miRTarBase - #MIRT649182 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DNPEP   
Synonyms ASPEP, DAP
Description aspartyl aminopeptidase
Transcript NM_012100   
Expression
Putative miRNA Targets on DNPEP
3'UTR of DNPEP
(miRNA target sites are highlighted)
>DNPEP|NM_012100|3'UTR
   1 GCCCTCTTGGAAAGACTTCTCTGCCATCCCTTTGCACCTGAGAGGGGAAGTTCTCAGCTGAGCTGAAGCTGGATTATTAA
  81 AGTGGATTGTCACTCAGACTCTCCGTGCTACGCTTATTTGGAGACTAGAGGAGTGGGAGTTGAGCCTGGCTTGAACCTTT
 161 GGAACCAGAAAAGTTGGGGAGCAGGTGGAGGAGGCCACACTCCTGGGAGCTGATGGTTTTAAATCTGGTTTTAAATCTCT
 241 TCTCTGTCTCAAGTCCATGTCTGAAGTGGGTGAAGGGTGGACTGGATCCTCAAGCAGAAGGTCACTTCTCCCACCCCTAG
 321 TCCTCCACCTGGGAAATGGCCTCAACGGTCTTCCCTCTTTCCATCCCCAGAATGGGTGTCCCGCTCTGCCTTCAGAGATC
 401 CTGTTCTGCACTGGGCCACCTTCAGAGCTGCTCTGGGCAGACAAAGCTGTTTCTCACCCTCCCAAAATCCCTTCCCATCC
 481 CCTCTCAGGAGCTGCAAAGAGAAGGGCACAGTCTATACCTTATCACCCTTCATCATCCACTTCTCAGCAGTCCCTGGTAT
 561 TACTTGATTGTGAACATATTATCAGGAAAAAAGATTATCATTGAAAAAATTGGAAAAGTCAAAGTCTGGCCGGGTGCAGC
 641 GGCTCACATCTGTATTCCCAGCATTTTGGGAGGCCAAGGCAGGTGGATCACTTGAGGTCAGAGTTCAAGACCAGCCTTGC
 721 CAACATGGTGAAACCCATCTCTACTTAAAAAAAAATACAAAAAAATTAGCCAGGCATGGTGGCACACACCTGTAATCTCA
 801 GCTATTCAGGAGACTGAGGCAGGAGAATAGCTTGAACCAAGGAGGCGTAGGTTGCAGTGAGCTGAGATGGAGCCACCACA
 881 CTCCAGCCTGGGCAACAGAGCAAGGCTCTGTCTCAGAGAAAAAAGGCCAGGCGTGATGGGTCATGCCTGTAGTCCCAGCA
 961 CTTTAGGAGGCTGAGGTGGGCGGATCACCTGAGGTCGGGAGTTCAAGACCAGCCTGACCAACATGGAGAAACCCTGTCCC
1041 TGCTAAAAATACAAAATTAGCCGGGCGTGGTGGCACATGCCTGTAATCTCAGCCACTCCGGAGGCTGAGGCAGGAGAATC
1121 GCTTGAACCCAGGAGGCGGAGGTTGTGGTGAGCCAAGATCCTGCCATTGCACTCTAGCCTGGGCAACAAGGGTGAAACTC
1201 TCTCAAAAAAAAAAAAAGAAAAAGAAAAAGTCAAAGCCTGCTTATAAACCAACCTCCTTCCTTCCACTAAAATAATTGTG
1281 CAAACTGGTGTCCTTCCAATCTTTTTGATACCTATATAAAAGTTTATTTCCATATAAATATTCCACTTCAGCTTTCTAAA
1361 AAACTTAATATAATATAGAGATATTTCTATATCAATACATATAAATTTAATTTAGCAATGGCAAAAAGTTAGAATTCATC
1441 TAAAGATTTCTCAGTAAAGGCAAGCCCAAATACACTATGAAATGTCCATTATAGGTAGCTATTGAGAAAAAGATAAATTG
1521 TATAGTGTGTGTACTAACATGAAGAGATTACAAAGACATTGTTGAGTAGAAAAGGCAGGTTGCAGAACTGGACACAGGAC
1601 AAGGAGTACCTTCAAAACATTATATGGCCAGGCACGGTGGCTTATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGTGG
1681 GCAGATCACTTGAGGTCAGGAGTTCAAAACCAGCCTGGCCAACATGGTGAAAACCTCTCTACTAAAAATACAAAAAAAAT
1761 TAGCCATGCGTGGTGGTGGGTGCCTGTAATCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATAGCTTGAGCCAGGGAGGC
1841 AGAGGCTGCAGTGAGCCAAGATTGAGCCACTGCACTCCAGCCTGGGCGACAGAGCCAGACTCCGTCTCAAAAAAAAAATT
1921 ATTATATATTTTTATGTGTATATAAATATGCACGTAGATGTATACATGTATAGAAAAAGCCTGGAAAAATGCACCTGAAA
2001 CTTTTACAGTGATCTTCTGGGTTGGGAGTGACAAAAGGGCCTTAGCCTTTTTGTAATGGTTTCCTTTTGTATAACAGAAT
