miRTarBase - #MIRT645993 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ACP6   
Synonyms ACPL1, LPAP, PACPL1
Description acid phosphatase 6, lysophosphatidic
Transcript NM_016361   
Putative miRNA Targets on ACP6
3'UTR of ACP6
(miRNA target sites are highlighted)
  81 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            |:::|| || | ||| | | 
37 - 57 95.00 -10.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30192822 18 COSMIC
COSN26964891 27 COSMIC
COSN30493173 29 COSMIC
COSN25694770 168 COSMIC
COSN1405160 588 COSMIC
COSN16422987 851 COSMIC
COSN20954319 1486 COSMIC
COSN22327923 1707 COSMIC
COSN20955205 1935 COSMIC
COSN20954752 2521 COSMIC
COSN20954318 2627 COSMIC
COSN20953905 2884 COSMIC
COSN20953065 3016 COSMIC
COSN26450131 3589 COSMIC
COSN22671098 3722 COSMIC
COSN16992972 3742 COSMIC
COSN20954751 3759 COSMIC
COSN8891344 4076 COSMIC
COSN5731556 4281 COSMIC
COSN21376333 4366 COSMIC
COSN23476073 4382 COSMIC
COSN9362803 4558 COSMIC
COSN20259283 4696 COSMIC
COSN32123511 4756 COSMIC
COSN16482491 4885 COSMIC
COSN29537894 4937 COSMIC
COSN14495373 4938 COSMIC
COSN23409149 5053 COSMIC
COSN26837899 5054 COSMIC
COSN27866689 5183 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1449679702 4 dbSNP
rs202120291 13 dbSNP
rs781953813 14 dbSNP
rs782164989 16 dbSNP
rs782735014 18 dbSNP
rs782023077 31 dbSNP
rs782394603 32 dbSNP
rs782254275 37 dbSNP
rs782622379 39 dbSNP
rs916657486 42 dbSNP
rs187407029 48 dbSNP
rs782331441 49 dbSNP
rs1201669598 51 dbSNP
rs782257096 65 dbSNP
rs1261209421 79 dbSNP
rs937208468 102 dbSNP
rs782167863 107 dbSNP
rs1422032113 108 dbSNP
rs1403983448 113 dbSNP
rs143507847 115 dbSNP
rs1407357674 118 dbSNP
rs1295803246 119 dbSNP
rs973326753 121 dbSNP
rs1430952499 122 dbSNP
rs1271604245 124 dbSNP
rs1353917190 139 dbSNP
rs961918721 162 dbSNP
rs907580898 163 dbSNP
rs1361498026 175 dbSNP
rs987148857 180 dbSNP
rs954637173 181 dbSNP
rs1446520585 182 dbSNP
rs1194118296 204 dbSNP
rs587674828 211 dbSNP
rs1244062581 212 dbSNP
rs1443101712 232 dbSNP
rs1183349890 234 dbSNP
rs1386317365 249 dbSNP
rs1028759016 250 dbSNP
rs1400791236 252 dbSNP
rs974867160 259 dbSNP
rs1319820951 269 dbSNP
rs782338242 272 dbSNP
rs1338327237 277 dbSNP
rs1451550447 284 dbSNP
rs1315437258 285 dbSNP
rs1237810435 307 dbSNP
rs1384787300 307 dbSNP
rs1260103202 309 dbSNP
rs1349958949 325 dbSNP
rs1205801700 326 dbSNP
rs1286501421 329 dbSNP
rs958237417 331 dbSNP
rs1032432740 339 dbSNP
rs587753432 349 dbSNP
rs999772321 350 dbSNP
rs1244103584 355 dbSNP
rs902764107 357 dbSNP
rs1024959752 360 dbSNP
rs1013570721 362 dbSNP
rs1363743701 363 dbSNP
rs1470832308 366 dbSNP
rs1159795715 369 dbSNP
rs895116446 374 dbSNP
rs1399489856 375 dbSNP
rs1468950804 378 dbSNP
rs1337011339 380 dbSNP
rs1407974487 382 dbSNP
rs1055229752 388 dbSNP
rs1306124318 392 dbSNP
rs1336260651 393 dbSNP
rs1241178054 394 dbSNP
rs782223100 412 dbSNP
rs587681020 413 dbSNP
rs587652295 434 dbSNP
rs148814331 435 dbSNP
rs940623727 446 dbSNP
rs1263996576 451 dbSNP
rs1462889736 460 dbSNP
rs907773495 462 dbSNP
rs1250335530 476 dbSNP
rs1438871293 488 dbSNP
rs1184669586 492 dbSNP
