miRTarBase - #MIRT645092 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC35E2B   
Synonyms SLC35E2
Description solute carrier family 35 member E2B
Transcript NM_001110781   
Putative miRNA Targets on SLC35E2B
3'UTR of SLC35E2B
(miRNA target sites are highlighted)
4321 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             :::|||||   :|||||| 
Target 5' atcGTGCCATT---GCACTCCa 3'
2246 - 2264 140.00 -17.50
            ||||  | ||  |||:||| 
3465 - 3484 140.00 -12.60
              ||||  |||  ||| |||| 
1081 - 1103 127.00 -15.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30657161 28 COSMIC
COSN8645443 169 COSMIC
COSN8645442 170 COSMIC
COSN6507792 201 COSMIC
COSN22619490 384 COSMIC
COSN20073743 422 COSMIC
COSN27726545 1063 COSMIC
COSN24099435 1423 COSMIC
COSN24550774 1482 COSMIC
COSN17970044 1683 COSMIC
COSN5198162 1853 COSMIC
COSN17076254 2040 COSMIC
COSN32063646 2319 COSMIC
COSN24144072 2600 COSMIC
COSN23950526 2602 COSMIC
COSN17075930 2613 COSMIC
COSN24143292 2643 COSMIC
COSN17506119 2849 COSMIC
COSN20094155 3041 COSMIC
COSN24484050 3123 COSMIC
COSN21467094 3164 COSMIC
COSN6507775 3735 COSMIC
COSN15757342 4300 COSMIC
rs72634819 721 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1455948845 1 dbSNP
rs951794846 5 dbSNP
rs919556962 6 dbSNP
rs1055490205 10 dbSNP
rs937000631 11 dbSNP
rs547496333 18 dbSNP
rs925759375 20 dbSNP
rs118019725 22 dbSNP
rs1350283909 24 dbSNP
rs1241596653 28 dbSNP
rs535898665 29 dbSNP
rs971543841 31 dbSNP
rs769010476 32 dbSNP
rs1394738566 41 dbSNP
rs914047291 46 dbSNP
rs1467021041 48 dbSNP
rs1012970727 50 dbSNP
rs1235150949 52 dbSNP
rs1310331337 55 dbSNP
rs1171929565 57 dbSNP
rs1441612688 59 dbSNP
rs1300539212 62 dbSNP
rs958807056 63 dbSNP
rs549600907 64 dbSNP
rs371326653 65 dbSNP
rs1318121398 68 dbSNP
rs1433982628 69 dbSNP
rs1258038241 70 dbSNP
rs1200759396 72 dbSNP
rs1000238116 75 dbSNP
rs534528839 76 dbSNP
rs1241758256 77 dbSNP
rs1337755241 78 dbSNP
rs912110154 81 dbSNP
rs1467920439 83 dbSNP
rs529520031 86 dbSNP
rs1236464312 87 dbSNP
rs953471410 88 dbSNP
rs1393472347 93 dbSNP
rs1315279411 95 dbSNP
rs145415853 104 dbSNP
rs1415780150 107 dbSNP
rs1162469826 109 dbSNP
rs1027743732 117 dbSNP
rs1009453692 120 dbSNP
rs1311573521 121 dbSNP
rs1421640956 122 dbSNP
rs1361284513 124 dbSNP
rs188348131 125 dbSNP
rs147285260 126 dbSNP
rs1040208932 127 dbSNP
rs533338391 132 dbSNP
rs1014795432 134 dbSNP
rs564174168 135 dbSNP
rs74047818 142 dbSNP
rs1056109475 143 dbSNP
rs372215533 146 dbSNP
rs1469261288 147 dbSNP
rs756791000 151 dbSNP
rs1001216536 152 dbSNP