2081 GTACCATGTATTACTTATGTAAAAAATTTTACCCTCACACTGTATTTACTCTTACAATTGGCGTACAGTATTTTATTGTA
2161 TAGATGGTCATTATTTATTCAGTCTGTTAATAATGGTCATTTAAGTTTTTCTCCAGTTGACAACTCTAAATAACATTGAG
2241 ATAAATGTACATATATCATTGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugugguaaCAGUGUGAGGu 5'
                     | |||||||| 
Target 5' aggtggaggagGCCACACTCCt 3'
183 - 204 147.00 -12.90
2
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               :|||    |||||||| 
Target 5' atggaGCCA---CCACACTCCa 3'
867 - 885 146.00 -16.80
3
miRNA  3' guUUGUGGU-AACAGUGUGAGGu 5'
            || :|:: || |||| |||| 
Target 5' acAAAGCTGTTTCTCACCCTCCc 3'
441 - 463 132.00 -12.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30493235 19 COSMIC
COSN30479508 29 COSMIC
COSN26650645 38 COSMIC
COSN30156943 40 COSMIC
COSN30447334 44 COSMIC
COSN30508860 45 COSMIC
COSN507968 49 COSMIC
COSN26973897 56 COSMIC
COSN30156066 56 COSMIC
COSN30191435 76 COSMIC
COSN30177906 95 COSMIC
COSN31575544 121 COSMIC
COSN30104946 126 COSMIC
COSN30150145 128 COSMIC
COSN29947061 256 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs780050414 3 dbSNP
rs757338684 9 dbSNP
rs997968906 13 dbSNP
rs751683872 19 dbSNP
rs1352351273 21 dbSNP
rs891671231 23 dbSNP
rs199937383 24 dbSNP
rs758671273 27 dbSNP
rs983692076 30 dbSNP
rs367736953 31 dbSNP
rs1433114165 33 dbSNP
rs745709284 39 dbSNP
rs948101983 42 dbSNP
rs543940459 44 dbSNP
rs532230311 45 dbSNP
rs751792787 50 dbSNP
rs373923975 57 dbSNP
rs1411953920 58 dbSNP
rs370505227 64 dbSNP
rs1027806088 87 dbSNP
rs973522848 88 dbSNP
rs1357744937 91 dbSNP
rs964780020 97 dbSNP
rs1465751759 103 dbSNP
rs1017665286 104 dbSNP
rs578115567 105 dbSNP
rs112344683 111 dbSNP
rs528574064 112 dbSNP
rs559378168 118 dbSNP
rs1374118206 123 dbSNP
rs767334974 126 dbSNP
rs904407020 135 dbSNP
rs1042865317 140 dbSNP
rs1354716751 144 dbSNP
rs1288473297 153 dbSNP
rs948523272 167 dbSNP
rs1287783328 174 dbSNP
rs1411162751 179 dbSNP
rs1223997323 184 dbSNP
rs894231900 185 dbSNP
rs1368110248 187 dbSNP
rs1036747715 191 dbSNP
rs941126912 195 dbSNP
rs1208998871 199 dbSNP
rs1251600847 203 dbSNP
rs7604628 221 dbSNP
rs1202477667 224 dbSNP
rs1250388008 227 dbSNP
rs1049839924 236 dbSNP
rs576793956 237 dbSNP
rs564522301 239 dbSNP
rs1202163521 241 dbSNP
rs985518543 258 dbSNP
rs759330284 260 dbSNP
rs922521950 261 dbSNP
rs1356544139 263 dbSNP
rs976642674 269 dbSNP
rs955841212 276 dbSNP
rs1366213861 305 dbSNP
rs1474534132 316 dbSNP
rs563677172 326 dbSNP
rs1276477994 335 dbSNP
rs1365404859 338 dbSNP
rs1218489508 345 dbSNP
