miRTarBase - #MIRT647013 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ADCY2   
Synonyms AC2, HBAC2
Description adenylate cyclase 2
Transcript NM_020546   
Expression
Putative miRNA Targets on ADCY2
3'UTR of ADCY2
(miRNA target sites are highlighted)
>ADCY2|NM_020546|3'UTR
   1 AGAGTCACCTTCATTTTGGCAAGAAGACTGTATTTTCAGGAAGGTATCACACACTTTCTGACTGCAACTTCTGTCCCTTG
  81 TTTTTGATGTGCGTGCTGTCTGTCCTATGGAGCCTCTGCAGACTCGTTCTCGTGACCCAGTGGCATACCGTTTGGTGTCT
 161 GATGTGTGCCCAGATCGTTCTGCCACTTGCACTGTGCTTGCTCCTAAGCAAAAGGGAAAAGGAGCGCGCGTGATAGAAGA
 241 AAAGCACTGGGAGAACTAACAGAGGAGAAAGGTGAAACACACACACATTCTTAAGGCAATAAAACTAGGGGGTGTATATT
 321 ATCTTCTGGTGCATGTTCTTTTCTGGAAAATATGGTAGCTCGCCAACCGCATCTGCTCATCTGATATTCAAACACACAGT
 401 ATTCGTGAATAAGTTGATTCTGTCCCCCACGTGGACTCTGTGCTCACCCATTGTCTCATTGCCAGTGGTGTCCAAGGGCC
 481 CCCGTTGGGACCCACGGCTCTCGTCCCTCTGCTCCGTGTGTCTCATGCCAGCAGCACGTCGCCATCCGTCACCAGAATTA
 561 GTCCTCACAGCCTAGGACCAGTTTTGTATCAAACTCGTCTGATGTTTTGATGCCATTTGTCTTTTGTAAAGTTAATTCAT
 641 TAAAAGTTTTATGTACTTTGATTTACAGTGCCTGTATCTTTTATTTTCCTGTCTTCTTTCTCCTGTGGTTTGCTCCAGAA
 721 TTAAGGTTTGTTTTCCATCCATTCTCCCTTTTGACACAGTTGTTTCAGAAAGAGCTCTCCAGAAGCCAATATTGAGATGT
 801 AATTCAGATTAGGACACAGTGTGTGACGCAGATAACTGGTTACTCAGCTCCCTGGAAAGCAGGCAAGCATGTTGAATGTA
 881 TCTAGTGGTCTGATTTTAATTTGGGCATCTCTAGAGAACGCTTTCAGGGAAAAATACTTTAATAGTAAAAAGATTCTCTG
 961 CGAGCAACAGTGCCCCCTCCGTCCACTACGCTCCTGTCTCCAAGAATGTTTTGCTAGAGCTAACAGACATAGACTGCAAA
1041 AGAATAATTTGGAATCAGCTATGCAAATCAGTCTCACAATAGCGTGAGCTAACTGAGAGAAGTACTAAGACCCACAAACT
1121 GCCTGTTAAGTCTGAGAAGGCTAAAGAAGACACACAGCCAACGTTCATGCATTTTTAAAGACAGAAGGCCTTGAAGAATT
1201 TGTTCTTGTAAATCCAACACAAGTTGTTTGGTACTTTTAACATAAAGAAATCATACTTTGCCAAATAGTGAAAAGTAGAG
1281 CAATCGTGTATAAGCTAATGTTTAAAAGCAAAACTGCAAATTGTAGCCCAGTTGGTCAAACTTGTTTTCTTTTTATAACT
1361 CATGGCAGGCATCTGTAAGAAGTAGAGAACCCAGATGATCTCTTAGGAAGCCTTTTATTCGTGGGAACTCGAACTTGAAG
1441 CACAAGTTCCTGGTTTGAATCCTGGCTCTGATTTTTTACTGGCTGTGTGACTTTGAACACATCTCTTAGTCCCTCTTAGG
1521 AGTACTTTCCTTATTGGCAACTTATGGACTCGCTAGTGATTAAACGAGGCAATGACTGTGAGCGAGCCTGGCAGGTGCCC
1601 CGTGGTACATTCACAGCACGGGCACAGCTGCTGTGCCAGGACTGTGACTCATTCCCAGTAAAAGGCACTTATCGAAGCTG
1681 ATAACCGTCCTTCATCACCGAAGTGTGAGTAGAGCATGACTTATTTAGTATTCTGCCTCAATGGGGAATTTTTTGATCCT
1761 GTAATCACAACTCAGCATTGGCCTTAATATACCTAAATCTCCAAAAACAGTGATTAAAGCAAGAGAATTATTACAAGGGC
1841 TTTTCTCTTTCCTCTAACTCATTCTTCACGGATGCCGTAGCGTTTCCGTGAGCTCAAACTGGCCTTGGTGTAAAATGTGT
1921 AAGGATGAGCAGCAGGCGTGCCTCGTGGGTTCTTCCTCTGTTACATCCTGCTACACTCATCCGCAGGTCACCTTAGTTCA
2001 CCTACCCTGAGTGAACACCCCCAGCTGGGTGGTCCACCAAGTTCTCATAAACAGAGTCCCTCCCATTCCCCCACGGGGTG
2081 CACCGAACTTGGGTTTGCGCTAAAAAGAACTCAAAAGGAGAACTGTGCTCTCCCAAAGCCATATCACCAGTCTTACCAAA
2161 CAATAGGCTTTTAAAAGCATTGAGTCATTGTCAGAATCCACTATGGGAAGCTCTGTGTGTACCTGGTCCCTTCTAGGTGT
2241 GGTCCCATAGGAGCAGCCTTAGCATCCCCTGTGAACTTATCAAAAATGCAAATTCTCAGGCCCCAACCTGAAGGAGGACC