rs1488551079 153 dbSNP
rs572255432 159 dbSNP
rs1049283449 167 dbSNP
rs930328250 169 dbSNP
rs1265653260 170 dbSNP
rs1234341499 172 dbSNP
rs1237869863 181 dbSNP
rs555098187 188 dbSNP
rs1042830260 193 dbSNP
rs945769254 196 dbSNP
rs140118478 198 dbSNP
rs72634820 201 dbSNP
rs556398891 208 dbSNP
rs944871843 219 dbSNP
rs368924316 220 dbSNP
rs1458664625 221 dbSNP
rs1399017380 222 dbSNP
rs917479462 226 dbSNP
rs34272997 227 dbSNP
rs1453244557 229 dbSNP
rs147514173 230 dbSNP
rs1195512543 233 dbSNP
rs1478112794 234 dbSNP
rs920564919 240 dbSNP
rs1033138718 241 dbSNP
rs553850300 242 dbSNP
rs962145805 246 dbSNP
rs4074020 247 dbSNP
rs200640613 255 dbSNP
rs370445102 259 dbSNP
rs1332157293 261 dbSNP
rs1271678398 270 dbSNP
rs1262784469 272 dbSNP
rs1220776248 279 dbSNP
rs960109080 280 dbSNP
rs1034272437 282 dbSNP
rs1270112958 289 dbSNP
rs1001833018 293 dbSNP
rs904201226 299 dbSNP
rs1326609394 302 dbSNP
rs749882386 303 dbSNP
rs183639607 305 dbSNP
rs1257277455 307 dbSNP
rs1042730860 308 dbSNP
rs1048809718 310 dbSNP
rs1234436685 311 dbSNP
rs1346494570 316 dbSNP
rs930358795 320 dbSNP
rs767163610 321 dbSNP
rs1326812476 323 dbSNP
rs568170096 325 dbSNP
rs1466863871 326 dbSNP
rs891583013 329 dbSNP
rs1036008963 331 dbSNP
rs549275729 334 dbSNP
rs949710628 335 dbSNP
rs536070476 341 dbSNP
rs1347691731 347 dbSNP
rs191125202 348 dbSNP
rs991700471 349 dbSNP
rs1369130212 351 dbSNP
rs890598035 354 dbSNP
rs1394549696 355 dbSNP
rs937530503 356 dbSNP
rs1050715242 367 dbSNP
rs1442714716 372 dbSNP
rs1353744438 374 dbSNP
rs926079665 379 dbSNP
rs932256095 383 dbSNP
rs978882370 384 dbSNP
rs920839262 387 dbSNP
rs1452017300 388 dbSNP
rs973440904 396 dbSNP
rs550435108 399 dbSNP
rs1445607675 403 dbSNP
rs536344416 404 dbSNP
rs564139450 406 dbSNP
rs1211145685 407 dbSNP
rs907966443 409 dbSNP
rs1232683648 411 dbSNP
rs1202792603 420 dbSNP
rs547393342 425 dbSNP
rs1210323841 426 dbSNP
rs959916954 429 dbSNP
rs1311508225 431 dbSNP
rs1224568646 433 dbSNP
rs1034567328 434 dbSNP
rs1277560465 437 dbSNP
rs979945636 440 dbSNP
rs868837090 442 dbSNP
rs1339944198 443 dbSNP
rs1269414207 447 dbSNP
rs969062800 451 dbSNP
rs1021492122 457 dbSNP
rs1007448469 458 dbSNP
rs527741044 465 dbSNP
rs1225026676 466 dbSNP
rs888964945 467 dbSNP
rs1342026492 468 dbSNP
rs1175913393 471 dbSNP
rs1315084346 476 dbSNP
rs1476379902 477 dbSNP
rs1009890395 484 dbSNP
rs1258878677 485 dbSNP
rs1027875833 486 dbSNP
rs891425583 495 dbSNP
rs1216505837 498 dbSNP
rs1374937615 500 dbSNP
rs1282411278 501 dbSNP
rs1229868882 505 dbSNP
rs1311089528 509 dbSNP
rs1412161519 510 dbSNP
rs1019343738 515 dbSNP
