 22595 COSMIC
COSN28473466 23397 COSMIC
rs75055810 9032 GWAS
SNPs in gene 3'UTRs
<
Mutant ID Mutant Position Mutant Source
rs1002737953 3 dbSNP
rs367591784 8 dbSNP
rs201075477 16 dbSNP
rs772575903 16 dbSNP
rs574445731 24 dbSNP
rs186008852 26 dbSNP
rs374026125 27 dbSNP
rs1412735736 32 dbSNP
rs369570559 37 dbSNP
rs1228045512 42 dbSNP
rs756451627 43 dbSNP
rs998580083 47 dbSNP
rs554836655 61 dbSNP
rs1289713170 62 dbSNP
rs1450410390 65 dbSNP
rs1218684631 67 dbSNP
rs375924085 70 dbSNP
rs1483120761 71 dbSNP
rs1180979002 78 dbSNP
rs750733123 91 dbSNP
rs1473652236 108 dbSNP
rs1163625666 114 dbSNP
rs1243383030 115 dbSNP
rs1412906645 129 dbSNP
rs146942753 143 dbSNP
rs531603481 147 dbSNP
rs141832261 159 dbSNP
rs1409338347 161 dbSNP
rs1306387343 163 dbSNP
rs1449139252 165 dbSNP
rs1039296069 171 dbSNP
rs769528460 172 dbSNP
rs943337122 187 dbSNP
rs1276035446 192 dbSNP
rs909235011 197 dbSNP
rs984815701 200 dbSNP
rs1390048133 205 dbSNP
rs1247896323 206 dbSNP
rs758869722 214 dbSNP
rs965110617 219 dbSNP
rs929364519 225 dbSNP
rs919376855 238 dbSNP
rs1164306505 243 dbSNP
rs981269411 247 dbSNP
rs537676979 280 dbSNP
rs1428828569 291 dbSNP
rs539388386 296 dbSNP
rs1429178781 300 dbSNP
rs971256419 305 dbSNP
rs1415758687 320 dbSNP
rs570748905 327 dbSNP
rs1473004956 333 dbSNP
rs991432504 336 dbSNP
rs1415290939 338 dbSNP
rs1333808888 340 dbSNP
rs957237865 348 dbSNP
rs1032620381 349 dbSNP
rs1298987473 354 dbSNP
rs1365112856 355 dbSNP
rs998504982 365 dbSNP
rs902939110 371 dbSNP
rs1029371109 377 dbSNP
rs1346635547 378 dbSNP
rs147965359 393 dbSNP
rs998059389 400 dbSNP
rs1277532674 411 dbSNP
rs1459801483 413 dbSNP
rs1209151568 418 dbSNP
rs902022747 421 dbSNP
rs1001126472 428 dbSNP
rs1467133534 430 dbSNP
rs537044952 434 dbSNP
rs1269405761 446 dbSNP
rs1191068353 456 dbSNP
rs1228482257 466 dbSNP
rs183140638 471 dbSNP
rs1277437551 475 dbSNP
rs547996114 479 dbSNP
rs1333173799 482 dbSNP
rs1388484016 483 dbSNP
rs781027533 506 dbSNP
rs191388481 507 dbSNP
rs1233407833 509 dbSNP
rs896572695 533 dbSNP
rs1320975637 543 dbSNP
rs11848393 561 dbSNP
rs1322571438 562 dbSNP
rs1457858377 563 dbSNP
rs1464308385 563 dbSNP
rs1055171468 569 dbSNP
rs1157015735 570 dbSNP
rs1452251935 571 dbSNP
rs1002583595 577 dbSNP
rs1479161340 578 dbSNP
rs74486405 584 dbSNP
rs10710825 586 dbSNP
rs1456017073 586 dbSNP
rs1473707239 586 dbSNP
rs796687690 586 dbSNP
rs888059744 589 dbSNP
rs1049086094 590 dbSNP
rs887789774 591 dbSNP
rs1386779266 598 dbSNP
rs1048767523 600 dbSNP
rs931261477 607 dbSNP
rs1229821829 613 dbSNP
rs1286267 619 dbSNP
rs552721938 620 dbSNP
rs1236701591 624 dbSNP
rs1267075453 630 dbSNP
rs1249840144 634 dbSNP
rs768038906 637 dbSNP
rs1356984542 638 dbSNP
rs1209262156 647 dbSNP
rs1266902175 648 dbSNP
rs376762862 650 dbSNP
rs1183136803 654 dbSNP
rs943889152 657 dbSNP
rs912305510 670 dbSNP
rs1369490307 675 dbSNP
rs185962406 681 dbSNP
rs1457871778 687 dbSNP
rs180710136 691 dbSNP
rs915764124 696 dbSNP
rs1411191435 709 dbSNP
rs1308257475 715 dbSNP
rs1349501132 716 dbSNP
rs991754913 719 dbSNP
rs957297934 726 dbSNP
rs543668557 731 dbSNP
rs530052466 733 dbSNP
rs1314641203 736 dbSNP
rs1032924345 745 dbSNP
rs879458840 751 dbSNP
rs1490835266 757 dbSNP
rs1243935922 763 dbSNP
rs977016881 769 dbSNP
rs924989584 771 dbSNP
rs561310348 774 dbSNP
rs1274104991 775 dbSNP
rs1345367638 781 dbSNP
rs980062769 787 dbSNP
rs1257268573 788 dbSNP
rs1423646447 789 dbSNP
rs1182272906 791 dbSNP
rs1392646374 793 dbSNP
rs1431036469 794 dbSNP
rs541196172 811 dbSNP
rs1353514274 812 dbSNP
rs1271131115 814 dbSNP
rs572489405 816 dbSNP
rs1460178157 838 dbSNP
rs997965257 851 dbSNP
rs575373029 855 dbSNP
rs45497398 856 dbSNP
rs190447773 857 dbSNP
rs1367270982 861 dbSNP
rs888028682 862 dbSNP
rs1296991228 863 dbSNP
rs1053460 865 dbSNP
rs1436515861 870 dbSNP
rs1049341831 874 dbSNP
rs993460368 875 dbSNP
rs1256871865 878 dbSNP
rs374579104 898 dbSNP
rs557300042 900 dbSNP
rs1316398489 902 dbSNP
rs1250387221 903 dbSNP
rs1450666235 904 dbSNP
rs1416315858 905 dbSNP
rs897840912 909 dbSNP
rs1188601186 921 dbSNP
rs1403196223 925 dbSNP
rs887748306 926 dbSNP
rs1177769123 929 dbSNP
rs76627395 930 dbSNP
rs1027640761 931 dbSNP
rs1334459034 934 dbSNP
rs1390680651 936 dbSNP
rs1046206741 940 dbSNP
rs17127097 955 dbSNP
rs866634472 968 dbSNP
rs1288267464 971 dbSNP
rs866447674 982 dbSNP
rs916009833 987 dbSNP
rs1221080873 988 dbSNP
rs1302168263 999 dbSNP
rs897069879 1002 dbSNP
rs1465661634 1004 dbSNP