2321 CTGAATTTGAGATCCCCGGGGCTGGGGCCCAGCACAACTGCTGTTTAGTGAACAGGTTCTCCAGGTGATTCTGATCCCTG
2401 ATCAAGCTTCAGACCTCCCTCCCTCCCCAGTGTTTTTGCAGGTGAGGAAACAGGGGCAGAGTAATTCAGGCACATGTGTT
2481 CAGAGTTCCACAGTTGATTAGCAGTTGAGGCCAGGCTAGAATGGAAAACTGCCTGTTCCTTGAATCTGAAAGAGCATTAT
2561 TCCTGGTCAAAGCTCCTTAAAGTTCTGGGCAGCTAAAAGCATCCCTGTGAGCAAAAATGCCAGGCAGAAAACTGGCAGTG
2641 CACCTCTCATCAGCCCAGGTCCCAGTGCCATTGGCTTCAAGAAAAAAAAAAAATCTCTCCCCAATGCTCTCCTTAACCTT
2721 TAAGTCTTACAGGAAGCCTCTCATAGAAATTGCCTCCAGTCCAGTTTCCCAAAAACCCCAGTGTTTTACATATCTGTTTA
2801 GGAGTGTCTAAGTTTTGTCATCAATCCAGGATGTTATTCTTCCTTCCCAACTCACTGTGCTCCTAAAGGCAGCAACCATT
2881 CATCTTTCCTTTGCTCTGGATACACCGAATGACCAGGTAACATCATCAGGCCGGGTGCAGTGGCTCCTATAATCCCAATA
2961 TTTTGGGAGGCCGAGGAGAGAGGATCACTTAAGCCCAGGAGTCTGAGACCAGCCTGGGCAACATAGCAAGACCCCCATCT
3041 CTGCAAAAAAATAAGAAAATTAGCTTGGCATGGTGGCACGTGCCTGTAGTCCCAGCTACATGGGAGGCTGAGGTGGGAGG
3121 ATCACTTGAGCCCAGGAAGTCCAGAACGTAGTGAGCCTTGATTATACCACTGCACTCCAGCCTGGGTGACAGAGCGAGAC
3201 TCTGTCTCAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |:|||| |   :|||||| 
Target 5' attATACCACT---GCACTCCa 3'
3161 - 3179 140.00 -16.70
2
miRNA  3' guuUGUGGUAACAGUGUGAGgu 5'
             |||:|  || :||||||  
Target 5' gttACATC-CTGCTACACTCat 3'
1960 - 1980 138.00 -13.60
3
miRNA  3' guuuGUGGUAACAG-UGUGAGGu 5'
              | ||:|   | ||:|||| 
Target 5' ccccCTCCGTCCACTACGCTCCt 3'
973 - 995 130.00 -14.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30501770 43 COSMIC
COSN30186716 68 COSMIC
COSN31499051 85 COSMIC
COSN30761436 86 COSMIC
COSN31500462 90 COSMIC
COSN31554472 93 COSMIC
COSN30124198 94 COSMIC
COSN7580544 99 COSMIC
COSN14180306 106 COSMIC
COSN30453301 112 COSMIC
COSN20075409 150 COSMIC
COSN31598771 163 COSMIC
COSN22748475 165 COSMIC
COSN31520146 177 COSMIC
COSN30542971 217 COSMIC
COSN26441871 226 COSMIC
COSN28184833 228 COSMIC
COSN31489879 229 COSMIC
COSN16678567 230 COSMIC
COSN6927861 235 COSMIC
COSN2118394 282 COSMIC
COSN24301115 282 COSMIC
COSN2118396 283 COSMIC
COSN31959939 313 COSMIC
COSN28628702 314 COSMIC
COSN24301223 385 COSMIC
COSN4852041 394 COSMIC
COSN26573596 396 COSMIC
COSN31490081 421 COSMIC
COSN31479706 439 COSMIC
COSN31555851 493 COSMIC
COSN28755767 498 COSMIC
COSN31486981 517 COSMIC
COSN4949281 524 COSMIC
COSN27495071 528 COSMIC
COSN28705919 549 COSMIC
COSN31521223 597 COSMIC
COSN22508322 837 COSMIC
COSN20951989 907 COSMIC
COSN31962380 962 COSMIC
COSN30177247 1100 COSMIC
COSN1319483 1104 COSMIC
COSN31520680 1197 COSMIC
COSN31591280 1261 COSMIC
COSN21397215 1269 COSMIC
COSN17731841 1477 COSMIC
COSN19036023 1583 COSMIC
COSN1319485 1624 COSMIC
COSN16391341 1626 COSMIC
COSN2118399 1636 COSMIC
COSN25197989 1674 COSMIC
COSN21144529 1744 COSMIC
COSN2118401 1959 COSMIC
COSN23163377 2051 COSMIC
COSN29224951 2093 COSMIC
COSN20747494 2100 COSMIC