rs782320499 501 dbSNP
rs933012743 502 dbSNP
rs1479843720 509 dbSNP
rs1176619623 512 dbSNP
rs921559973 513 dbSNP
rs115425617 524 dbSNP
rs1396995561 527 dbSNP
rs1393040573 533 dbSNP
rs1321528815 553 dbSNP
rs1343647653 561 dbSNP
rs1223000127 565 dbSNP
rs1284069629 575 dbSNP
rs1325923047 576 dbSNP
rs1225576618 578 dbSNP
rs957781341 579 dbSNP
rs1340532050 589 dbSNP
rs1198034763 590 dbSNP
rs1267381810 594 dbSNP
rs145464683 605 dbSNP
rs782676243 611 dbSNP
rs1426336872 612 dbSNP
rs782512515 618 dbSNP
rs114621635 619 dbSNP
rs1463359244 623 dbSNP
rs1161538464 629 dbSNP
rs1014225924 632 dbSNP
rs1405553846 640 dbSNP
rs1303805018 642 dbSNP
rs1369886447 650 dbSNP
rs895156759 652 dbSNP
rs1034060312 653 dbSNP
rs995646476 654 dbSNP
rs1230086878 661 dbSNP
rs879951630 682 dbSNP
rs1290111375 683 dbSNP
rs898575194 684 dbSNP
rs1223937502 693 dbSNP
rs1293294109 706 dbSNP
rs1037569364 722 dbSNP
rs940522168 724 dbSNP
rs12744461 725 dbSNP
rs1429993670 728 dbSNP
rs1181521005 743 dbSNP
rs587616952 751 dbSNP
rs12045199 755 dbSNP
rs933192360 757 dbSNP
rs879981353 759 dbSNP
rs974806145 763 dbSNP
rs1451730545 765 dbSNP
rs1288448152 770 dbSNP
rs587674513 772 dbSNP
rs1437624431 774 dbSNP
rs782484820 779 dbSNP
rs34258431 790 dbSNP
rs1313327770 794 dbSNP
rs781793149 795 dbSNP
rs1247287655 797 dbSNP
rs782710048 801 dbSNP
rs1317812504 811 dbSNP
rs1314541812 814 dbSNP
rs1214445559 821 dbSNP
rs1486626334 822 dbSNP
rs1201440993 827 dbSNP
rs375072019 832 dbSNP
rs977787902 833 dbSNP
rs1445055187 840 dbSNP
rs1185276732 843 dbSNP
rs587602345 844 dbSNP
rs587742384 845 dbSNP
rs1345898610 848 dbSNP
rs1458994070 855 dbSNP
rs992427585 864 dbSNP
rs1405755520 872 dbSNP
rs587686544 874 dbSNP
rs1305022857 884 dbSNP
rs1371810058 892 dbSNP
rs1223755672 897 dbSNP
rs1307060871 900 dbSNP
rs959889272 917 dbSNP
rs1221267523 933 dbSNP
rs1033721281 952 dbSNP
rs782546437 955 dbSNP
rs587629519 961 dbSNP
rs1231027208 966 dbSNP
rs587729911 970 dbSNP
rs1177755493 971 dbSNP
rs1408746222 973 dbSNP
rs962677918 975 dbSNP
rs781908121 990 dbSNP
rs1473631266 1019 dbSNP
rs781903255 1019 dbSNP
rs1174460781 1023 dbSNP
rs1428874786 1029 dbSNP
rs1470464809 1032 dbSNP
rs1015697735 1042 dbSNP
rs782778112 1043 dbSNP
rs12045115 1044 dbSNP
rs1052029638 1065 dbSNP
rs587603057 1072 dbSNP
rs1351731045 1074 dbSNP
rs1402576168 1079 dbSNP
rs1282155933 1080 dbSNP
rs1323798219 1082 dbSNP
rs997476566 1083 dbSNP
rs587708553 1086 dbSNP
rs1038720027 1096 dbSNP
rs141108879 1097 dbSNP
rs1234535146 1098 dbSNP
rs1484043227 1101 dbSNP
rs1197358107 1107 dbSNP
rs1268323935 1108 dbSNP
rs1480874000 1125 dbSNP
rs1174559756 1128 dbSNP
rs1417768813 1129 dbSNP
rs1171667605 1131 dbSNP
rs1409759131 1131 dbSNP
rs1372937242 1135 dbSNP
rs1423366704 1139 dbSNP
rs146529615 1140 dbSNP
rs782012979 1143 dbSNP
rs1042128644 1151 dbSNP
rs1345645508 1155 dbSNP
rs78038214 1159 dbSNP
rs1268077105 1164 dbSNP
rs918133229 1173 dbSNP
rs1214953757 1176 dbSNP
rs1276580762 1191 dbSNP
rs782112020 1200 dbSNP
rs1221724261 1204 dbSNP
rs1357153836 1204 dbSNP
rs1291070566 1208 dbSNP
rs959679971 1211 dbSNP
rs1201195171 1218 dbSNP
rs57463094 1219 dbSNP