rs1008365104 516 dbSNP
rs889532158 525 dbSNP
rs1051056998 526 dbSNP
rs569051438 532 dbSNP
rs545859954 552 dbSNP
rs1166437840 556 dbSNP
rs561864714 560 dbSNP
rs949762282 566 dbSNP
rs1419064657 567 dbSNP
rs1474665501 572 dbSNP
rs1164593109 574 dbSNP
rs1474515532 576 dbSNP
rs1264474138 578 dbSNP
rs767977637 580 dbSNP
rs541983630 583 dbSNP
rs899446581 585 dbSNP
rs1037924602 586 dbSNP
rs1474644607 587 dbSNP
rs1272327611 592 dbSNP
rs1231151169 594 dbSNP
rs940675073 602 dbSNP
rs907852334 608 dbSNP
rs576167810 611 dbSNP
rs1381202796 612 dbSNP
rs1359297508 617 dbSNP
rs946224064 622 dbSNP
rs979363423 622 dbSNP
rs1441197512 623 dbSNP
rs1393199118 625 dbSNP
rs938793253 627 dbSNP
rs1164747468 630 dbSNP
rs114043810 633 dbSNP
rs976793749 638 dbSNP
rs189120070 640 dbSNP
rs968570632 641 dbSNP
rs577211861 644 dbSNP
rs988666909 648 dbSNP
rs955721474 650 dbSNP
rs953439688 660 dbSNP
rs1027558881 673 dbSNP
rs1481478826 673 dbSNP
rs1293617090 676 dbSNP
rs995114015 682 dbSNP
rs1019270413 684 dbSNP
rs974658179 686 dbSNP
rs553760596 688 dbSNP
rs1007876922 691 dbSNP
rs953970349 692 dbSNP
rs1369868702 693 dbSNP
rs1028065126 694 dbSNP
rs996757504 699 dbSNP
rs1234154958 700 dbSNP
rs149396264 701 dbSNP
rs574558480 702 dbSNP
rs1461929032 704 dbSNP
rs1227263543 705 dbSNP
rs1353199437 710 dbSNP
rs1011399334 715 dbSNP
rs1005107414 718 dbSNP
rs1444518518 719 dbSNP
rs550737260 720 dbSNP
rs72634819 721 dbSNP
rs1408647141 723 dbSNP
rs1397164194 729 dbSNP
rs114530211 732 dbSNP
rs1421058444 734 dbSNP
rs927401426 736 dbSNP
rs1044450542 737 dbSNP
rs1479657975 738 dbSNP
rs1460628833 740 dbSNP
rs1211045231 744 dbSNP
rs1043310738 745 dbSNP
rs947228920 746 dbSNP
rs946208814 755 dbSNP
rs913368289 757 dbSNP
rs1335917164 758 dbSNP
rs185448343 762 dbSNP
rs1391173676 768 dbSNP
rs1231747296 769 dbSNP
rs1315323886 772 dbSNP
rs1435457778 774 dbSNP
rs539699867 778 dbSNP
rs1374952728 784 dbSNP
rs944078592 788 dbSNP
rs1179587930 796 dbSNP
rs1469724619 800 dbSNP
rs1273615629 801 dbSNP
rs1212880603 808 dbSNP
rs1180899737 811 dbSNP
rs911289259 820 dbSNP
rs1259583730 821 dbSNP
rs985891800 826 dbSNP
rs952734356 827 dbSNP
rs1351029617 828 dbSNP
rs1016058645 831 dbSNP
rs920548692 832 dbSNP
rs1288062387 834 dbSNP
rs570821648 836 dbSNP
rs1348980905 842 dbSNP
rs766672115 851 dbSNP
rs1415953140 854 dbSNP
rs973307567 864 dbSNP
rs1374155660 869 dbSNP
rs1383987861 870 dbSNP
rs1278978272 880 dbSNP
rs1158182513 881 dbSNP
rs961862704 883 dbSNP
rs1440680089 888 dbSNP
rs1419785127 892 dbSNP
rs746478401 896 dbSNP
rs1014683796 899 dbSNP
rs1165301042 903 dbSNP
rs1474840818 903 dbSNP