rs984131673 346 dbSNP
rs550487372 347 dbSNP
rs1248425328 348 dbSNP
rs920796528 365 dbSNP
rs746694626 367 dbSNP
rs1273314309 370 dbSNP
rs574663932 376 dbSNP
rs185725797 377 dbSNP
rs1490354159 382 dbSNP
rs111752777 383 dbSNP
rs1245540153 384 dbSNP
rs1267047403 394 dbSNP
rs1488426748 406 dbSNP
rs1012653679 408 dbSNP
rs1422041982 410 dbSNP
rs1447911072 411 dbSNP
rs895186145 420 dbSNP
rs141094081 421 dbSNP
rs1426703899 447 dbSNP
rs558650597 448 dbSNP
rs910655869 449 dbSNP
rs987562404 456 dbSNP
rs1268721724 460 dbSNP
rs1003805384 464 dbSNP
rs1230096050 471 dbSNP
rs1348095270 480 dbSNP
rs1289263603 481 dbSNP
rs1367034312 484 dbSNP
rs112760040 499 dbSNP
rs1031671580 505 dbSNP
rs1359692001 505 dbSNP
rs1229585088 507 dbSNP
rs749799592 509 dbSNP
rs1037184527 510 dbSNP
rs375395973 511 dbSNP
rs796634260 511 dbSNP
rs909617081 513 dbSNP
rs999214512 514 dbSNP
rs1049537703 515 dbSNP
rs968614370 517 dbSNP
rs4672926 518 dbSNP
rs189137544 521 dbSNP
rs1012722686 532 dbSNP
rs1413117196 547 dbSNP
rs185665406 567 dbSNP
rs536138404 568 dbSNP
rs924552027 570 dbSNP
rs1432705599 571 dbSNP
rs1319617371 573 dbSNP
rs1383124501 575 dbSNP
rs1459278831 581 dbSNP
rs922584106 588 dbSNP
rs1377730857 593 dbSNP
rs978988013 595 dbSNP
rs1270645800 597 dbSNP
rs1327687985 597 dbSNP
rs1208551857 607 dbSNP
rs1264115094 610 dbSNP
rs968613144 613 dbSNP
rs1181148878 618 dbSNP
rs1236990317 620 dbSNP
rs1184434186 621 dbSNP
rs1414155065 631 dbSNP
rs115628345 632 dbSNP
rs1158187559 640 dbSNP
rs886814558 641 dbSNP
rs1415829085 644 dbSNP
rs1269777155 647 dbSNP
rs959325643 651 dbSNP
rs181027238 659 dbSNP
rs1289657542 661 dbSNP
rs1349230006 663 dbSNP
rs1228281097 664 dbSNP
rs772587420 666 dbSNP
rs1347507406 682 dbSNP
rs1474343322 696 dbSNP
rs746293436 697 dbSNP
rs1198955395 706 dbSNP
rs1278269810 726 dbSNP
rs1438585708 737 dbSNP
rs1207429676 754 dbSNP
rs1003569769 756 dbSNP
rs1471581731 757 dbSNP
rs12465134 758 dbSNP
rs548380499 765 dbSNP
rs1377989241 766 dbSNP
rs762723184 766 dbSNP
rs530502188 775 dbSNP
rs1401120114 776 dbSNP
rs189381328 789 dbSNP
rs1309358140 790 dbSNP
rs1368110289 791 dbSNP
rs1409762031 795 dbSNP
rs1304211922 803 dbSNP
rs1259669306 824 dbSNP
rs888626069 825 dbSNP
rs1274596866 827 dbSNP
rs771527739 828 dbSNP
rs749701119 846 dbSNP
rs552290060 847 dbSNP
rs900821325 848 dbSNP
rs35113687 850 dbSNP
rs1370808118 869 dbSNP
rs184899385 878 dbSNP
rs1453233881 881 dbSNP
rs934355229 891 dbSNP
rs1376820063 908 dbSNP
rs752942219 909 dbSNP
rs978740011 910 dbSNP
rs1387787372 921 dbSNP
rs1383401866 924 dbSNP
rs947168325 927 dbSNP