rs1475243774 1223 dbSNP
rs1187470235 1228 dbSNP
rs974291863 1241 dbSNP
rs962710793 1244 dbSNP
rs1163526704 1246 dbSNP
rs868908753 1262 dbSNP
rs1406605345 1270 dbSNP
rs782796095 1271 dbSNP
rs115387983 1276 dbSNP
rs1299521163 1284 dbSNP
rs782641721 1291 dbSNP
rs1245106023 1299 dbSNP
rs955633596 1300 dbSNP
rs1030191461 1303 dbSNP
rs782353568 1306 dbSNP
rs1315653632 1308 dbSNP
rs1357077128 1312 dbSNP
rs1211704671 1320 dbSNP
rs1282333060 1323 dbSNP
rs1446604195 1332 dbSNP
rs1209647493 1338 dbSNP
rs144088798 1339 dbSNP
rs1443197941 1347 dbSNP
rs1183445957 1354 dbSNP
rs1369560667 1355 dbSNP
rs782237718 1361 dbSNP
rs1474091316 1375 dbSNP
rs782565922 1385 dbSNP
rs1406673162 1389 dbSNP
rs1400880129 1394 dbSNP
rs1322172907 1398 dbSNP
rs1403546775 1399 dbSNP
rs1451670571 1402 dbSNP
rs903532651 1408 dbSNP
rs1337220714 1416 dbSNP
rs1042034039 1419 dbSNP
rs945163663 1424 dbSNP
rs1342195529 1428 dbSNP
rs1236845300 1434 dbSNP
rs1277827513 1436 dbSNP
rs917647673 1437 dbSNP
rs1056659842 1439 dbSNP
rs1350068615 1441 dbSNP
rs1229198648 1451 dbSNP
rs1270253885 1454 dbSNP
rs782328702 1465 dbSNP
rs1460212883 1469 dbSNP
rs797024935 1476 dbSNP
rs183160839 1478 dbSNP
rs75614143 1488 dbSNP
rs191713387 1495 dbSNP
rs908576962 1500 dbSNP
rs587700767 1512 dbSNP
rs1180315554 1515 dbSNP
rs982766294 1520 dbSNP
rs1362671810 1526 dbSNP
rs1472636757 1530 dbSNP
rs1160855900 1535 dbSNP
rs1426758207 1543 dbSNP
rs955507558 1544 dbSNP
rs1030177970 1545 dbSNP
rs139327993 1554 dbSNP
rs1176852259 1556 dbSNP
rs188172753 1561 dbSNP
rs1389550699 1577 dbSNP
rs1328133629 1579 dbSNP
rs1335174600 1582 dbSNP
rs1410530195 1583 dbSNP
rs587684772 1586 dbSNP
rs1290353362 1587 dbSNP
rs1321665900 1593 dbSNP
rs1223174470 1594 dbSNP
rs964910725 1608 dbSNP
rs1017353925 1618 dbSNP
rs1347617439 1621 dbSNP
rs1194518393 1641 dbSNP
rs1250452653 1647 dbSNP
rs1000778035 1652 dbSNP
rs1483703494 1662 dbSNP
rs1183713009 1667 dbSNP
rs1266204763 1673 dbSNP
rs1479895378 1675 dbSNP
rs59438946 1685 dbSNP
rs1379108380 1698 dbSNP
rs1167193238 1703 dbSNP
rs1371072605 1705 dbSNP
rs1020607352 1726 dbSNP
rs1431620657 1736 dbSNP
rs1343771722 1740 dbSNP
rs1009631363 1741 dbSNP
rs896132360 1757 dbSNP
rs1333132182 1759 dbSNP
rs587764239 1760 dbSNP
rs1225686508 1764 dbSNP
rs1251173526 1775 dbSNP
rs1343465449 1784 dbSNP
rs1056622189 1791 dbSNP
rs1207986006 1798 dbSNP
rs182808735 1804 dbSNP
rs782497542 1811 dbSNP
rs1490051361 1813 dbSNP
rs1191344738 1823 dbSNP
rs905396540 1831 dbSNP
rs1269032970 1840 dbSNP
rs1038537576 1844 dbSNP
rs1426427262 1849 dbSNP
rs587607424 1858 dbSNP
rs1192193825 1860 dbSNP
rs587701787 1866 dbSNP
rs908774450 1867 dbSNP
rs1363720815 1874 dbSNP
rs1457483499 1877 dbSNP
rs1294254382 1882 dbSNP
rs1393146577 1885 dbSNP
rs1380785659 1890 dbSNP
rs983008259 1892 dbSNP
rs933998465 1900 dbSNP
rs1366410199 1901 dbSNP
rs922594869 1907 dbSNP
rs1313555045 1925 dbSNP
rs1358030533 1926 dbSNP
rs201918180 1936 dbSNP
rs150632180 1937 dbSNP
rs1484670353 1939 dbSNP
rs964159824 1946 dbSNP
rs1248359045 1948 dbSNP
rs142876449 1952 dbSNP
rs587636861 1954 dbSNP
rs967964271 1955 dbSNP