COSN4949282 2129 COSMIC
COSN28668662 2267 COSMIC
COSN31591275 2382 COSMIC
COSN31577468 2383 COSMIC
COSN9191942 2399 COSMIC
COSN31565019 2507 COSMIC
COSN25282486 2636 COSMIC
COSN20100961 2694 COSMIC
COSN31517597 2696 COSMIC
COSN32186309 2803 COSMIC
COSN20091166 2870 COSMIC
COSN21981643 2975 COSMIC
COSN17037609 3004 COSMIC
COSN2504944 3126 COSMIC
COSN18896724 3197 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759855887 8 dbSNP
rs772439415 19 dbSNP
rs531417017 20 dbSNP
rs372251132 24 dbSNP
rs375222733 27 dbSNP
rs761637605 29 dbSNP
rs761204978 30 dbSNP
rs769362919 45 dbSNP
rs764272749 47 dbSNP
rs1393196929 48 dbSNP
rs754038177 52 dbSNP
rs1475031077 53 dbSNP
rs541124496 55 dbSNP
rs1240184721 57 dbSNP
rs1195223717 72 dbSNP
rs914182463 73 dbSNP
rs945594698 74 dbSNP
rs1211287754 84 dbSNP
rs1308822192 87 dbSNP
rs1273066538 92 dbSNP
rs777576618 94 dbSNP
rs554806522 96 dbSNP
rs1339255779 108 dbSNP
rs979627626 114 dbSNP
rs1443489261 115 dbSNP
rs943435690 116 dbSNP
rs1325560402 118 dbSNP
rs1039090969 122 dbSNP
rs1356403907 125 dbSNP
rs145676451 126 dbSNP
rs543659527 127 dbSNP
rs563981637 129 dbSNP
rs771193755 131 dbSNP
rs778994344 132 dbSNP
rs113690629 133 dbSNP
rs1290370413 148 dbSNP
rs577629860 150 dbSNP
rs1203145050 151 dbSNP
rs1437769958 157 dbSNP
rs1273024039 166 dbSNP
rs772054576 177 dbSNP
rs1349122106 178 dbSNP
rs1303101500 179 dbSNP
rs1217733060 183 dbSNP
rs1387174736 186 dbSNP
rs1280234025 195 dbSNP
rs867241652 204 dbSNP
rs1441497982 212 dbSNP
rs1206847018 215 dbSNP
rs1374664839 224 dbSNP
rs917928814 226 dbSNP
rs145262052 227 dbSNP
rs1408184498 228 dbSNP
rs760875746 229 dbSNP
rs1016726802 230 dbSNP
rs898301458 231 dbSNP
rs902389884 234 dbSNP
rs559367029 237 dbSNP
rs1188634081 251 dbSNP
rs1280107107 266 dbSNP
rs1033410632 271 dbSNP
rs960717506 273 dbSNP
rs771454680 277 dbSNP
rs991867293 279 dbSNP
rs1163577175 302 dbSNP
rs528137634 309 dbSNP
rs1415353065 310 dbSNP
rs376116637 312 dbSNP
rs1354684195 315 dbSNP
rs1300876759 330 dbSNP
rs769252575 333 dbSNP
rs979639026 336 dbSNP
rs925456597 350 dbSNP
rs1157994445 353 dbSNP
rs1030060364 354 dbSNP
rs943494934 363 dbSNP
rs574759945 369 dbSNP
rs548256898 370 dbSNP
rs1487094606 371 dbSNP
rs561636990 372 dbSNP
rs933393599 377 dbSNP
rs565886921 379 dbSNP
rs1215401082 390 dbSNP
rs1004472721 396 dbSNP
rs1342090395 399 dbSNP
rs1233911085 405 dbSNP
rs530682345 406 dbSNP
rs1383836361 413 dbSNP
rs1362457400 426 dbSNP
rs1047762799 429 dbSNP
rs1015802507 431 dbSNP
rs1342788974 438 dbSNP
rs1396159365 443 dbSNP
rs766355866 444 dbSNP
rs1165029121 446 dbSNP
rs939949830 451 dbSNP
rs961604131 459 dbSNP
rs1229894012 463 dbSNP
rs1366201034 471 dbSNP
rs974303803 476 dbSNP
rs1430792062 484 dbSNP
rs762253671 485 dbSNP
rs1188266543 486 dbSNP
rs959542973 488 dbSNP
rs868383697 489 dbSNP
rs1002066192 493 dbSNP