rs1208623926 1007 dbSNP
rs1036982001 1008 dbSNP
rs199698869 1019 dbSNP
rs1484602562 1030 dbSNP
rs1192433774 1031 dbSNP
rs1425364313 1032 dbSNP
rs1055623726 1034 dbSNP
rs1173935198 1035 dbSNP
rs1355743091 1039 dbSNP
rs538361412 1063 dbSNP
rs1457625945 1065 dbSNP
rs935839621 1069 dbSNP
rs1053461 1091 dbSNP
rs1343369906 1092 dbSNP
rs925838705 1096 dbSNP
rs1294222319 1104 dbSNP
rs977322765 1109 dbSNP
rs1403305063 1111 dbSNP
rs943818517 1115 dbSNP
rs1330222298 1127 dbSNP
rs1223642295 1128 dbSNP
rs1282684043 1133 dbSNP
rs890966555 1136 dbSNP
rs1246814147 1146 dbSNP
rs1049919637 1149 dbSNP
rs1196823693 1160 dbSNP
rs1253612034 1163 dbSNP
rs554526065 1181 dbSNP
rs1157800638 1190 dbSNP
rs1405643479 1193 dbSNP
rs1407047082 1195 dbSNP
rs1277504881 1199 dbSNP
rs1053462 1202 dbSNP
rs1165449927 1206 dbSNP
rs1263832511 1211 dbSNP
rs1053463 1212 dbSNP
rs1310077330 1215 dbSNP
rs777307650 1223 dbSNP
rs1346130576 1224 dbSNP
rs1277277041 1226 dbSNP
rs1229781767 1230 dbSNP
rs1308397269 1233 dbSNP
rs535646164 1235 dbSNP
rs73322598 1236 dbSNP
rs551940294 1244 dbSNP
rs77129062 1245 dbSNP
rs1294184289 1246 dbSNP
rs1219625642 1247 dbSNP
rs1278017976 1247 dbSNP
rs74981916 1248 dbSNP
rs1450322609 1255 dbSNP
rs1483194253 1257 dbSNP
rs925048746 1264 dbSNP
rs979119363 1265 dbSNP
rs963824310 1266 dbSNP
rs1312465186 1267 dbSNP
rs1018482716 1268 dbSNP
rs1491451682 1268 dbSNP
rs1021128263 1269 dbSNP
rs1170575434 1269 dbSNP
rs1243078398 1269 dbSNP
rs1314882854 1269 dbSNP
rs1327148728 1269 dbSNP
rs1361247702 1269 dbSNP
rs1371346350 1269 dbSNP
rs1381244296 1269 dbSNP
rs1398659340 1269 dbSNP
rs1409639426 1269 dbSNP
rs1449304171 1269 dbSNP
rs1491338961 1269 dbSNP
rs78409439 1269 dbSNP
rs878935535 1269 dbSNP
rs147818177 1270 dbSNP
rs1413216525 1272 dbSNP
rs1415344658 1272 dbSNP
rs1372159255 1276 dbSNP
rs1007685295 1291 dbSNP
rs952196351 1297 dbSNP
rs1009313622 1298 dbSNP
rs1336511668 1301 dbSNP
rs945078379 1303 dbSNP
rs1409237507 1305 dbSNP
rs1417316692 1312 dbSNP
rs993765925 1321 dbSNP
rs898102326 1323 dbSNP
rs1321866902 1326 dbSNP
rs1164445456 1333 dbSNP
rs186144917 1340 dbSNP
rs1014704557 1341 dbSNP
rs1256245333 1348 dbSNP
rs1267973273 1348 dbSNP
rs894556384 1359 dbSNP
rs1346695774 1360 dbSNP
rs181802610 1361 dbSNP
rs960840315 1365 dbSNP
rs1056290544 1366 dbSNP
rs981378522 1370 dbSNP
rs1210487876 1377 dbSNP
rs935808336 1378 dbSNP
rs925808977 1383 dbSNP
rs952143271 1392 dbSNP
rs1480906733 1393 dbSNP
rs1028191560 1396 dbSNP
rs1427615574 1400 dbSNP
rs1041556303 1402 dbSNP
rs1160543956 1415 dbSNP
rs1384874826 1418 dbSNP
rs1381102804 1421 dbSNP
rs993503907 1430 dbSNP
rs945955397 1435 dbSNP
rs1307375964 1446 dbSNP
rs922546828 1447 dbSNP
rs1271539360 1456 dbSNP
rs1230567663 1457 dbSNP
rs1282293953 1459 dbSNP
rs111289522 1464 dbSNP
rs897835863 1466 dbSNP
rs1230009512 1472 dbSNP
rs1292807391 1486 dbSNP
rs1349899484 1492 dbSNP
rs1015479908 1495 dbSNP
rs1413167302 1512 dbSNP
rs976444912 1523 dbSNP
rs1269524535 1537 dbSNP
rs1490549493 1544 dbSNP
rs1198954585 1545 dbSNP
rs1267124349 1551 dbSNP
rs546191064 1561 dbSNP
rs910937588 1562 dbSNP
rs983882216 1565 dbSNP
rs1363673882 1572 dbSNP
rs1452294587 1574 dbSNP
rs1165549958 1576 dbSNP
rs952166570 1580 dbSNP
rs1049567385 1584 dbSNP
rs536236536 1590 dbSNP
rs993694262 1604 dbSNP
rs1302071474 1611 dbSNP
rs778522091 1615 dbSNP
rs1343274291 1619 dbSNP
rs1411377162 1620 dbSNP
rs1307483621 1627 dbSNP
rs1334995115 1628 dbSNP
rs903594114 1633 dbSNP
rs1352653226 1640 dbSNP
rs1267212042 1657 dbSNP
rs1360255792 1658 dbSNP
rs962280416 1661 dbSNP
rs189062320 1664 dbSNP
rs1484169829 1670 dbSNP
rs1196704337 1671 dbSNP
rs1014222312 1672 dbSNP
rs913590641 1682 dbSNP
rs894479937 1684 dbSNP
rs530310249 1685 dbSNP
rs369852297 1687 dbSNP
rs754993626 1703 dbSNP
rs904646356 1728 dbSNP
rs1463171980 1730 dbSNP
rs1298444744 1776 dbSNP
rs1041526140 1785 dbSNP
rs770819187 1790 dbSNP
rs146911044 1793 dbSNP
rs1041365527 1798 dbSNP
rs547763230 1801 dbSNP
rs1383452208 1805 dbSNP
rs942349566 1812 dbSNP
rs1480491005 1813 dbSNP
rs972145407 1817 dbSNP
rs1344454120 1822 dbSNP
rs1224406979 1824 dbSNP
rs910895874 1825 dbSNP
rs867141142 1826 dbSNP
rs1251025133 1828 dbSNP
rs527826785 1834 dbSNP
rs1202547759 1838 dbSNP
rs1244239011 1843 dbSNP
rs962014331 1849 dbSNP
rs1182335734 1855 dbSNP
rs1272555214 1862 dbSNP
rs374824204 1864 dbSNP
rs1331431702 1872 dbSNP
rs1170710280 1875 dbSNP
rs1372153727 1884 dbSNP