rs1158456579 929 dbSNP
rs977453086 932 dbSNP
rs968667116 933 dbSNP
rs1021510456 944 dbSNP
rs1295756151 947 dbSNP
rs1172017415 952 dbSNP
rs563571975 956 dbSNP
rs543756127 962 dbSNP
rs1246862911 965 dbSNP
rs1267272726 975 dbSNP
rs958554903 976 dbSNP
rs1207942352 977 dbSNP
rs1465128122 981 dbSNP
rs539160723 981 dbSNP
rs191688931 982 dbSNP
rs1016222858 985 dbSNP
rs1003069790 993 dbSNP
rs1005810964 996 dbSNP
rs149317348 997 dbSNP
rs1200906558 998 dbSNP
rs1047210962 1004 dbSNP
rs1456852097 1008 dbSNP
rs1028511846 1022 dbSNP
rs995187582 1023 dbSNP
rs372608595 1025 dbSNP
rs1318925995 1028 dbSNP
rs373584703 1033 dbSNP
rs1396787109 1037 dbSNP
rs7587160 1042 dbSNP
rs1338719999 1044 dbSNP
rs1342407561 1050 dbSNP
rs1264863193 1052 dbSNP
rs1037983587 1062 dbSNP
rs1230114479 1063 dbSNP
rs943601020 1065 dbSNP
rs910747097 1066 dbSNP
rs547444597 1067 dbSNP
rs933445889 1076 dbSNP
rs924737633 1077 dbSNP
rs11338907 1089 dbSNP
rs759110816 1089 dbSNP
rs751746934 1090 dbSNP
rs1404526609 1094 dbSNP
rs1311135920 1096 dbSNP
rs1434378244 1099 dbSNP
rs1040805560 1100 dbSNP
rs1391049417 1101 dbSNP
rs1170660613 1104 dbSNP
rs1474309624 1107 dbSNP
rs977448965 1120 dbSNP
rs766418208 1121 dbSNP
rs1188244139 1128 dbSNP
rs1400331915 1129 dbSNP
rs934323105 1132 dbSNP
rs1444051191 1137 dbSNP
rs1254836948 1141 dbSNP
rs1209490939 1150 dbSNP
rs1230098942 1159 dbSNP
rs1286239344 1171 dbSNP
rs1316045509 1189 dbSNP
rs1483075133 1194 dbSNP
rs1482056540 1199 dbSNP
rs1199426181 1202 dbSNP
rs1276363618 1204 dbSNP
rs902858926 1205 dbSNP
rs947420118 1205 dbSNP
rs1411701239 1206 dbSNP
rs914556166 1212 dbSNP
rs1043331196 1218 dbSNP
rs1175029533 1218 dbSNP
rs1178674768 1218 dbSNP
rs1308736777 1218 dbSNP
rs1411591622 1218 dbSNP
rs1306177771 1221 dbSNP
rs947337984 1222 dbSNP
rs1337864578 1224 dbSNP
rs1303093477 1228 dbSNP
rs113277766 1230 dbSNP
rs1269978850 1230 dbSNP
rs371170322 1231 dbSNP
rs1202407399 1236 dbSNP
rs1251803526 1237 dbSNP
rs1489080947 1240 dbSNP
rs915705656 1248 dbSNP
rs1265662335 1254 dbSNP
rs1246247197 1256 dbSNP
rs991404082 1260 dbSNP
rs1169390117 1269 dbSNP
rs991324578 1276 dbSNP
rs1427970843 1279 dbSNP
rs958606970 1281 dbSNP
rs1035982213 1293 dbSNP
rs1353895792 1298 dbSNP
rs144736785 1299 dbSNP
rs1295094073 1316 dbSNP
rs928033203 1325 dbSNP
rs1439717242 1327 dbSNP
rs1297968707 1342 dbSNP
rs573532196 1344 dbSNP
rs1225613438 1350 dbSNP
rs982197440 1367 dbSNP
rs1224347818 1368 dbSNP
rs1322888675 1368 dbSNP
rs1245347678 1369 dbSNP
rs961336136 1376 dbSNP
rs1188037741 1378 dbSNP
rs574428475 1378 dbSNP
rs545171702 1381 dbSNP