rs766121450 496 dbSNP
rs1263734998 497 dbSNP
rs1441117623 498 dbSNP
rs1183377393 503 dbSNP
rs917972657 504 dbSNP
rs777127417 517 dbSNP
rs147605170 527 dbSNP
rs1013748276 531 dbSNP
rs1020619743 538 dbSNP
rs369409178 539 dbSNP
rs1001136883 541 dbSNP
rs570691834 542 dbSNP
rs936571165 548 dbSNP
rs1053651135 549 dbSNP
rs759170340 565 dbSNP
rs1404080379 567 dbSNP
rs1467975979 572 dbSNP
rs900353530 574 dbSNP
rs1448118634 576 dbSNP
rs765614338 580 dbSNP
rs1451220391 588 dbSNP
rs1365789706 591 dbSNP
rs1265397913 596 dbSNP
rs983909352 597 dbSNP
rs1437241700 598 dbSNP
rs1294738524 604 dbSNP
rs1273743496 608 dbSNP
rs1051960514 616 dbSNP
rs890164781 635 dbSNP
rs1233520784 642 dbSNP
rs1349862177 653 dbSNP
rs866605743 676 dbSNP
rs942011182 677 dbSNP
rs1037646388 680 dbSNP
rs1308529799 692 dbSNP
rs1257329323 695 dbSNP
rs919870085 699 dbSNP
rs1395133747 701 dbSNP
rs1428355801 706 dbSNP
rs539327548 713 dbSNP
rs142454358 714 dbSNP
rs1477835382 756 dbSNP
rs183803240 759 dbSNP
rs1269192052 764 dbSNP
rs534707508 766 dbSNP
rs555003160 772 dbSNP
rs1419817696 777 dbSNP
rs1251156487 783 dbSNP
rs1179990266 790 dbSNP
rs996178381 793 dbSNP
rs1486595684 799 dbSNP
rs896268761 805 dbSNP
rs1027208234 816 dbSNP
rs959813505 819 dbSNP
rs574859780 828 dbSNP
rs542089353 834 dbSNP
rs752163617 835 dbSNP
rs868515610 837 dbSNP
rs537620449 868 dbSNP
rs1357860634 877 dbSNP
rs1201097351 888 dbSNP
rs777668327 892 dbSNP
rs1000563322 893 dbSNP
rs970791803 896 dbSNP
rs978113921 900 dbSNP
rs1175407157 905 dbSNP
rs1454484880 906 dbSNP
rs1411383565 912 dbSNP
rs571412858 920 dbSNP
rs557259861 921 dbSNP
rs1458738593 923 dbSNP
rs989818823 924 dbSNP
rs955016596 927 dbSNP
rs1287113561 928 dbSNP
rs921839527 929 dbSNP
rs1263555782 935 dbSNP
rs1205395233 937 dbSNP
rs1327999675 938 dbSNP
rs1265720472 941 dbSNP
rs1384173294 941 dbSNP
rs758662226 951 dbSNP
rs577538803 956 dbSNP
rs538568721 957 dbSNP
rs1302799082 959 dbSNP
rs1328960542 962 dbSNP
rs1320659881 963 dbSNP
rs890238327 965 dbSNP
rs1289349718 973 dbSNP
rs778706885 979 dbSNP
rs1036012035 980 dbSNP
rs898847578 981 dbSNP
rs146466625 982 dbSNP
rs1162638468 983 dbSNP
rs1471750685 988 dbSNP
rs772294140 990 dbSNP
rs973407016 991 dbSNP
rs895397237 1002 dbSNP
rs1012861152 1004 dbSNP
rs1055417643 1006 dbSNP
rs1211662775 1007 dbSNP
rs1265408926 1008 dbSNP
rs560127907 1009 dbSNP
rs1480221213 1017 dbSNP
rs1354799207 1021 dbSNP
rs1183239518 1038 dbSNP
rs1412431236 1045 dbSNP
rs1025132434 1060 dbSNP
rs1364911458 1063 dbSNP
rs1318867952 1065 dbSNP
rs917770918 1069 dbSNP
rs970824359 1073 dbSNP
rs978192099 1080 dbSNP
rs1031064996 1084 dbSNP
rs958289188 1085 dbSNP
rs1168296785 1086 dbSNP
rs902298189 1089 dbSNP
rs1388085765 1097 dbSNP
rs148301058 1105 dbSNP
rs566551399 1110 dbSNP
rs1454428466 1121 dbSNP
rs1245644704 1140 dbSNP