rs931035962 1889 dbSNP
rs1338478475 1890 dbSNP
rs918372389 1897 dbSNP
rs1451784215 1900 dbSNP
rs1334666386 1902 dbSNP
rs777757142 1911 dbSNP
rs972222653 1918 dbSNP
rs1367423002 1930 dbSNP
rs565381045 1943 dbSNP
rs1295039946 1946 dbSNP
rs1306006787 1947 dbSNP
rs1370880272 1949 dbSNP
rs141020038 1950 dbSNP
rs1264113639 1956 dbSNP
rs962524400 1958 dbSNP
rs1024532033 1961 dbSNP
rs1028692486 1962 dbSNP
rs1202791050 1964 dbSNP
rs1250519227 1970 dbSNP
rs755083434 1977 dbSNP
rs959012059 1979 dbSNP
rs996659517 1987 dbSNP
rs766580020 1993 dbSNP
rs1034301242 1998 dbSNP
rs903687753 2000 dbSNP
rs1393657568 2004 dbSNP
rs1323251391 2005 dbSNP
rs1458387183 2007 dbSNP
rs1346900189 2010 dbSNP
rs1388779524 2013 dbSNP
rs1157882197 2018 dbSNP
rs1043461419 2022 dbSNP
rs1288397980 2052 dbSNP
rs202180250 2053 dbSNP
rs151092997 2075 dbSNP
rs563444426 2080 dbSNP
rs543767064 2083 dbSNP
rs1323271263 2085 dbSNP
rs1222076675 2093 dbSNP
rs939057278 2094 dbSNP
rs926885217 2098 dbSNP
rs1215827136 2099 dbSNP
rs1259594778 2101 dbSNP
rs1020330825 2104 dbSNP
rs1009993269 2105 dbSNP
rs7155799 2106 dbSNP
rs1261438023 2111 dbSNP
rs1197028516 2115 dbSNP
rs920778795 2115 dbSNP
rs1401186560 2127 dbSNP
rs1158361153 2128 dbSNP
rs972112944 2132 dbSNP
rs1426703794 2142 dbSNP
rs962107604 2143 dbSNP
rs1256183082 2149 dbSNP
rs1315427527 2152 dbSNP
rs1281669103 2161 dbSNP
rs531884866 2172 dbSNP
rs1223692540 2174 dbSNP
rs1280402491 2179 dbSNP
rs912003321 2186 dbSNP
rs1219606630 2194 dbSNP
rs987461863 2198 dbSNP
rs1040942207 2202 dbSNP
rs1291978740 2207 dbSNP
rs1490090672 2210 dbSNP
rs78200003 2221 dbSNP
rs780158096 2225 dbSNP
rs1437245178 2227 dbSNP
rs8018757 2231 dbSNP
rs967880255 2235 dbSNP
rs1022073694 2237 dbSNP
rs1164324133 2239 dbSNP
rs1365143452 2241 dbSNP
rs1009382094 2257 dbSNP
rs1451088981 2259 dbSNP
rs571907738 2260 dbSNP
rs1056174893 2268 dbSNP
rs931004738 2271 dbSNP
rs1278221902 2274 dbSNP
rs1435767776 2275 dbSNP
rs184294339 2283 dbSNP
rs918300502 2291 dbSNP
rs904858353 2292 dbSNP
rs538318743 2293 dbSNP
rs1262513733 2296 dbSNP
rs930903122 2317 dbSNP
rs972490459 2320 dbSNP
rs1484987134 2340 dbSNP
rs1203579221 2341 dbSNP
rs569946755 2343 dbSNP
rs1231059229 2345 dbSNP
rs767916031 2349 dbSNP
rs1258018281 2364 dbSNP
rs920883701 2373 dbSNP
rs1384659443 2383 dbSNP
rs1442915629 2387 dbSNP
rs757602655 2388 dbSNP
rs1420496202 2391 dbSNP
rs1409689651 2394 dbSNP
rs1036513885 2407 dbSNP
rs1453966437 2423 dbSNP
rs940874552 2433 dbSNP
rs917388144 2434 dbSNP
rs911945371 2439 dbSNP
rs1346848086 2440 dbSNP
rs1277988808 2441 dbSNP
rs1230512464 2442 dbSNP
rs987556865 2443 dbSNP
rs1308006889 2445 dbSNP
rs1294168369 2446 dbSNP
rs752072231 2447 dbSNP
rs1380841903 2449 dbSNP
rs1271519335 2457 dbSNP
rs931978282 2458 dbSNP
rs993041284 2460 dbSNP
rs959207193 2462 dbSNP
rs1213735747 2467 dbSNP
rs1255879858 2482 dbSNP
rs1325478737 2485 dbSNP
rs1034605141 2486 dbSNP
rs921941792 2487 dbSNP
rs978696485 2503 dbSNP
rs1242866960 2504 dbSNP
rs1475226592 2507 dbSNP
rs968701269 2513 dbSNP
rs1020294664 2514 dbSNP
rs968353753 2516 dbSNP
rs1172239143 2518 dbSNP
rs1432097792 2523 dbSNP
rs1404556286 2529 dbSNP
rs1393744945 2532 dbSNP
rs1010753190 2534 dbSNP
rs1022211088 2546 dbSNP
rs867030539 2554 dbSNP
rs987924658 2561 dbSNP
rs965512769 2565 dbSNP
rs1019851777 2567 dbSNP
rs956543607 2578 dbSNP
rs549949902 2582 dbSNP
rs1034690476 2584 dbSNP
rs764594146 2595 dbSNP
rs1003720169 2596 dbSNP
rs1169775857 2600 dbSNP
rs1206930714 2602 dbSNP
rs1006757323 2607 dbSNP
rs1191775112 2608 dbSNP
rs181450876 2614 dbSNP
rs762383768 2617 dbSNP
rs552766320 2623 dbSNP
rs904827690 2637 dbSNP
rs1188902035 2649 dbSNP
rs1480936208 2650 dbSNP
rs1199179653 2664 dbSNP
rs8014028 2666 dbSNP
rs995136501 2671 dbSNP
rs896843325 2679 dbSNP
rs560567603 2686 dbSNP
rs371174032 2707 dbSNP
rs1036623737 2708 dbSNP
rs1282430918 2716 dbSNP
rs1329175500 2729 dbSNP
rs1241084095 2731 dbSNP
rs949146550 2733 dbSNP
rs1349963468 2739 dbSNP
rs1250724238 2750 dbSNP
rs774803258 2754 dbSNP
rs547724965 2755 dbSNP
rs1294164648 2763 dbSNP
rs1225208596 2765 dbSNP
rs527692476 2781 dbSNP
rs940799566 2783 dbSNP
rs1222082227 2789 dbSNP
rs1265684855 2802 dbSNP
rs565098324 2804 dbSNP
rs890647441 2818 dbSNP
rs1183155126 2828 dbSNP
rs1363731093 2834 dbSNP
rs1057483387 2835 dbSNP
rs1051821153 2838 dbSNP
rs932047421 2839 dbSNP
rs937529098 2842 dbSNP
rs927518292 2846 dbSNP
rs978998727 2847 dbSNP
rs979171248 2848 dbSNP