rs201226064 1382 dbSNP
rs1371176152 1383 dbSNP
rs951263671 1386 dbSNP
rs1025404585 1388 dbSNP
rs1166752119 1389 dbSNP
rs1348048326 1397 dbSNP
rs576080200 1400 dbSNP
rs373317237 1401 dbSNP
rs898205285 1404 dbSNP
rs141015022 1409 dbSNP
rs1395576692 1412 dbSNP
rs758472580 1415 dbSNP
rs1432392652 1421 dbSNP
rs1269104380 1423 dbSNP
rs1379175250 1429 dbSNP
rs1229533050 1436 dbSNP
rs1288420060 1438 dbSNP
rs1334741984 1442 dbSNP
rs1209789048 1443 dbSNP
rs1006530537 1445 dbSNP
rs889380027 1446 dbSNP
rs1052423808 1449 dbSNP
rs1270366954 1456 dbSNP
rs933516868 1466 dbSNP
rs751433392 1471 dbSNP
rs1473760692 1473 dbSNP
rs996961141 1477 dbSNP
rs1180183202 1486 dbSNP
rs1415625615 1500 dbSNP
rs184384321 1502 dbSNP
rs1159675606 1513 dbSNP
rs1390507277 1514 dbSNP
rs1019282188 1518 dbSNP
rs1041809164 1520 dbSNP
rs1317279516 1527 dbSNP
rs554811432 1529 dbSNP
rs1359363402 1533 dbSNP
rs998568713 1546 dbSNP
rs1253267413 1553 dbSNP
rs192531903 1558 dbSNP
rs947470420 1567 dbSNP
rs914608538 1578 dbSNP
rs1327437357 1588 dbSNP
rs1204914352 1593 dbSNP
rs991456558 1599 dbSNP
rs1279677083 1600 dbSNP
rs1011687370 1606 dbSNP
rs565977530 1609 dbSNP
rs937300312 1615 dbSNP
rs928585402 1618 dbSNP
rs1256853006 1620 dbSNP
rs552341510 1621 dbSNP
rs1210840596 1624 dbSNP
rs532505592 1630 dbSNP
rs1468459251 1631 dbSNP
rs1271837154 1635 dbSNP
rs1233134631 1636 dbSNP
rs1415781362 1637 dbSNP
rs1351254693 1648 dbSNP
rs1281338315 1652 dbSNP
rs766071683 1658 dbSNP
rs1410976589 1660 dbSNP
rs928461635 1662 dbSNP
rs1349161740 1665 dbSNP
rs951273551 1673 dbSNP
rs1238846106 1674 dbSNP
rs1335364437 1677 dbSNP
rs1324405618 1679 dbSNP
rs1046489968 1681 dbSNP
rs1462840598 1689 dbSNP
rs570082882 1695 dbSNP
rs1279725819 1699 dbSNP
rs1238104577 1711 dbSNP
rs1343043047 1715 dbSNP
rs1207362835 1723 dbSNP
rs973854522 1724 dbSNP
rs1435972614 1725 dbSNP
rs1180861061 1749 dbSNP
rs1171285713 1760 dbSNP
rs962463651 1760 dbSNP
rs984122780 1760 dbSNP
rs1394099721 1761 dbSNP
rs1164136006 1765 dbSNP
rs1429902711 1767 dbSNP
rs1457703069 1769 dbSNP
rs1018000956 1770 dbSNP
rs921521227 1775 dbSNP
rs762958048 1776 dbSNP
rs1333135178 1786 dbSNP
rs568035748 1792 dbSNP
rs1030611876 1800 dbSNP
rs549928040 1801 dbSNP
rs12463970 1802 dbSNP
rs1272516549 1803 dbSNP
rs764869549 1807 dbSNP
rs1462953569 1809 dbSNP
rs188965481 1815 dbSNP
rs1290333537 1823 dbSNP
rs947524108 1826 dbSNP
rs893224945 1843 dbSNP
rs1011239087 1844 dbSNP
rs1252045101 1846 dbSNP
rs894136353 1847 dbSNP
rs541364950 1848 dbSNP
rs1189979720 1861 dbSNP
rs11680364 1865 dbSNP
rs937370174 1866 dbSNP
rs1393495391 1873 dbSNP