rs1218685747 1141 dbSNP
rs989459724 1150 dbSNP
rs1450395622 1156 dbSNP
rs1275796748 1159 dbSNP
rs1156689884 1162 dbSNP
rs780034398 1163 dbSNP
rs1341949868 1164 dbSNP
rs1295833594 1169 dbSNP
rs372249969 1170 dbSNP
rs1368526267 1181 dbSNP
rs1274342951 1189 dbSNP
rs900135363 1197 dbSNP
rs561793700 1204 dbSNP
rs1308631068 1213 dbSNP
rs866388950 1224 dbSNP
rs1338550436 1230 dbSNP
rs911709185 1231 dbSNP
rs186669399 1238 dbSNP
rs1403932608 1265 dbSNP
rs1368526934 1267 dbSNP
rs1175225691 1277 dbSNP
rs1308325788 1282 dbSNP
rs1351952981 1285 dbSNP
rs550684396 1286 dbSNP
rs920317594 1287 dbSNP
rs1470918730 1306 dbSNP
rs533899742 1317 dbSNP
rs1183601633 1320 dbSNP
rs1482988427 1324 dbSNP
rs1272977484 1327 dbSNP
rs140466126 1331 dbSNP
rs1015035587 1336 dbSNP
rs533001360 1339 dbSNP
rs895413649 1341 dbSNP
rs748598481 1354 dbSNP
rs1278257024 1355 dbSNP
rs1217683863 1357 dbSNP
rs1375669723 1360 dbSNP
rs1289041612 1367 dbSNP
rs1247689464 1372 dbSNP
rs1409156519 1374 dbSNP
rs150401724 1385 dbSNP
rs1314493798 1391 dbSNP
rs1466305373 1392 dbSNP
rs566433445 1396 dbSNP
rs1034320881 1397 dbSNP
rs1173575329 1400 dbSNP
rs958926874 1403 dbSNP
rs1412098675 1407 dbSNP
rs1157724229 1412 dbSNP
rs1490226801 1413 dbSNP
rs10059539 1421 dbSNP
rs906714548 1422 dbSNP
rs949324152 1429 dbSNP
rs1482211206 1431 dbSNP
rs999662048 1432 dbSNP
rs1208342370 1442 dbSNP
rs1249609807 1447 dbSNP
rs977959742 1448 dbSNP
rs1268880742 1449 dbSNP
rs1227787698 1452 dbSNP
rs1166895545 1460 dbSNP
rs923733116 1466 dbSNP
rs1396509793 1469 dbSNP
rs1378239502 1473 dbSNP
rs1300817954 1480 dbSNP
rs1432501248 1483 dbSNP
rs1382845930 1484 dbSNP
rs1031097483 1506 dbSNP
rs958148106 1508 dbSNP
rs1011358990 1522 dbSNP
rs548310899 1523 dbSNP
rs1214788322 1535 dbSNP
rs1455241952 1538 dbSNP
rs1419384599 1539 dbSNP
rs1028981611 1540 dbSNP
rs1413551745 1541 dbSNP
rs953443235 1546 dbSNP
rs326173 1550 dbSNP
rs1371970410 1552 dbSNP
rs931662787 1553 dbSNP
rs1208328131 1555 dbSNP
rs537131248 1560 dbSNP
rs557472913 1566 dbSNP
rs1005086832 1567 dbSNP
rs1321010443 1575 dbSNP
rs1310319442 1576 dbSNP
rs1216049395 1583 dbSNP
rs326174 1584 dbSNP
rs899304829 1585 dbSNP
rs1432403340 1588 dbSNP
rs920373440 1595 dbSNP
rs929787 1596 dbSNP
rs553654318 1598 dbSNP
rs1313472806 1602 dbSNP
rs915595818 1603 dbSNP
rs1359371652 1611 dbSNP
rs1229174283 1615 dbSNP
rs958805030 1620 dbSNP
rs1197305279 1621 dbSNP
rs1305958555 1625 dbSNP
rs949670912 1626 dbSNP
rs1046691990 1628 dbSNP
rs775033535 1629 dbSNP
rs1204146347 1633 dbSNP
rs879058982 1638 dbSNP
rs1188226267 1639 dbSNP
rs906746137 1641 dbSNP
rs993273180 1669 dbSNP
rs138342909 1672 dbSNP
rs541773999 1673 dbSNP
rs369150760 1674 dbSNP
rs578093297 1675 dbSNP
rs760167450 1680 dbSNP
rs780115436 1687 dbSNP
rs555051889 1688 dbSNP
rs533382311 1694 dbSNP
rs977971520 1697 dbSNP