rs376509197 2851 dbSNP
rs1168328637 2854 dbSNP
rs569984661 2856 dbSNP
rs540306836 2859 dbSNP
rs968663916 2871 dbSNP
rs1238007612 2879 dbSNP
rs1360327189 2885 dbSNP
rs1397706359 2885 dbSNP
rs1298083571 2886 dbSNP
rs1460965615 2887 dbSNP
rs1245495854 2900 dbSNP
rs1263964327 2903 dbSNP
rs142867116 2928 dbSNP
rs988854572 2929 dbSNP
rs956514246 2946 dbSNP
rs1474968725 2947 dbSNP
rs1186008204 2950 dbSNP
rs1415988117 2953 dbSNP
rs148546615 2955 dbSNP
rs189673826 2956 dbSNP
rs1249620426 2966 dbSNP
rs1168316115 2977 dbSNP
rs1007096116 2992 dbSNP
rs1444455255 2997 dbSNP
rs1338689806 2998 dbSNP
rs1193992026 3000 dbSNP
rs953866935 3001 dbSNP
rs558029951 3006 dbSNP
rs1309510442 3016 dbSNP
rs1228565935 3024 dbSNP
rs994878045 3024 dbSNP
rs1026875397 3028 dbSNP
rs1489462647 3028 dbSNP
rs995405110 3029 dbSNP
rs1244297546 3032 dbSNP
rs897104387 3042 dbSNP
rs1461330086 3047 dbSNP
rs574500636 3051 dbSNP
rs1013294155 3057 dbSNP
rs896186959 3064 dbSNP
rs1054891652 3065 dbSNP
rs1180794950 3066 dbSNP
rs1015162488 3067 dbSNP
rs1273195989 3077 dbSNP
rs937480214 3077 dbSNP
rs1193512004 3081 dbSNP
rs1422634545 3083 dbSNP
rs539020584 3108 dbSNP
rs1463934468 3110 dbSNP
rs1212539913 3127 dbSNP
rs927482660 3130 dbSNP
rs1465568096 3156 dbSNP
rs1043228097 3157 dbSNP
rs561245660 3159 dbSNP
rs1005151567 3173 dbSNP
rs1332164705 3173 dbSNP
rs947624949 3178 dbSNP
rs1295198433 3179 dbSNP
rs757901010 3187 dbSNP
rs890742239 3198 dbSNP
rs1239380658 3204 dbSNP
rs1264244683 3211 dbSNP
rs1323487829 3212 dbSNP
rs1336712385 3213 dbSNP
rs1208690016 3220 dbSNP
rs1253715117 3223 dbSNP
rs1306816181 3224 dbSNP
rs913518816 3228 dbSNP
rs932210736 3229 dbSNP
rs1262029848 3242 dbSNP
rs1476686941 3246 dbSNP
rs540935719 3248 dbSNP
rs1201349416 3250 dbSNP
rs1429864579 3257 dbSNP
rs1432497716 3258 dbSNP
rs1173927581 3270 dbSNP
rs1347026002 3270 dbSNP
rs1454432663 3270 dbSNP
rs764402896 3271 dbSNP
rs572029758 3280 dbSNP
rs558111371 3288 dbSNP
rs1043151760 3290 dbSNP
rs1407103022 3291 dbSNP
rs947335099 3297 dbSNP
rs1367400980 3298 dbSNP
rs1326600865 3302 dbSNP
rs965408988 3313 dbSNP
rs913251683 3318 dbSNP
rs1318134791 3322 dbSNP
rs1215905328 3323 dbSNP
rs912603139 3327 dbSNP
rs1487123713 3328 dbSNP
rs1224305582 3333 dbSNP
rs985575565 3337 dbSNP
rs1488069188 3338 dbSNP
rs1052273717 3346 dbSNP
rs544739457 3349 dbSNP
rs1419698300 3352 dbSNP
rs1158154363 3353 dbSNP
rs1378587159 3354 dbSNP
rs1026806182 3358 dbSNP
rs973936381 3365 dbSNP
rs1304038825 3375 dbSNP
rs763458662 3376 dbSNP
rs1015515105 3389 dbSNP
rs575726668 3396 dbSNP
rs1013638508 3406 dbSNP
rs1374727985 3411 dbSNP
rs1240195116 3414 dbSNP
rs759303341 3416 dbSNP
rs1307862900 3421 dbSNP
rs1253573276 3422 dbSNP
rs1247703262 3430 dbSNP
rs1290232624 3442 dbSNP
rs556388241 3450 dbSNP
rs1450757320 3451 dbSNP
rs536853620 3451 dbSNP
rs146780842 3463 dbSNP
rs574757523 3479 dbSNP
rs973195876 3505 dbSNP
rs910334697 3506 dbSNP
rs184394515 3515 dbSNP
rs1413357996 3540 dbSNP
rs1403908904 3550 dbSNP
rs868148617 3552 dbSNP
rs1355522600 3560 dbSNP
rs1446671260 3564 dbSNP
rs1001888223 3574 dbSNP
rs1454123358 3575 dbSNP
rs534195980 3577 dbSNP
rs1269536240 3583 dbSNP
rs1226295141 3587 dbSNP
rs571694667 3587 dbSNP
rs1274829847 3588 dbSNP
rs1318404817 3588 dbSNP
rs1043197076 3590 dbSNP
rs900669801 3597 dbSNP
rs1462660960 3602 dbSNP
rs1043508900 3604 dbSNP
rs775921557 3605 dbSNP
rs1471916734 3615 dbSNP
rs1188559718 3624 dbSNP
rs1420655134 3638 dbSNP
rs1465496330 3639 dbSNP
rs891909465 3642 dbSNP
rs1053029915 3647 dbSNP
rs1408958699 3649 dbSNP
rs1470647146 3652 dbSNP
rs1349504449 3662 dbSNP
rs1334213008 3663 dbSNP
rs776402849 3681 dbSNP
rs1265385391 3683 dbSNP
rs938723584 3685 dbSNP
rs927862520 3691 dbSNP
rs1340824465 3707 dbSNP
rs1217795774 3715 dbSNP
rs1256018441 3717 dbSNP
rs1046312605 3721 dbSNP
rs947856847 3724 dbSNP
rs1440889028 3726 dbSNP
rs892007304 3741 dbSNP
rs770910774 3753 dbSNP
rs551783639 3755 dbSNP
rs963107110 3766 dbSNP
rs907667015 3777 dbSNP
rs983109809 3778 dbSNP
rs1401436700 3784 dbSNP
rs1191990261 3792 dbSNP
rs1384544960 3793 dbSNP
rs1431954125 3796 dbSNP
rs1481036295 3797 dbSNP
rs1172564822 3803 dbSNP
rs1400863778 3804 dbSNP
rs1156544386 3806 dbSNP
rs1467359878 3807 dbSNP
rs1412262359 3812 dbSNP
rs944007300 3813 dbSNP
rs1360787838 3821 dbSNP
rs912582287 3826 dbSNP
rs1276039658 3831 dbSNP
rs1347224114 3833 dbSNP
rs1030958295 3841 dbSNP
rs1225552329 3842 dbSNP
rs1274255309 3842 dbSNP