rs1020847868 1957 dbSNP
rs1384521509 1979 dbSNP
rs1424396951 1980 dbSNP
rs1009450226 1982 dbSNP
rs1165536575 1992 dbSNP
rs137878086 1994 dbSNP
rs587770679 2000 dbSNP
rs1320175040 2004 dbSNP
rs1389753653 2009 dbSNP
rs1437739594 2013 dbSNP
rs896141062 2018 dbSNP
rs1335208592 2020 dbSNP
rs1379073802 2032 dbSNP
rs1229433719 2038 dbSNP
rs1314220309 2039 dbSNP
rs1314636378 2040 dbSNP
rs1237799176 2041 dbSNP
rs1268385250 2042 dbSNP
rs1466022485 2043 dbSNP
rs1034687485 2044 dbSNP
rs587714592 2045 dbSNP
rs1483525769 2050 dbSNP
rs1183554509 2051 dbSNP
rs1258307948 2052 dbSNP
rs782618171 2054 dbSNP
rs1038571504 2055 dbSNP
rs1412951822 2056 dbSNP
rs941528509 2063 dbSNP
rs1174687799 2065 dbSNP
rs190623377 2066 dbSNP
rs1358997066 2079 dbSNP
rs1449333800 2090 dbSNP
rs1305143224 2096 dbSNP
rs887244429 2104 dbSNP
rs1408676407 2114 dbSNP
rs1047770303 2115 dbSNP
rs1221361469 2136 dbSNP
rs1277600026 2142 dbSNP
rs934220385 2152 dbSNP
rs1312593542 2162 dbSNP
rs1212061739 2182 dbSNP
rs922634421 2188 dbSNP
rs1480300211 2190 dbSNP
rs1039700572 2191 dbSNP
rs1252675836 2193 dbSNP
rs1473681979 2196 dbSNP
rs942809415 2203 dbSNP
rs587757349 2204 dbSNP
rs782617529 2209 dbSNP
rs1415417908 2210 dbSNP
rs186102893 2210 dbSNP
rs1353267491 2228 dbSNP
rs868958614 2228 dbSNP
rs1308090460 2229 dbSNP
rs587767091 2229 dbSNP
rs183148722 2230 dbSNP
rs782433476 2232 dbSNP
rs200935966 2264 dbSNP
rs913696868 2265 dbSNP
rs1367966981 2267 dbSNP
rs988500617 2277 dbSNP
rs1220722131 2279 dbSNP
rs1293255517 2279 dbSNP
rs1341330436 2282 dbSNP
rs960648025 2285 dbSNP
rs1035125602 2287 dbSNP
rs1275379527 2292 dbSNP
rs1220449499 2295 dbSNP
rs374088684 2301 dbSNP
rs587774962 2307 dbSNP
rs969018454 2308 dbSNP
rs1478517950 2313 dbSNP
rs1193256379 2325 dbSNP
rs1417878715 2327 dbSNP
rs1449345772 2340 dbSNP
rs1169822056 2342 dbSNP
rs1371801276 2355 dbSNP
rs1422223944 2360 dbSNP
rs1322366509 2375 dbSNP
rs374823718 2382 dbSNP
rs1005271037 2383 dbSNP
rs191020099 2385 dbSNP
rs1229002807 2388 dbSNP
rs887277105 2393 dbSNP
rs1047224296 2406 dbSNP
rs1226676768 2407 dbSNP
rs1289295818 2412 dbSNP
rs1452385461 2416 dbSNP
rs1224082765 2417 dbSNP
rs1246535777 2423 dbSNP
rs1464735844 2428 dbSNP
rs1189713823 2442 dbSNP
rs1449030779 2442 dbSNP
rs782069348 2442 dbSNP
rs1406689704 2445 dbSNP
rs868923641 2455 dbSNP
rs998879060 2460 dbSNP
rs1387550605 2467 dbSNP
rs1435559783 2469 dbSNP
rs1322375481 2470 dbSNP
rs1380450212 2471 dbSNP
rs1447267011 2472 dbSNP
rs587637562 2484 dbSNP
rs1357184297 2485 dbSNP
rs1230175558 2500 dbSNP
rs1266490033 2501 dbSNP
rs1328811076 2511 dbSNP
rs901412473 2526 dbSNP
rs1209741726 2551 dbSNP
rs1040135521 2557 dbSNP
rs942723501 2568 dbSNP
rs1441165477 2569 dbSNP
rs925928718 2572 dbSNP
rs1043123463 2579 dbSNP
rs1187485777 2598 dbSNP
rs370149558 2598 dbSNP
rs587652935 2600 dbSNP
rs782433306 2601 dbSNP
rs1410765107 2614 dbSNP
rs1457480464 2616 dbSNP
rs587764385 2617 dbSNP
rs75975824 2618 dbSNP
rs1334747191 2627 dbSNP
rs12568313 2631 dbSNP
rs1450276905 2633 dbSNP
rs927920006 2634 dbSNP
rs1286607899 2635 dbSNP
rs981067203 2637 dbSNP
rs1350073556 2639 dbSNP
rs969049666 2642 dbSNP