rs575242795 1700 dbSNP
rs191071802 1701 dbSNP
rs1010974249 1710 dbSNP
rs1385674128 1713 dbSNP
rs989296957 1728 dbSNP
rs921704612 1736 dbSNP
rs1432131978 1738 dbSNP
rs1391524191 1739 dbSNP
rs931740837 1740 dbSNP
rs1029469068 1742 dbSNP
rs563848329 1761 dbSNP
rs183202972 1763 dbSNP
rs1359387909 1765 dbSNP
rs1467849919 1767 dbSNP
rs1008813282 1772 dbSNP
rs1199837722 1774 dbSNP
rs540061504 1791 dbSNP
rs559983669 1793 dbSNP
rs1382645075 1796 dbSNP
rs1018856038 1804 dbSNP
rs1436520041 1824 dbSNP
rs890086958 1826 dbSNP
rs961927663 1828 dbSNP
rs971898857 1838 dbSNP
rs940954820 1839 dbSNP
rs529161117 1841 dbSNP
rs1360021440 1850 dbSNP
rs1036544517 1865 dbSNP
rs1346697386 1868 dbSNP
rs377114163 1870 dbSNP
rs1279512342 1871 dbSNP
rs899357297 1877 dbSNP
rs552016223 1878 dbSNP
rs1055961138 1880 dbSNP
rs894592525 1883 dbSNP
rs768330534 1888 dbSNP
rs1209344854 1889 dbSNP
rs1249340005 1895 dbSNP
rs1404797774 1895 dbSNP
rs915612592 1897 dbSNP
rs1465713676 1904 dbSNP
rs568356757 1905 dbSNP
rs1161411160 1909 dbSNP
rs1472879141 1915 dbSNP
rs981103865 1936 dbSNP
rs370511357 1937 dbSNP
rs79813278 1939 dbSNP
rs935556794 1941 dbSNP
rs572084134 1942 dbSNP
rs1425378678 1945 dbSNP
rs368503546 1946 dbSNP
rs16879201 1949 dbSNP
rs1405876645 1950 dbSNP
rs1228413717 1955 dbSNP
rs1327852450 1956 dbSNP
rs946847569 1959 dbSNP
rs747142721 1971 dbSNP
rs1050534521 1974 dbSNP
rs1227062387 1976 dbSNP
rs758594937 1979 dbSNP
rs16879202 1983 dbSNP
rs75598880 1984 dbSNP
rs1400252145 1994 dbSNP
rs1322658023 1996 dbSNP
rs540009814 1997 dbSNP
rs1369948292 2003 dbSNP
rs1411320715 2007 dbSNP
rs1156901988 2011 dbSNP
rs1221957593 2013 dbSNP
rs1281115274 2018 dbSNP
rs1186500742 2023 dbSNP
rs187562785 2034 dbSNP
rs1249575851 2040 dbSNP
rs146129588 2041 dbSNP
rs1027956043 2047 dbSNP
rs1286193120 2048 dbSNP
rs1445235296 2049 dbSNP
rs1214412079 2050 dbSNP
rs940335795 2051 dbSNP
rs1490733211 2054 dbSNP
rs1285160473 2059 dbSNP
rs951919761 2061 dbSNP
rs1381018342 2068 dbSNP
rs1300176692 2069 dbSNP
rs991693021 2073 dbSNP
rs920880740 2075 dbSNP
rs371565415 2076 dbSNP
rs1407024711 2079 dbSNP
rs535751850 2081 dbSNP
rs138920057 2086 dbSNP
rs575090279 2088 dbSNP
rs924258112 2089 dbSNP
rs1391753629 2092 dbSNP
rs1014769947 2099 dbSNP
rs934292754 2100 dbSNP
rs1245700083 2105 dbSNP
rs1264742693 2115 dbSNP
rs1453848733 2121 dbSNP
rs1400668342 2122 dbSNP
rs988425507 2123 dbSNP
rs1324248859 2124 dbSNP
rs915438845 2127 dbSNP
rs903252263 2128 dbSNP
rs1351736345 2131 dbSNP
rs998886860 2133 dbSNP
rs1277182493 2141 dbSNP
rs544199580 2142 dbSNP
rs1051023507 2163 dbSNP
rs1364649553 2166 dbSNP
rs1268507796 2168 dbSNP
rs16879204 2181 dbSNP
rs577336368 2183 dbSNP
rs944775139 2188 dbSNP
rs1010781528 2197 dbSNP
rs539565346 2201 dbSNP
rs1422644160 2203 dbSNP
rs953209497 2212 dbSNP