rs76564743 3842 dbSNP
rs1286950926 3848 dbSNP
rs1192915374 3853 dbSNP
rs965211087 3859 dbSNP
rs1271477242 3871 dbSNP
rs143627365 3875 dbSNP
rs1249269809 3885 dbSNP
rs1376440914 3889 dbSNP
rs1193289184 3915 dbSNP
rs985893505 3918 dbSNP
rs1446013922 3919 dbSNP
rs1011722580 3928 dbSNP
rs932715609 3930 dbSNP
rs36052170 3933 dbSNP
rs569370780 3939 dbSNP
rs1380425825 3942 dbSNP
rs1418698554 3950 dbSNP
rs891877083 3959 dbSNP
rs1367206257 3961 dbSNP
rs140032634 3962 dbSNP
rs920048368 3966 dbSNP
rs76444510 3970 dbSNP
rs1241146721 3973 dbSNP
rs1310049679 3984 dbSNP
rs565709739 3986 dbSNP
rs575161413 3988 dbSNP
rs907220013 3990 dbSNP
rs1234203402 3993 dbSNP
rs961209059 3994 dbSNP
rs60022208 4007 dbSNP
rs1265832821 4008 dbSNP
rs541346637 4009 dbSNP
rs771991851 4010 dbSNP
rs947985042 4017 dbSNP
rs1238240739 4020 dbSNP
rs1431602384 4023 dbSNP
rs1438615542 4035 dbSNP
rs992110430 4037 dbSNP
rs1326035688 4039 dbSNP
rs527577823 4040 dbSNP
rs1033335454 4041 dbSNP
rs1162466592 4041 dbSNP
rs1393052953 4043 dbSNP
rs1037538584 4046 dbSNP
rs1001857192 4051 dbSNP
rs1341325746 4063 dbSNP
rs1444669434 4063 dbSNP
rs1244382950 4066 dbSNP
rs941879472 4068 dbSNP
rs1341985076 4069 dbSNP
rs1199820269 4081 dbSNP
rs1257984822 4084 dbSNP
rs77627700 4092 dbSNP
rs1176265355 4095 dbSNP
rs983204911 4098 dbSNP
rs932946344 4107 dbSNP
rs1432717900 4112 dbSNP
rs1186472725 4122 dbSNP
rs558338592 4130 dbSNP
rs922973297 4140 dbSNP
rs544604384 4141 dbSNP
rs1421592525 4143 dbSNP
rs200965237 4156 dbSNP
rs1399482494 4158 dbSNP
rs1464089681 4161 dbSNP
rs780218896 4162 dbSNP
rs1304624883 4173 dbSNP
rs1011665398 4177 dbSNP
rs1403068157 4187 dbSNP
rs1395659283 4189 dbSNP
rs974840639 4191 dbSNP
rs1328501919 4193 dbSNP
rs146264340 4197 dbSNP
rs555846485 4202 dbSNP
rs1278070495 4204 dbSNP
rs1022333194 4209 dbSNP
rs944289580 4210 dbSNP
rs891405524 4212 dbSNP
rs1206168864 4215 dbSNP
rs1189178335 4235 dbSNP
rs990269938 4243 dbSNP
rs542321400 4244 dbSNP
rs1049755930 4252 dbSNP
rs192602517 4261 dbSNP
rs919976274 4262 dbSNP
rs778579322 4265 dbSNP
rs956215475 4265 dbSNP
rs1476785757 4268 dbSNP
rs867918567 4270 dbSNP
rs974169393 4272 dbSNP
rs11626006 4275 dbSNP
rs377356825 4277 dbSNP
rs1484949814 4290 dbSNP
rs149324706 4296 dbSNP
rs1301260401 4297 dbSNP
rs553018299 4302 dbSNP
rs757621063 4305 dbSNP
rs1297939976 4310 dbSNP
rs746526795 4316 dbSNP
rs558229676 4347 dbSNP
rs1338981557 4348 dbSNP
rs1225881008 4353 dbSNP
rs772785503 4360 dbSNP
rs538252731 4377 dbSNP
rs926571368 4389 dbSNP
rs1312203030 4396 dbSNP
rs980364398 4397 dbSNP
rs1268559459 4398 dbSNP
rs1253840058 4404 dbSNP
rs967694758 4405 dbSNP
rs751893429 4417 dbSNP
rs78621830 4419 dbSNP
rs778164746 4421 dbSNP
rs1487225967 4423 dbSNP
rs895056761 4426 dbSNP
rs1009289115 4428 dbSNP
rs1425806938 4430 dbSNP
rs956685241 4443 dbSNP
rs570248486 4444 dbSNP
rs1311990704 4448 dbSNP
rs1341615946 4461 dbSNP
rs1382292039 4464 dbSNP
rs1008852747 4472 dbSNP
rs771775317 4473 dbSNP
rs1158340075 4476 dbSNP
rs1358948133 4479 dbSNP
rs758899222 4481 dbSNP
rs1294580702 4484 dbSNP
rs1367551960 4493 dbSNP
rs1356099999 4496 dbSNP
rs1050014529 4503 dbSNP
rs1355297583 4506 dbSNP
rs1409366499 4508 dbSNP
rs1284875472 4513 dbSNP
rs1416771517 4516 dbSNP
rs1351166269 4525 dbSNP
rs996823345 4529 dbSNP
rs898519323 4531 dbSNP
rs1247174699 4532 dbSNP
rs886289180 4536 dbSNP
rs1475298089 4538 dbSNP
rs374209401 4542 dbSNP
rs535897775 4547 dbSNP
rs1158213830 4553 dbSNP
rs1378722092 4567 dbSNP
rs1471997752 4580 dbSNP
rs1235018746 4581 dbSNP
rs1349710024 4588 dbSNP
rs923035757 4591 dbSNP
rs1334032495 4596 dbSNP
rs1205828318 4597 dbSNP
rs753114793 4602 dbSNP
rs1378392943 4604 dbSNP
rs1446907452 4606 dbSNP
rs1308020027 4642 dbSNP
rs1370769039 4643 dbSNP
rs187992901 4646 dbSNP
rs764890059 4651 dbSNP
rs1320955706 4652 dbSNP
rs939185235 4654 dbSNP
rs943062507 4655 dbSNP
rs11629107 4656 dbSNP
rs1215659382 4657 dbSNP
rs990363891 4660 dbSNP
rs1335670364 4661 dbSNP
rs1473883364 4668 dbSNP
rs1292868803 4678 dbSNP
rs1231742398 4696 dbSNP
rs1375243578 4699 dbSNP
rs1279992491 4706 dbSNP
rs1173387049 4709 dbSNP
rs1401698331 4711 dbSNP
rs556650940 4715 dbSNP
rs150572928 4717 dbSNP
rs1330054984 4718 dbSNP
rs868811655 4723 dbSNP
rs866740013 4725 dbSNP
rs1352312746 4726 dbSNP
rs914891566 4734 dbSNP
rs1031788016 4737 dbSNP
rs1449755059 4737 dbSNP
rs527635324 4742 dbSNP
rs1231251913 4749 dbSNP
rs766067004 4752 dbSNP
rs1023506977 4754 dbSNP