rs1270363599 2644 dbSNP
rs1343353699 2652 dbSNP
rs1016571825 2655 dbSNP
rs1005344688 2659 dbSNP
rs1444691931 2661 dbSNP
rs1179348756 2669 dbSNP
rs1250492266 2670 dbSNP
rs1472685260 2671 dbSNP
rs951104210 2675 dbSNP
rs1375652515 2685 dbSNP
rs78488547 2707 dbSNP
rs185775656 2728 dbSNP
rs587595087 2730 dbSNP
rs1173000260 2731 dbSNP
rs998348180 2735 dbSNP
rs1408182257 2736 dbSNP
rs148496381 2744 dbSNP
rs75556492 2746 dbSNP
rs1410625820 2749 dbSNP
rs1290451259 2757 dbSNP
rs1329655897 2758 dbSNP
rs1232971012 2772 dbSNP
rs144678070 2776 dbSNP
rs1347728041 2778 dbSNP
rs1203661252 2781 dbSNP
rs1273229285 2788 dbSNP
rs1483098640 2801 dbSNP
rs1206782380 2805 dbSNP
rs1264805772 2818 dbSNP
rs57515690 2821 dbSNP
rs1043028361 2825 dbSNP
rs1447532879 2829 dbSNP
rs587654539 2831 dbSNP
rs946162583 2836 dbSNP
rs587752528 2844 dbSNP
rs181694120 2845 dbSNP
rs1057456598 2854 dbSNP
rs1386469974 2855 dbSNP
rs189798021 2861 dbSNP
rs1333222124 2864 dbSNP
rs927752647 2869 dbSNP
rs1297526422 2874 dbSNP
rs186179259 2875 dbSNP
rs782107363 2882 dbSNP
rs1263215272 2896 dbSNP
rs947949473 2903 dbSNP
rs1210089024 2909 dbSNP
rs1269157379 2913 dbSNP
rs909584003 2919 dbSNP
rs1187790923 2924 dbSNP
rs1390698797 2925 dbSNP
rs143047835 2930 dbSNP
rs1172593291 2940 dbSNP
rs1366819723 2946 dbSNP
rs1457557370 2952 dbSNP
rs139335155 2957 dbSNP
rs868979565 2958 dbSNP
rs587774401 2971 dbSNP
rs976880630 2986 dbSNP
rs1320378476 2988 dbSNP
rs1366513193 2996 dbSNP
rs181374471 3021 dbSNP
rs1437968871 3024 dbSNP
rs147332772 3029 dbSNP
rs1320630360 3030 dbSNP
rs1244984378 3037 dbSNP
rs377731299 3051 dbSNP
rs1266858654 3060 dbSNP
rs782319405 3065 dbSNP
rs143960538 3067 dbSNP
rs189050970 3080 dbSNP
rs904769446 3083 dbSNP
rs587755601 3089 dbSNP
rs1180076962 3090 dbSNP
rs1254087921 3098 dbSNP
rs1423330272 3105 dbSNP
rs1165642068 3113 dbSNP
rs1420284278 3116 dbSNP
rs1455878173 3119 dbSNP
rs1158867679 3121 dbSNP
rs1021602982 3136 dbSNP
rs1455772285 3137 dbSNP
rs1010209753 3139 dbSNP
rs183860411 3140 dbSNP
rs1294665852 3142 dbSNP
rs1348206622 3148 dbSNP
rs1227424604 3154 dbSNP
rs1057224870 3173 dbSNP
rs1330954117 3177 dbSNP
rs1207861405 3184 dbSNP
rs1255323714 3187 dbSNP
rs782021669 3204 dbSNP
rs1483574036 3210 dbSNP
rs782479116 3213 dbSNP
rs1182485879 3218 dbSNP
rs1259754847 3218 dbSNP
rs1471707574 3219 dbSNP
rs906406189 3221 dbSNP
rs1181772855 3224 dbSNP
rs1044913903 3229 dbSNP
rs1421266426 3238 dbSNP
rs782416584 3275 dbSNP
rs1174472712 3277 dbSNP
rs947982160 3288 dbSNP
rs1359094300 3293 dbSNP
rs587749227 3297 dbSNP
rs984016051 3298 dbSNP
rs929673335 3308 dbSNP
rs78167191 3312 dbSNP
rs918215716 3336 dbSNP
rs1375147303 3342 dbSNP
rs976533516 3343 dbSNP
rs587667480 3353 dbSNP
rs587612530 3355 dbSNP
rs1300377643 3377 dbSNP
rs1312675413 3378 dbSNP
rs1212959273 3386 dbSNP
rs1282520382 3392 dbSNP
rs1482119143 3396 dbSNP
rs1204634846 3411 dbSNP
rs1252797330 3418 dbSNP
rs782245268 3425 dbSNP
rs181884599 3427 dbSNP
rs1189811730 3437 dbSNP
rs1424968640 3454 dbSNP
rs1434219700 3459 dbSNP
rs1176084155 3461 dbSNP
rs1387723604 3483 dbSNP
rs1428520787 3487 dbSNP
rs782591988 3493 dbSNP