rs987644372 2214 dbSNP
rs191289925 2221 dbSNP
rs775859118 2224 dbSNP
rs113719418 2229 dbSNP
rs961756000 2233 dbSNP
rs1192557841 2236 dbSNP
rs1478107919 2256 dbSNP
rs897842313 2263 dbSNP
rs755112459 2270 dbSNP
rs1048976551 2271 dbSNP
rs1206245119 2272 dbSNP
rs1341883656 2275 dbSNP
rs887689542 2277 dbSNP
rs1271233904 2281 dbSNP
rs1361055170 2282 dbSNP
rs1274284646 2288 dbSNP
rs1403063055 2291 dbSNP
rs1056024227 2292 dbSNP
rs867006687 2294 dbSNP
rs1012786352 2296 dbSNP
rs1352538392 2299 dbSNP
rs1177837763 2301 dbSNP
rs1414656173 2302 dbSNP
rs1423881045 2303 dbSNP
rs1022791637 2307 dbSNP
rs971162039 2308 dbSNP
rs1483190322 2314 dbSNP
rs142467512 2320 dbSNP
rs934728371 2321 dbSNP
rs1054459855 2334 dbSNP
rs1031397979 2338 dbSNP
rs143977748 2339 dbSNP
rs955741596 2341 dbSNP
rs542546324 2346 dbSNP
rs1011252635 2351 dbSNP
rs562807854 2353 dbSNP
rs1221701600 2354 dbSNP
rs1028886605 2363 dbSNP
rs1288985735 2365 dbSNP
rs1416597398 2368 dbSNP
rs889012526 2371 dbSNP
rs1370966736 2386 dbSNP
rs116646474 2387 dbSNP
rs1448339453 2398 dbSNP
rs1018731313 2399 dbSNP
rs551015281 2401 dbSNP
rs1371358047 2403 dbSNP
rs1411950575 2404 dbSNP
rs1412029348 2407 dbSNP
rs878901247 2414 dbSNP
rs971754820 2415 dbSNP
rs1160621348 2416 dbSNP
rs34171880 2417 dbSNP
rs1330617514 2422 dbSNP
rs915527116 2425 dbSNP
rs968689261 2430 dbSNP
rs1441390246 2437 dbSNP
rs796862110 2439 dbSNP
rs1237175089 2445 dbSNP
rs1284638567 2447 dbSNP
rs986337143 2450 dbSNP
rs763436897 2452 dbSNP
rs1491230662 2453 dbSNP
rs910738398 2454 dbSNP
rs1208050400 2456 dbSNP
rs1243069381 2458 dbSNP
rs764312235 2460 dbSNP
rs182105921 2462 dbSNP
rs916194552 2464 dbSNP
rs570238459 2472 dbSNP
rs1319255133 2473 dbSNP
rs929364043 2481 dbSNP
rs558196180 2491 dbSNP
rs533448363 2493 dbSNP
rs1453683433 2495 dbSNP
rs188317693 2496 dbSNP
rs1167509381 2503 dbSNP
rs1437542343 2509 dbSNP
rs1424825995 2512 dbSNP
rs773490549 2523 dbSNP
rs887729273 2540 dbSNP
rs924733311 2542 dbSNP
rs1013233792 2556 dbSNP
rs1451505726 2565 dbSNP
rs767153836 2567 dbSNP
rs1187929772 2575 dbSNP
rs1044315006 2577 dbSNP
rs893143768 2582 dbSNP
rs907050366 2600 dbSNP
rs1002675619 2616 dbSNP
rs547144345 2623 dbSNP
rs1320950326 2637 dbSNP
rs1289266623 2644 dbSNP
rs1245458104 2650 dbSNP
rs932691995 2663 dbSNP
rs1050177872 2665 dbSNP
rs1031463226 2672 dbSNP
rs10714753 2682 dbSNP
rs1197923426 2682 dbSNP
rs1458846922 2682 dbSNP
rs397996733 2682 dbSNP
rs879230890 2682 dbSNP
rs759851383 2694 dbSNP
rs955972241 2695 dbSNP
rs1162010942 2696 dbSNP
rs1431862417 2700 dbSNP
rs1011268400 2705 dbSNP
rs1463712716 2709 dbSNP
rs1018742600 2710 dbSNP
rs897634436 2711 dbSNP
rs1269534426 2714 dbSNP
rs1400240233 2718 dbSNP
rs1191728092 2720 dbSNP
rs566943157 2731 dbSNP
rs749643764 2733 dbSNP
rs1490154776 2736 dbSNP
rs1266515701 2739 dbSNP
rs1206960259 2740 dbSNP