rs1197985362 4760 dbSNP
rs866468243 4769 dbSNP
rs1270951630 4772 dbSNP
rs564841402 4777 dbSNP
rs544860067 4778 dbSNP
rs1008359853 4779 dbSNP
rs1393152335 4780 dbSNP
rs1162327364 4785 dbSNP
rs1402150077 4786 dbSNP
rs1410529291 4799 dbSNP
rs1424836925 4800 dbSNP
rs1178148874 4802 dbSNP
rs1477768621 4808 dbSNP
rs569526412 4810 dbSNP
rs1028553801 4817 dbSNP
rs1334346655 4826 dbSNP
rs1415693321 4826 dbSNP
rs1006153818 4827 dbSNP
rs562114736 4842 dbSNP
rs1196098054 4849 dbSNP
rs1299780726 4856 dbSNP
rs1340955359 4857 dbSNP
rs549975804 4879 dbSNP
rs1047575377 4880 dbSNP
rs997797548 4885 dbSNP
rs754761781 4909 dbSNP
rs1278138887 4912 dbSNP
rs1484798363 4913 dbSNP
rs898775789 4931 dbSNP
rs370053990 4932 dbSNP
rs1264332568 4939 dbSNP
rs1038373798 4957 dbSNP
rs1191591078 4959 dbSNP
rs185024272 4961 dbSNP
rs914252372 4967 dbSNP
rs1172622205 4991 dbSNP
rs1054078940 4999 dbSNP
rs771729610 5002 dbSNP
rs1223027765 5006 dbSNP
rs560777428 5009 dbSNP
rs924907129 5011 dbSNP
rs887162244 5013 dbSNP
rs1056961057 5018 dbSNP
rs1399182650 5028 dbSNP
rs939170838 5029 dbSNP
rs1305502728 5030 dbSNP
rs1332795361 5034 dbSNP
rs1441612598 5046 dbSNP
rs926477048 5046 dbSNP
rs1044900010 5049 dbSNP
rs1323310325 5052 dbSNP
rs1284413700 5056 dbSNP
rs946622534 5063 dbSNP
rs915197391 5064 dbSNP
rs1345890960 5065 dbSNP
rs987784720 5075 dbSNP
rs1454967296 5077 dbSNP
rs1345437667 5078 dbSNP
rs1353375526 5079 dbSNP
rs934998323 5080 dbSNP
rs540467628 5083 dbSNP
rs1452670531 5087 dbSNP
rs1198843179 5088 dbSNP
rs578182415 5095 dbSNP
rs142459999 5099 dbSNP
rs538511329 5107 dbSNP
rs987643183 5108 dbSNP
rs1380554040 5110 dbSNP
rs953177532 5117 dbSNP
rs575738509 5136 dbSNP
rs1392684939 5139 dbSNP
rs1252380848 5140 dbSNP
rs1189560538 5141 dbSNP
rs1322888245 5145 dbSNP
rs1368796745 5150 dbSNP
rs555462018 5154 dbSNP
rs1310209416 5158 dbSNP
rs769926356 5162 dbSNP
rs745879719 5170 dbSNP
rs781404581 5171 dbSNP
rs1004183923 5172 dbSNP
rs1026270308 5182 dbSNP
rs887122585 5187 dbSNP
rs1209694002 5193 dbSNP
rs4904737 5207 dbSNP
rs377720517 5208 dbSNP
rs566851581 5215 dbSNP
rs1234844738 5220 dbSNP
rs1200020362 5230 dbSNP
rs1038758465 5243 dbSNP
rs1007707885 5244 dbSNP
rs1179292942 5253 dbSNP
rs1369975279 5254 dbSNP
rs1473007062 5278 dbSNP
rs1164061447 5289 dbSNP
rs892911171 5291 dbSNP
rs1347072506 5292 dbSNP
rs547027528 5295 dbSNP
rs533749339 5296 dbSNP
rs1044874241 5297 dbSNP
rs924830529 5306 dbSNP
rs946555145 5311 dbSNP
rs893689662 5312 dbSNP
rs950219995 5325 dbSNP
rs187659353 5326 dbSNP
rs1219839560 5330 dbSNP
rs1258133342 5333 dbSNP
rs1428282348 5334 dbSNP
rs1480063997 5337 dbSNP
rs1359025319 5341 dbSNP
rs1193651642 5344 dbSNP
rs1052793628 5360 dbSNP
rs747365486 5362 dbSNP
rs1442740599 5366 dbSNP
rs934987873 5371 dbSNP
rs916075285 5374 dbSNP
rs1478754555 5387 dbSNP
rs138039039 5390 dbSNP
rs962770657 5395 dbSNP
rs1460539189 5396 dbSNP
rs1304755978 5397 dbSNP
rs1403223194 5401 dbSNP
rs910008981 5402 dbSNP
rs1311419311 5431 dbSNP
rs1342840439 5435 dbSNP
rs778240858 5448 dbSNP
rs1219783810 5459 dbSNP
rs931709476 5467 dbSNP
rs982774402 5470 dbSNP
rs1306357839 5475 dbSNP
rs921721236 5476 dbSNP
rs951369278 5479 dbSNP
rs1257283894 5480 dbSNP
rs1173998638 5484 dbSNP
rs758668655 5486 dbSNP
rs1209777491 5492 dbSNP
rs1255125019 5494 dbSNP
rs1489150836 5495 dbSNP
rs1194222562 5496 dbSNP
rs1260983222 5502 dbSNP
rs1430356615 5503 dbSNP
rs1420382129 5504 dbSNP
rs962881596 5510 dbSNP
rs1178290079 5515 dbSNP
rs73322593 5541 dbSNP
rs1172079630 5546 dbSNP
rs1362777534 5547 dbSNP
rs1401009843 5552 dbSNP
rs983458578 5561 dbSNP
rs562537282 5567 dbSNP
rs951686931 5578 dbSNP
rs1360531525 5581 dbSNP
rs548690924 5588 dbSNP
rs1302745755 5599 dbSNP
rs529030308 5607 dbSNP
rs546120288 5612 dbSNP
rs1211356253 5613 dbSNP
rs1485279068 5619 dbSNP
rs1017837358 5630 dbSNP
rs2401923 5632 dbSNP
rs1259970603 5634 dbSNP
rs905247110 5636 dbSNP
rs753344861 5637 dbSNP
rs1453881174 5638 dbSNP
rs1191925343 5641 dbSNP
rs1010665921 5649 dbSNP
rs1420652306 5650 dbSNP
rs1216339602 5656 dbSNP
rs1343858440 5660 dbSNP
rs1459891216 5662 dbSNP
rs1294632583 5669 dbSNP
rs1356991403 5671 dbSNP
rs1295448221 5673 dbSNP
rs1415821082 5677 dbSNP
rs1375269265 5682 dbSNP
rs1470794150 5682 dbSNP
rs893658366 5688 dbSNP
rs1371019479 5690 dbSNP
rs1439550322 5693 dbSNP
rs183671867 5696 dbSNP
rs935230402 5697 dbSNP
rs890410238 5699 dbSNP
rs10148025 5708 dbSNP
rs1224044324 5709 dbSNP
rs1306008991 5712 dbSNP