rs1255307995 907 dbSNP
rs1194772302 909 dbSNP
rs1447056709 912 dbSNP
rs1109645 917 dbSNP
rs1327132099 918 dbSNP
rs1234279547 921 dbSNP
rs1334829840 923 dbSNP
rs772944788 927 dbSNP
rs527656278 938 dbSNP
rs1440699019 943 dbSNP
rs1392726793 944 dbSNP
rs1326403907 949 dbSNP
rs1013978052 950 dbSNP
rs1411596010 951 dbSNP
rs546546470 954 dbSNP
rs1400867246 955 dbSNP
rs1372016589 957 dbSNP
rs1190315352 964 dbSNP
rs1406634631 968 dbSNP
rs959805850 969 dbSNP
rs1331502742 972 dbSNP
rs1214765621 973 dbSNP
rs1468298033 984 dbSNP
rs561972607 994 dbSNP
rs1034090743 997 dbSNP
rs548651899 998 dbSNP
rs1455170584 999 dbSNP
rs1269675315 1000 dbSNP
rs1001643230 1001 dbSNP
rs1373534875 1003 dbSNP
rs1304412148 1004 dbSNP
rs1439946462 1009 dbSNP
rs1347932837 1015 dbSNP
rs1253598355 1016 dbSNP
rs1410470185 1018 dbSNP
rs528398493 1019 dbSNP
rs1109644 1025 dbSNP
rs904148926 1037 dbSNP
rs546029999 1039 dbSNP
rs1043709135 1040 dbSNP
rs1010459040 1046 dbSNP
rs1245360153 1047 dbSNP
rs1206978129 1053 dbSNP
rs1218231060 1054 dbSNP
rs1272901615 1062 dbSNP
rs1203169159 1064 dbSNP
rs1350105614 1073 dbSNP
rs1317694975 1082 dbSNP
rs1283695051 1083 dbSNP
rs1365677005 1088 dbSNP
rs1281139750 1092 dbSNP
rs1442646390 1097 dbSNP
rs577174820 1099 dbSNP
rs1335151382 1101 dbSNP
rs891985507 1103 dbSNP
rs1041255319 1119 dbSNP
rs944172561 1120 dbSNP
rs911341792 1121 dbSNP
rs1350122451 1136 dbSNP
rs1304889399 1140 dbSNP
rs1049835614 1151 dbSNP
rs1179373896 1153 dbSNP
rs1470702366 1154 dbSNP
rs1234111791 1159 dbSNP
rs1251778012 1159 dbSNP
rs1180686427 1160 dbSNP
rs931310891 1161 dbSNP
rs919906396 1165 dbSNP
rs1210249236 1166 dbSNP
rs1431050034 1167 dbSNP
rs973743613 1168 dbSNP
rs1224170095 1169 dbSNP
rs1349732701 1170 dbSNP
rs1286177467 1173 dbSNP
rs1416559872 1176 dbSNP
rs1344278739 1177 dbSNP
rs940588439 1179 dbSNP
rs1436106803 1180 dbSNP
rs1395157074 1197 dbSNP
rs560470757 1203 dbSNP
rs1159335324 1207 dbSNP
rs1452438361 1208 dbSNP
rs1399715880 1210 dbSNP
rs540562323 1211 dbSNP
rs1186852451 1213 dbSNP
rs1476511962 1217 dbSNP
rs992649957 1218 dbSNP
rs1181408049 1221 dbSNP
rs1482300347 1226 dbSNP
rs1243881866 1236 dbSNP
rs1216807902 1237 dbSNP
rs1446584039 1242 dbSNP
rs1485406268 1245 dbSNP
rs1266016641 1247 dbSNP
rs1241799453 1251 dbSNP
rs1335451786 1253 dbSNP
rs574470742 1255 dbSNP
rs554308451 1258 dbSNP
rs1226153435 1260 dbSNP
rs1363492402 1262 dbSNP
rs1214714874 1263 dbSNP
rs1429605438 1267 dbSNP
rs1061880 1268 dbSNP
rs544292261 1271 dbSNP
rs1463325551 1272 dbSNP
rs1210824195 1282 dbSNP
rs370953816 1283 dbSNP
rs1164731432 1285 dbSNP