rs985573115 3505 dbSNP
rs587671844 3507 dbSNP
rs1433905588 3508 dbSNP
rs1292678362 3521 dbSNP
rs1368083028 3525 dbSNP
rs1236323037 3529 dbSNP
rs1295336562 3534 dbSNP
rs1341444594 3535 dbSNP
rs1227761307 3539 dbSNP
rs1273855350 3540 dbSNP
rs371287785 3547 dbSNP
rs1439753955 3551 dbSNP
rs1219674910 3556 dbSNP
rs1489019262 3569 dbSNP
rs1195954822 3578 dbSNP
rs1246721804 3594 dbSNP
rs1449431595 3598 dbSNP
rs57359024 3604 dbSNP
rs1421047054 3613 dbSNP
rs1403200264 3615 dbSNP
rs1021844674 3616 dbSNP
rs868944782 3617 dbSNP
rs587716047 3630 dbSNP
rs1318373010 3635 dbSNP
rs1364333824 3637 dbSNP
rs1435786978 3650 dbSNP
rs1270796528 3651 dbSNP
rs1341565751 3670 dbSNP
rs782584041 3671 dbSNP
rs1036097894 3678 dbSNP
rs1289410712 3691 dbSNP
rs76644209 3701 dbSNP
rs1215905598 3713 dbSNP
rs776356245 3715 dbSNP
rs1464799638 3722 dbSNP
rs1194553430 3749 dbSNP
rs781897782 3750 dbSNP
rs1012106187 3753 dbSNP
rs782711241 3761 dbSNP
rs1414066649 3762 dbSNP
rs1462728727 3771 dbSNP
rs1156661104 3772 dbSNP
rs1387664033 3783 dbSNP
rs61657066 3791 dbSNP
rs1320221911 3794 dbSNP
rs929845272 3796 dbSNP
rs114863681 3797 dbSNP
rs1283713487 3800 dbSNP
rs587660146 3804 dbSNP
rs781829941 3809 dbSNP
rs1235391348 3810 dbSNP
rs1266577509 3812 dbSNP
rs1328908188 3814 dbSNP
rs1206181434 3819 dbSNP
rs115960700 3822 dbSNP
rs587682402 3832 dbSNP
rs1208778972 3836 dbSNP
rs910987196 3838 dbSNP
rs1179609143 3839 dbSNP
rs985146115 3843 dbSNP
rs782591660 3844 dbSNP
rs1160152346 3847 dbSNP
rs1399940343 3861 dbSNP
rs1413883605 3870 dbSNP
rs782745751 3879 dbSNP
rs1333529241 3883 dbSNP
rs914703523 3887 dbSNP
rs989116533 3892 dbSNP
rs956481104 3895 dbSNP
rs1350167388 3899 dbSNP
rs1240208899 3915 dbSNP
rs1035723784 3948 dbSNP
rs1343465858 3960 dbSNP
rs1280369999 3963 dbSNP
rs1486370021 3964 dbSNP
rs1003268744 3972 dbSNP
rs970061690 3978 dbSNP
rs1438086796 3981 dbSNP
rs138280076 3998 dbSNP
rs1375738885 3999 dbSNP
rs1477631318 4001 dbSNP
rs1174187844 4004 dbSNP
rs1006278145 4005 dbSNP
rs1436650664 4016 dbSNP
rs1306332624 4017 dbSNP
rs1370156837 4019 dbSNP
rs888285417 4022 dbSNP
rs1331236936 4025 dbSNP
rs1329744843 4029 dbSNP
rs1233079658 4051 dbSNP
rs587749708 4056 dbSNP
rs781964132 4058 dbSNP
rs1225503786 4061 dbSNP
rs897043065 4065 dbSNP
rs1339597696 4073 dbSNP
rs1197211203 4081 dbSNP
rs1264917925 4086 dbSNP
rs1450832171 4088 dbSNP
rs1040942335 4089 dbSNP
rs115326112 4103 dbSNP
rs910852878 4104 dbSNP
rs1447630589 4111 dbSNP
rs782168168 4122 dbSNP
rs1166776177 4124 dbSNP
rs371259671 4133 dbSNP
rs1372601125 4145 dbSNP
rs372939247 4150 dbSNP
rs947134895 4163 dbSNP
rs150312239 4164 dbSNP
rs989371968 4168 dbSNP
rs1169877730 4173 dbSNP
rs879994711 4177 dbSNP
rs1440623323 4179 dbSNP
rs868974334 4185 dbSNP
rs72700335 4205 dbSNP
rs1433554808 4217 dbSNP
rs781906072 4218 dbSNP
rs1326507936 4219 dbSNP
rs1229083246 4227 dbSNP
rs1263298351 4235 dbSNP
rs782376985 4240 dbSNP
rs1214060003 4241 dbSNP
rs1274874381 4242 dbSNP
rs928901106 4243 dbSNP
rs1463453539 4244 dbSNP
rs981689366 4249 dbSNP
rs970055690 4269 dbSNP
rs1187887527 4274 dbSNP
rs1261049732 4277 dbSNP
rs1429215676 4280 dbSNP