rs1342591612 2743 dbSNP
rs1273551728 2746 dbSNP
rs917389761 2752 dbSNP
rs1384852275 2753 dbSNP
rs1450407043 2772 dbSNP
rs1301297755 2777 dbSNP
rs1387888139 2778 dbSNP
rs993226659 2779 dbSNP
rs1301690474 2792 dbSNP
rs1412127147 2801 dbSNP
rs1371527914 2803 dbSNP
rs116417992 2811 dbSNP
rs1460618278 2818 dbSNP
rs749998950 2825 dbSNP
rs326175 2830 dbSNP
rs148637759 2831 dbSNP
rs1184249346 2834 dbSNP
rs1201349921 2835 dbSNP
rs1483282720 2839 dbSNP
rs1193738319 2842 dbSNP
rs1249530480 2842 dbSNP
rs569557763 2858 dbSNP
rs1265434001 2859 dbSNP
rs537410521 2870 dbSNP
rs1320777133 2874 dbSNP
rs1281976523 2875 dbSNP
rs1230755073 2876 dbSNP
rs981654275 2890 dbSNP
rs370842341 2893 dbSNP
rs1248722773 2899 dbSNP
rs919377917 2900 dbSNP
rs1404546816 2906 dbSNP
rs1303632612 2907 dbSNP
rs924784275 2908 dbSNP
rs780205168 2919 dbSNP
rs1430318538 2920 dbSNP
rs1191126277 2921 dbSNP
rs565672352 2933 dbSNP
rs141166854 2934 dbSNP
rs1363043103 2935 dbSNP
rs867180427 2940 dbSNP
rs1425196534 2951 dbSNP
rs192646303 2957 dbSNP
rs6870733 2958 dbSNP
rs567312031 2967 dbSNP
rs938528883 2973 dbSNP
rs1385596956 2974 dbSNP
rs537776395 2979 dbSNP
rs368831930 2994 dbSNP
rs891565193 2998 dbSNP
rs1383365685 3002 dbSNP
rs1237411910 3003 dbSNP
rs1342634223 3018 dbSNP
rs1011757695 3019 dbSNP
rs1021346115 3020 dbSNP
rs1315650732 3022 dbSNP
rs553488987 3025 dbSNP
rs1325457919 3030 dbSNP
rs897730826 3039 dbSNP
rs1156727514 3040 dbSNP
rs573711810 3043 dbSNP
rs1459307672 3045 dbSNP
rs34341116 3045 dbSNP
rs1182624676 3049 dbSNP
rs1048874552 3053 dbSNP
rs1249357257 3055 dbSNP
rs1006472547 3064 dbSNP
rs1017849867 3071 dbSNP
rs1013040673 3077 dbSNP
rs1203870356 3078 dbSNP
rs966260727 3080 dbSNP
rs976251493 3081 dbSNP
rs971439941 3097 dbSNP
rs1380771977 3101 dbSNP
rs1003142624 3103 dbSNP
rs1031951898 3108 dbSNP
rs542813551 3120 dbSNP
rs956262263 3121 dbSNP
rs1026881197 3122 dbSNP
rs950891625 3127 dbSNP
rs990349815 3133 dbSNP
rs1391231046 3135 dbSNP
rs914722355 3145 dbSNP
rs1487147730 3148 dbSNP
rs1203421121 3149 dbSNP
rs1391697100 3149 dbSNP
rs562613706 3154 dbSNP
rs576302377 3157 dbSNP
rs985921212 3168 dbSNP
rs912583626 3172 dbSNP
rs944066514 3173 dbSNP
rs1453789692 3176 dbSNP
rs776074708 3178 dbSNP
rs1431150811 3183 dbSNP
rs1277119457 3188 dbSNP
rs373292298 3190 dbSNP
rs948704675 3191 dbSNP
rs980089620 3196 dbSNP
rs928563460 3197 dbSNP
rs887571750 3200 dbSNP
rs545357852 3205 dbSNP
rs1302461502 3210 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |:|||| |   :|||||| 
Target 5' auuAUACCACU---GCACUCCa 3'
1 - 19
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000338316.4 | 3UTR | AUUAUACCACUGCACUCCAGCCUGGGUGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000338316.4 | 3UTR | UAUACCACUGCACUCCAGCCUGGGUGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*