rs1034515365 1286 dbSNP
rs979842441 1287 dbSNP
rs879720769 1305 dbSNP
rs1464671406 1325 dbSNP
rs1246406668 1335 dbSNP
rs1215572679 1342 dbSNP
rs1361681540 1345 dbSNP
rs575250574 1347 dbSNP
rs1219307979 1349 dbSNP
rs1416173502 1352 dbSNP
rs4443835 1354 dbSNP
rs1295677142 1361 dbSNP
rs199846995 1365 dbSNP
rs1432822375 1366 dbSNP
rs1441137463 1370 dbSNP
rs1395704977 1372 dbSNP
rs539662770 1375 dbSNP
rs968802143 1385 dbSNP
rs1356252990 1388 dbSNP
rs1171037900 1397 dbSNP
rs193184099 1400 dbSNP
rs1448912788 1401 dbSNP
rs1417039420 1404 dbSNP
rs1388590895 1408 dbSNP
rs554026543 1419 dbSNP
rs183114556 1423 dbSNP
rs1454835710 1427 dbSNP
rs1476280263 1428 dbSNP
rs1481614157 1443 dbSNP
rs1021267654 1449 dbSNP
rs1203863713 1453 dbSNP
rs763118667 1459 dbSNP
rs1281784087 1462 dbSNP
rs1234590647 1463 dbSNP
rs1330083759 1467 dbSNP
rs1301100554 1468 dbSNP
rs1385446342 1469 dbSNP
rs1009885408 1477 dbSNP
rs1299207736 1481 dbSNP
rs201191342 1482 dbSNP
rs1368812817 1484 dbSNP
rs892079386 1485 dbSNP
rs1377278945 1491 dbSNP
rs1196540936 1494 dbSNP
rs1019868568 1498 dbSNP
rs1250925015 1505 dbSNP
rs1482304073 1506 dbSNP
rs1253655709 1507 dbSNP
rs1482001350 1511 dbSNP
rs1205829978 1517 dbSNP
rs1008437952 1535 dbSNP
rs1210977824 1542 dbSNP
rs1343932005 1543 dbSNP
rs1253858869 1544 dbSNP
rs1231578153 1554 dbSNP
rs1319136795 1555 dbSNP
rs1289320264 1571 dbSNP
rs889921268 1578 dbSNP
rs1314918526 1583 dbSNP
rs61776766 1589 dbSNP
rs1234775464 1600 dbSNP
rs1355655793 1607 dbSNP
rs1050279777 1610 dbSNP
rs534258676 1616 dbSNP
rs1292263991 1621 dbSNP
rs1158063987 1630 dbSNP
rs1393845324 1633 dbSNP
rs931385906 1634 dbSNP
rs1188111867 1635 dbSNP
rs983241665 1636 dbSNP
rs1441300381 1637 dbSNP
rs1253408105 1638 dbSNP
rs1298679888 1640 dbSNP
rs1485955974 1641 dbSNP
rs1461365809 1644 dbSNP
rs1269165805 1647 dbSNP
rs1228158362 1660 dbSNP
rs868359038 1664 dbSNP
rs1327771878 1665 dbSNP
rs1295618654 1666 dbSNP
rs1246116940 1667 dbSNP
rs1339971631 1669 dbSNP
rs1397872127 1674 dbSNP
rs530610094 1677 dbSNP
rs1389654436 1678 dbSNP
rs1319713730 1680 dbSNP
rs1461739814 1681 dbSNP
rs6700227 1683 dbSNP
rs1472396730 1685 dbSNP
rs1366213297 1686 dbSNP
rs1037061223 1688 dbSNP
rs940013770 1689 dbSNP
rs568437208 1696 dbSNP
rs764133948 1699 dbSNP
rs1252676134 1701 dbSNP
rs1178295407 1703 dbSNP
rs1275387065 1705 dbSNP
rs1480565089 1707 dbSNP
rs1356184428 1708 dbSNP
rs1282569951 1713 dbSNP
rs1229689518 1721 dbSNP
rs1236768869 1723 dbSNP
rs907833242 1723 dbSNP
rs992703895 1724 dbSNP
rs1335886720 1728 dbSNP
rs1323898725 1729 dbSNP
rs1404697524 1736 dbSNP