rs587689599 4288 dbSNP
rs1195500465 4298 dbSNP
rs1366902160 4299 dbSNP
rs184532429 4324 dbSNP
rs1166043268 4331 dbSNP
rs1397176740 4334 dbSNP
rs1456045537 4340 dbSNP
rs1288807212 4341 dbSNP
rs1363340755 4343 dbSNP
rs1383411991 4348 dbSNP
rs1022935490 4355 dbSNP
rs1310010812 4367 dbSNP
rs1339491519 4380 dbSNP
rs192984227 4390 dbSNP
rs782091395 4392 dbSNP
rs1006351762 4404 dbSNP
rs1261229291 4408 dbSNP
rs140199152 4413 dbSNP
rs1206948652 4425 dbSNP
rs1254195078 4432 dbSNP
rs1474980019 4435 dbSNP
rs1188925554 4440 dbSNP
rs148232231 4442 dbSNP
rs782002728 4445 dbSNP
rs994423135 4448 dbSNP
rs116271131 4456 dbSNP
rs868973444 4458 dbSNP
rs188696671 4461 dbSNP
rs1346279023 4462 dbSNP
rs1455853410 4477 dbSNP
rs1374356891 4487 dbSNP
rs143022701 4491 dbSNP
rs1314347065 4494 dbSNP
rs60132470 4498 dbSNP
rs112368342 4505 dbSNP
rs782027428 4521 dbSNP
rs1307501759 4524 dbSNP
rs1318602135 4535 dbSNP
rs889487997 4542 dbSNP
rs77348542 4543 dbSNP
rs1485391808 4547 dbSNP
rs1211756978 4554 dbSNP
rs1259867029 4557 dbSNP
rs781804601 4559 dbSNP
rs1482221234 4570 dbSNP
rs1176967666 4580 dbSNP
rs1409206402 4581 dbSNP
rs1421361596 4585 dbSNP
rs78663078 4586 dbSNP
rs892869912 4589 dbSNP
rs1052850710 4608 dbSNP
rs372999273 4609 dbSNP
rs928787716 4613 dbSNP
rs1368290914 4618 dbSNP
rs587699671 4624 dbSNP
rs948949968 4629 dbSNP
rs1375262373 4632 dbSNP
rs915949941 4635 dbSNP
rs1384944536 4644 dbSNP
rs587656650 4646 dbSNP
rs1348582534 4659 dbSNP
rs140835704 4667 dbSNP
rs1235072296 4668 dbSNP
rs951999178 4672 dbSNP
rs587702607 4676 dbSNP
rs587646774 4710 dbSNP
rs1026835564 4712 dbSNP
rs972136538 4713 dbSNP
rs961511669 4714 dbSNP
rs587769015 4720 dbSNP
rs1481831446 4728 dbSNP
rs1233747397 4729 dbSNP
rs1189900583 4734 dbSNP
rs1019436332 4735 dbSNP
rs1455121347 4745 dbSNP
rs1174918934 4749 dbSNP
rs1008139516 4751 dbSNP
rs1408939453 4753 dbSNP
rs889682180 4756 dbSNP
rs1355972152 4778 dbSNP
rs1325018287 4783 dbSNP
rs1371614705 4786 dbSNP
rs1443047827 4787 dbSNP
rs587687797 4790 dbSNP
rs782230501 4791 dbSNP
rs1359966584 4793 dbSNP
rs892780225 4820 dbSNP
rs1273961916 4829 dbSNP
rs1309556888 4840 dbSNP
rs782587312 4849 dbSNP
rs782501127 4854 dbSNP
rs1272968961 4855 dbSNP
rs1196059010 4860 dbSNP
rs1245604056 4862 dbSNP
rs587632629 4866 dbSNP
rs1474784928 4870 dbSNP
rs934391668 4873 dbSNP
rs1421160411 4874 dbSNP
rs1421736528 4882 dbSNP
rs1163883187 4888 dbSNP
rs1394987719 4895 dbSNP
rs587733264 4907 dbSNP
rs1318481802 4908 dbSNP
rs1344597223 4910 dbSNP
rs10900387 4920 dbSNP
rs1270888445 4929 dbSNP
rs11811290 4937 dbSNP
rs1339886744 4938 dbSNP
rs587726220 4938 dbSNP
rs1335929915 4943 dbSNP
rs1216001091 4944 dbSNP
rs200823745 4947 dbSNP
rs907396834 4947 dbSNP
rs75563743 4951 dbSNP
rs763696811 4952 dbSNP
rs1186792022 4953 dbSNP
rs368991368 4954 dbSNP
rs1476057729 4959 dbSNP
rs1156769169 4988 dbSNP
rs374824499 4994 dbSNP
rs1407124212 4996 dbSNP
rs1401268409 4998 dbSNP
rs1319017990 5002 dbSNP
rs1347044484 5004 dbSNP
rs1413099972 5011 dbSNP
rs1312485248 5016 dbSNP
rs1356410570 5017 dbSNP
rs1235487766 5018 dbSNP
rs1278192279 5019 dbSNP
rs587758470 5022 dbSNP