rs1314978827 5719 dbSNP
rs544956092 5728 dbSNP
rs902873607 5737 dbSNP
rs1045951766 5741 dbSNP
rs950337872 5745 dbSNP
rs1169838946 5747 dbSNP
rs146926092 5755 dbSNP
rs1420327677 5756 dbSNP
rs1173428867 5761 dbSNP
rs555779993 5762 dbSNP
rs1176905364 5767 dbSNP
rs941545122 5771 dbSNP
rs1394433542 5772 dbSNP
rs1425938895 5772 dbSNP
rs909935820 5772 dbSNP
rs535487545 5779 dbSNP
rs1037469900 5782 dbSNP
rs191216201 5796 dbSNP
rs1442477205 5797 dbSNP
rs1297255979 5798 dbSNP
rs79042896 5802 dbSNP
rs539515962 5803 dbSNP
rs1196234705 5809 dbSNP
rs951710283 5828 dbSNP
rs114612785 5831 dbSNP
rs982043576 5833 dbSNP
rs969373301 5838 dbSNP
rs1204017612 5852 dbSNP
rs985891333 5854 dbSNP
rs1484418657 5862 dbSNP
rs551143592 5863 dbSNP
rs1023650612 5865 dbSNP
rs72697512 5866 dbSNP
rs958143370 5870 dbSNP
rs774274050 5873 dbSNP
rs1173537194 5881 dbSNP
rs1425069002 5886 dbSNP
rs1393584000 5887 dbSNP
rs1031242124 5898 dbSNP
rs1374719567 5900 dbSNP
rs998573449 5908 dbSNP
rs1297638230 5913 dbSNP
rs1449833213 5915 dbSNP
rs999402992 5919 dbSNP
rs36003020 5920 dbSNP
rs890332875 5920 dbSNP
rs1412782926 5924 dbSNP
rs1464099368 5930 dbSNP
rs1280029955 5937 dbSNP
rs569052602 5938 dbSNP
rs755172 5949 dbSNP
rs1461181602 5950 dbSNP
rs34396101 5954 dbSNP
rs188121814 5955 dbSNP
rs560067473 5962 dbSNP
rs894713594 5964 dbSNP
rs1257257248 5993 dbSNP
rs1484898394 5995 dbSNP
rs141061555 6003 dbSNP
rs3085775 6003 dbSNP
rs373515586 6003 dbSNP
rs398118506 6003 dbSNP
rs900188717 6005 dbSNP
rs544839209 6008 dbSNP
rs879402481 6008 dbSNP
rs182654421 6013 dbSNP
rs1415814942 6027 dbSNP
rs867840092 6028 dbSNP
rs1419551491 6033 dbSNP
rs941471509 6038 dbSNP
rs759633870 6050 dbSNP
rs1469404616 6051 dbSNP
rs8015286 6052 dbSNP
rs142684132 6066 dbSNP
rs544818190 6067 dbSNP
rs1369907986 6072 dbSNP
rs1263993687 6079 dbSNP
rs138667467 6080 dbSNP
rs928177013 6084 dbSNP
rs1346111284 6088 dbSNP
rs1219292621 6094 dbSNP
rs1462904772 6096 dbSNP
rs1285446425 6105 dbSNP
rs977148623 6117 dbSNP
rs1191744366 6119 dbSNP
rs1317937192 6122 dbSNP
rs189823192 6131 dbSNP
rs1193819735 6136 dbSNP
rs56226757 6167 dbSNP
rs1432520540 6168 dbSNP
rs573174569 6172 dbSNP
rs773294406 6174 dbSNP
rs1160212139 6175 dbSNP
rs916566687 6176 dbSNP
rs1386372515 6180 dbSNP
rs1388876323 6182 dbSNP
rs989471928 6183 dbSNP
rs1400037601 6188 dbSNP
rs772557331 6198 dbSNP
rs1031090096 6201 dbSNP
rs1302907459 6203 dbSNP
rs977250777 6214 dbSNP
rs999734890 6225 dbSNP
rs1156762692 6226 dbSNP
rs553308552 6229 dbSNP
rs1030231486 6237 dbSNP
rs996077127 6240 dbSNP
rs1014305526 6242 dbSNP
rs900450337 6253 dbSNP
rs1292665487 6256 dbSNP
rs1034577375 6259 dbSNP
rs556539459 6264 dbSNP
rs1213737520 6266 dbSNP
rs1192487197 6269 dbSNP
rs545926239 6270 dbSNP
rs888729965 6272 dbSNP
rs1364093931 6274 dbSNP
rs1469452394 6283 dbSNP
rs1005930881 6292 dbSNP
rs1415915199 6299 dbSNP
rs1047258454 6312 dbSNP
rs994371124 6312 dbSNP
rs886153802 6314 dbSNP
rs1449473050 6319 dbSNP
rs576915593 6322 dbSNP
rs930110405 6332 dbSNP
rs906682769 6333 dbSNP
rs1335492782 6339 dbSNP
rs1237368392 6347 dbSNP
rs1046574720 6348 dbSNP
rs748397759 6350 dbSNP
rs948297724 6353 dbSNP
rs916867528 6355 dbSNP
rs182001848 6356 dbSNP
rs935900044 6368 dbSNP
rs1466754684 6371 dbSNP
rs989398862 6373 dbSNP
rs936695215 6374 dbSNP
rs1436975850 6381 dbSNP
rs1179362366 6384 dbSNP
rs1419827489 6389 dbSNP
rs1238523315 6390 dbSNP
rs1164212479 6391 dbSNP
rs1350698021 6393 dbSNP
rs1415691546 6400 dbSNP
rs923995511 6402 dbSNP
rs978220990 6403 dbSNP
rs1463608891 6405 dbSNP
rs1304195351 6407 dbSNP
rs954983698 6410 dbSNP
rs1030157764 6418 dbSNP
rs974609331 6420 dbSNP
rs374807286 6423 dbSNP
rs1356576814 6430 dbSNP
rs190870052 6436 dbSNP
rs916948163 6437 dbSNP
rs1320512817 6442 dbSNP
rs1331969110 6445 dbSNP
rs1229015815 6463 dbSNP
rs992611429 6468 dbSNP
rs755496923 6477 dbSNP
rs1193780266 6478 dbSNP
rs1296123235 6483 dbSNP
rs1485881091 6493 dbSNP
rs749777903 6497 dbSNP
rs1255355897 6498 dbSNP
rs1395645164 6503 dbSNP
rs886124934 6507 dbSNP
rs1026422645 6508 dbSNP
rs952931717 6511 dbSNP
rs1002612375 6513 dbSNP
rs1372633905 6520 dbSNP
rs185870950 6523 dbSNP
rs1046544877 6529 dbSNP
rs1376386156 6531 dbSNP
rs555396684 6532 dbSNP
rs1374352462 6538 dbSNP
rs1041496181 6539 dbSNP
rs895370174 6549 dbSNP
rs535718642 6553 dbSNP
rs1295660984 6559 dbSNP
rs1006960216 6566 dbSNP
rs566380531 6575 dbSNP
rs755562280 6576 dbSNP
rs1224713129 6582 dbSNP