rs565117542 1877 dbSNP
rs545183823 1881 dbSNP
rs576059610 1887 dbSNP
rs556198151 1888 dbSNP
rs1295511264 1890 dbSNP
rs1045671850 1892 dbSNP
rs1213685177 1895 dbSNP
rs929876277 1903 dbSNP
rs1358353991 1904 dbSNP
rs908614192 1905 dbSNP
rs1272269414 1916 dbSNP
rs1465088804 1918 dbSNP
rs1048994911 1919 dbSNP
rs1259067737 1919 dbSNP
rs918475641 1919 dbSNP
rs761561154 1923 dbSNP
rs973906747 1936 dbSNP
rs1370741219 1949 dbSNP
rs776370460 1952 dbSNP
rs962516788 1953 dbSNP
rs1222171881 1958 dbSNP
rs1349988045 1959 dbSNP
rs1389769641 1965 dbSNP
rs531593029 1968 dbSNP
rs1384506913 1983 dbSNP
rs931289381 1985 dbSNP
rs910987835 1994 dbSNP
rs1357322977 1999 dbSNP
rs985601924 2000 dbSNP
rs1292467455 2009 dbSNP
rs1368603701 2009 dbSNP
rs1329522940 2017 dbSNP
rs1324962703 2019 dbSNP
rs542276388 2019 dbSNP
rs1258635858 2038 dbSNP
rs760232103 2040 dbSNP
rs11674368 2045 dbSNP
rs1346865797 2047 dbSNP
rs553331792 2052 dbSNP
rs1484984370 2055 dbSNP
rs1029740734 2056 dbSNP
rs1156775839 2068 dbSNP
rs1473808736 2069 dbSNP
rs912838348 2071 dbSNP
rs1399626430 2072 dbSNP
rs1157349148 2073 dbSNP
rs1363482328 2084 dbSNP
rs34425766 2086 dbSNP
rs184017952 2087 dbSNP
rs1175194226 2091 dbSNP
rs997811486 2092 dbSNP
rs1452169631 2097 dbSNP
rs968041065 2098 dbSNP
rs1373653152 2102 dbSNP
rs1193363441 2106 dbSNP
rs1465597349 2113 dbSNP
rs1244358257 2116 dbSNP
rs1412869025 2118 dbSNP
rs1312272415 2119 dbSNP
rs771136692 2119 dbSNP
rs552368454 2121 dbSNP
rs1446506836 2122 dbSNP
rs76420757 2123 dbSNP
rs1315987144 2129 dbSNP
rs1236845119 2135 dbSNP
rs1281847539 2135 dbSNP
rs893274121 2141 dbSNP
rs572361443 2142 dbSNP
rs1055832871 2143 dbSNP
rs1484305021 2146 dbSNP
rs1302467476 2154 dbSNP
rs140436764 2155 dbSNP
rs1433997398 2158 dbSNP
rs539192444 2161 dbSNP
rs1178427578 2165 dbSNP
rs533489152 2167 dbSNP
rs1021336402 2180 dbSNP
rs80201277 2181 dbSNP
rs760261386 2182 dbSNP
rs1359291573 2217 dbSNP
rs929956681 2221 dbSNP
rs79248785 2223 dbSNP
rs1296251284 2228 dbSNP
rs1394133107 2236 dbSNP
rs1372257162 2241 dbSNP
rs1034036964 2247 dbSNP
rs536325309 2248 dbSNP
rs907109184 2249 dbSNP
rs10445825 2250 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000273075.4 | 3UTR | UGAGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000273075.4 | 3UTR | UUGAGCCACUGCACUCCAGCCUGGGCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000273075.4 | 3UTR | GAUUGAGCCACUGCACUCCAGCCUGGGCGACAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000273075.4 | 3UTR | AUUGAGCCACUGCACUCCAGCCUGGGCGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*