rs1350525250 5027 dbSNP
rs184567511 5029 dbSNP
rs144158616 5037 dbSNP
rs1484414180 5047 dbSNP
rs1209606492 5054 dbSNP
rs781916847 5055 dbSNP
rs985019799 5055 dbSNP
rs1486473628 5063 dbSNP
rs1179373290 5068 dbSNP
rs1232115674 5075 dbSNP
rs1470431629 5081 dbSNP
rs930634729 5099 dbSNP
rs1160237082 5102 dbSNP
rs1423041025 5108 dbSNP
rs1432938043 5120 dbSNP
rs1173136755 5128 dbSNP
rs1376266488 5130 dbSNP
rs1416877629 5146 dbSNP
rs80031698 5149 dbSNP
rs782029044 5156 dbSNP
rs140320565 5157 dbSNP
rs1019889458 5161 dbSNP
rs1281768040 5162 dbSNP
rs1346429970 5165 dbSNP
rs1232892542 5170 dbSNP
rs587671908 5173 dbSNP
rs1349543027 5176 dbSNP
rs1193720338 5178 dbSNP
rs1249482829 5181 dbSNP
rs953851464 5184 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             :::|||||   :|||||| 
Target 5' aucGUGCCAUU---GCACUCCa 3'
4 - 22
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000369238.6 | 3UTR | AAGAUCGUGCCAUUGCACUCCAGCCUGGGCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.548 2.8e-3 0.565 2.0e-3 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.408 2.7e-2 -0.318 7.0e-2 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.273 9.8e-2 -0.238 1.3e-1 24 Click to see details
GSE17306 Multiple myeloma 0.157 1.4e-1 0.213 7.1e-2 49 Click to see details
GSE17498 Multiple myeloma -0.144 1.9e-1 -0.259 5.3e-2 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.127 2.7e-1 0.172 2.1e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.076 2.8e-1 0.031 4.0e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.189 2.8e-1 0.010 4.9e-1 12 Click to see details
GSE38226 Liver fibrosis 0.109 3.2e-1 0.258 1.3e-1 21 Click to see details
GSE32688 Pancreatic cancer -0.076 3.4e-1 -0.092 3.1e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.08 3.5e-1 -0.081 3.5e-1 25 Click to see details
GSE21849 B cell lymphoma -0.07 3.6e-1 0.436 9.0e-3 29 Click to see details
GSE14794 Lymphoblastoid cells -0.031 3.9e-1 -0.041 3.5e-1 90 Click to see details
GSE27834 Pluripotent stem cells -0.071 4.0e-1 -0.109 3.4e-1 16 Click to see details
GSE28260 Renal cortex and medulla -0.056 4.3e-1 -0.066 4.2e-1 13 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.053 4.6e-1 0.143 3.9e-1 6 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.001 5.0e-1 0.215 1.8e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.528 0 0.247 0.04 49 Click to see details
KICH -0.878 0 -0.786 0.01 8 Click to see details
THCA -0.96 0 -1.000 0.5 5 Click to see details
KIRP -0.328 0.19 -0.167 0.33 9 Click to see details
CHOL -0.289 0.23 -0.267 0.24 9 Click to see details
ESCA 0.44 0.23 0.500 0.2 5 Click to see details
STAD -0.189 0.33 0.048 0.46 8 Click to see details
HNSC 0.419 0.36 -0.500 0.33 3 Click to see details
KIRC -0.043 0.41 -0.045 0.41 29 Click to see details
KIRC -0.043 0.41 -0.045 0.41 29 Click to see details
KIRC -0.043 0.41 -0.045 0.41 29 Click to see details
KIRC -0.043 0.41 -0.045 0.41 29 Click to see details
KIRC -0.043 0.41 -0.045 0.41 29 Click to see details
KIRC -0.043 0.41 -0.045 0.41 29 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*