rs1446068349 6584 dbSNP
rs1209847589 6590 dbSNP
rs889889235 6591 dbSNP
rs1262846495 6594 dbSNP
rs202182130 6595 dbSNP
rs1486798587 6613 dbSNP
rs1053714159 6618 dbSNP
rs936712101 6622 dbSNP
rs936646407 6625 dbSNP
rs750154646 6634 dbSNP
rs978527022 6638 dbSNP
rs1454031460 6648 dbSNP
rs34928727 6650 dbSNP
rs945847027 6655 dbSNP
rs1347378029 6658 dbSNP
rs1454760629 6663 dbSNP
rs1288805766 6670 dbSNP
rs143373995 6672 dbSNP
rs1200437607 6684 dbSNP
rs993099428 6686 dbSNP
rs757086541 6692 dbSNP
rs1233181287 6705 dbSNP
rs1272074929 6706 dbSNP
rs751305875 6708 dbSNP
rs1228346400 6709 dbSNP
rs533108527 6710 dbSNP
rs974535660 6718 dbSNP
rs1340141934 6722 dbSNP
rs983753140 6727 dbSNP
rs952358972 6728 dbSNP
rs764050574 6732 dbSNP
rs964552608 6733 dbSNP
rs1276021626 6744 dbSNP
rs1416358548 6751 dbSNP
rs1420069112 6782 dbSNP
rs149229712 6803 dbSNP
rs546288014 6811 dbSNP
rs762918456 6813 dbSNP
rs1240164776 6819 dbSNP
rs984705374 6822 dbSNP
rs950721266 6826 dbSNP
rs966041407 6838 dbSNP
rs1291443788 6841 dbSNP
rs1375192079 6842 dbSNP
rs145347490 6845 dbSNP
rs1002990071 6848 dbSNP
rs1306074423 6848 dbSNP
rs1235124343 6855 dbSNP
rs1273887386 6858 dbSNP
rs1334267301 6861 dbSNP
rs1212000098 6870 dbSNP
rs537043285 6874 dbSNP
rs1022675275 6877 dbSNP
rs1012342687 6891 dbSNP
rs1477262636 6892 dbSNP
rs550658451 6892 dbSNP
rs531030672 6897 dbSNP
rs1421062597 6899 dbSNP
rs1189680425 6901 dbSNP
rs766539128 6902 dbSNP
rs1032399839 6909 dbSNP
rs1476469138 6909 dbSNP
rs1417875751 6924 dbSNP
rs562277490 6934 dbSNP
rs1162211189 6946 dbSNP
rs1001113436 6952 dbSNP
rs747846606 6955 dbSNP
rs1042390183 6956 dbSNP
rs1297381557 6957 dbSNP
rs181638387 6965 dbSNP
rs945974002 6966 dbSNP
rs923317425 6967 dbSNP
rs1039154901 6970 dbSNP
rs943457131 6979 dbSNP
rs569614145 6980 dbSNP
rs937179174 6981 dbSNP
rs1204168722 6982 dbSNP
rs1275138933 6983 dbSNP
rs1249908046 6987 dbSNP
rs559359994 6990 dbSNP
rs545788691 6992 dbSNP
rs150463882 6993 dbSNP
rs1257469849 6994 dbSNP
rs1317413110 7007 dbSNP
rs1256368419 7008 dbSNP
rs926989231 7008 dbSNP
rs1235428112 7010 dbSNP
rs1179586629 7011 dbSNP
rs1355849615 7012 dbSNP
rs559276034 7018 dbSNP
rs1283386905 7019 dbSNP
rs983888864 7020 dbSNP
rs1410179902 7021 dbSNP
rs539260914 7021 dbSNP
rs1368410118 7025 dbSNP
rs985062782 7026 dbSNP
rs1313373240 7032 dbSNP
rs1354711711 7054 dbSNP
rs1337486665 7057 dbSNP
rs1328902348 7060 dbSNP
rs1271994205 7070 dbSNP
rs950659539 7072 dbSNP
rs1214143231 7073 dbSNP
rs918241596 7077 dbSNP
rs760669284 7088 dbSNP
rs972831450 7097 dbSNP
rs189652851 7111 dbSNP
rs1280130228 7114 dbSNP
rs1441179210 7115 dbSNP
rs557044161 7117 dbSNP
rs981095002 7119 dbSNP
rs1461704087 7121 dbSNP
rs1185527175 7125 dbSNP
rs543476989 7126 dbSNP
rs1022648836 7128 dbSNP
rs113298028 7130 dbSNP
rs957149197 7132 dbSNP
rs1412616852 7133 dbSNP
rs540130483 7152 dbSNP
rs1472069817 7166 dbSNP
rs1032503892 7167 dbSNP
rs1430143505 7171 dbSNP
rs1032367170 7179 dbSNP
rs1235068927 7187 dbSNP
rs1001481186 7188 dbSNP
rs555523735 7194 dbSNP
rs902725189 7205 dbSNP
rs773548139 7209 dbSNP
rs1020935785 7214 dbSNP
rs1285606140 7235 dbSNP
rs772168837 7237 dbSNP
rs1447041681 7245 dbSNP
rs997494124 7266 dbSNP
rs1412682330 7274 dbSNP
rs1387124163 7277 dbSNP
rs1469527177 7278 dbSNP
rs901825970 7281 dbSNP
rs1376795952 7286 dbSNP
rs1476930269 7289 dbSNP
rs1335739634 7290 dbSNP
rs1160185029 7293 dbSNP
rs895699194 7299 dbSNP
rs1400095478 7307 dbSNP
rs1318606857 7308 dbSNP
rs1039081711 7316 dbSNP
rs368785818 7318 dbSNP
rs943425897 7321 dbSNP
rs909326020 7322 dbSNP
rs1048846973 7330 dbSNP
rs774133112 7331 dbSNP
rs75874439 7332 dbSNP
rs1329664807 7335 dbSNP
rs184790985 7338 dbSNP
rs1048285003 7347 dbSNP
rs1350569680 7348 dbSNP
rs919149997 7355 dbSNP
rs373119594 7366 dbSNP
rs918369328 7371 dbSNP
rs774820838 7372 dbSNP
rs1446024241 7373 dbSNP
rs1336321754 7374 dbSNP
rs1374014387 7379 dbSNP
rs972416123 7380 dbSNP
rs769097435 7383 dbSNP
rs4900064 7384 dbSNP
rs539451574 7390 dbSNP
rs912778243 7390 dbSNP
rs570430268 7405 dbSNP
rs550719624 7414 dbSNP
rs1156865451 7420 dbSNP
rs1420042645 7422 dbSNP
rs1462054569 7426 dbSNP
rs1164434244 7430 dbSNP
rs1162303646 7432 dbSNP
rs1403928320 7434 dbSNP
rs1410690016 7436 dbSNP
rs957116570 7442 dbSNP
rs1335548828 7447 dbSNP
rs1439627178 7451 dbSNP
rs1408472689 7459 dbSNP
rs1033179487 7466 dbSNP
rs1356768917 7471 dbSNP
rs1236369462 7473 dbSNP
rs1195603127 7476 dbSNP
rs1233329537 7480 dbSNP