rs1388481769 1741 dbSNP
rs377091481 1747 dbSNP
rs1242160996 1748 dbSNP
rs531790076 1754 dbSNP
rs927118593 1755 dbSNP
rs1455261843 1757 dbSNP
rs1255292455 1761 dbSNP
rs1200024779 1763 dbSNP
rs1451599769 1770 dbSNP
rs1307022210 1771 dbSNP
rs1390777415 1773 dbSNP
rs1342996480 1775 dbSNP
rs372729377 1779 dbSNP
rs1327812214 1781 dbSNP
rs1441440269 1785 dbSNP
rs1373381749 1789 dbSNP
rs1236378749 1802 dbSNP
rs1393451533 1803 dbSNP
rs1329321834 1809 dbSNP
rs1330774480 1813 dbSNP
rs1430275154 1816 dbSNP
rs4313339 1821 dbSNP
rs1166104261 1824 dbSNP
rs552372393 1828 dbSNP
rs532325519 1829 dbSNP
rs560425256 1833 dbSNP
rs540523742 1841 dbSNP
rs1418535698 1842 dbSNP
rs1483632531 1844 dbSNP
rs529991218 1850 dbSNP
rs1195981926 1851 dbSNP
rs1203102135 1853 dbSNP
rs1469189906 1854 dbSNP
rs1279571212 1857 dbSNP
rs1218468646 1858 dbSNP
rs1252752701 1860 dbSNP
rs1281014146 1864 dbSNP
rs1349795439 1865 dbSNP
rs1207753588 1867 dbSNP
rs1486627337 1878 dbSNP
rs1260909056 1879 dbSNP
rs1359425722 1885 dbSNP
rs1237734287 1886 dbSNP
rs1412348802 1887 dbSNP
rs544769199 1892 dbSNP
rs1350791118 1896 dbSNP
rs1473242275 1901 dbSNP
rs1411854053 1905 dbSNP
rs1180167183 1910 dbSNP
rs1484258703 1911 dbSNP
rs1238085091 1917 dbSNP
rs1305542646 1919 dbSNP
rs1234926178 1924 dbSNP
rs1286169083 1925 dbSNP
rs1370052494 1926 dbSNP
rs1021779115 1931 dbSNP
rs1321312413 1935 dbSNP
rs1385349301 1936 dbSNP
rs1283025675 1938 dbSNP
rs1445358055 1939 dbSNP
rs1387453859 1940 dbSNP
rs560896248 1941 dbSNP
rs1419183192 1945 dbSNP
rs143134567 1950 dbSNP
rs1176149475 1956 dbSNP
rs1426024481 1965 dbSNP
rs1181349014 1966 dbSNP
rs188309802 1968 dbSNP
rs1250112836 1969 dbSNP
rs1209169468 1970 dbSNP
rs186465849 1971 dbSNP
rs1265960672 1982 dbSNP
rs1215496423 1983 dbSNP
rs1322180363 1989 dbSNP
rs149075179 1993 dbSNP
rs1226100438 1998 dbSNP
rs1430617623 2000 dbSNP
rs1297836433 2004 dbSNP
rs1433850819 2009 dbSNP
rs370771686 2009 dbSNP
rs1204117668 2013 dbSNP
rs1008451033 2017 dbSNP
rs1281824588 2020 dbSNP
rs1350963094 2021 dbSNP
rs1211569892 2022 dbSNP
rs4307513 2023 dbSNP
rs1403648301 2024 dbSNP
rs1272959563 2027 dbSNP
rs1229366189 2028 dbSNP
rs369071058 2033 dbSNP
rs553988490 2034 dbSNP
rs1192699926 2036 dbSNP
rs116497550 2040 dbSNP
rs1399621539 2043 dbSNP
rs374765976 2044 dbSNP
rs77042062 2047 dbSNP
rs1435379638 2052 dbSNP
rs145135074 2061 dbSNP
rs1339629494 2063 dbSNP
rs190231537 2066 dbSNP
rs1388863368 2069 dbSNP
rs1476597376 2070 dbSNP
rs1373990768 2071 dbSNP
rs1434875336 2076 dbSNP
rs1372498562 2077 dbSNP
rs1169233434 2080 dbSNP
rs1429433411 2081 dbSNP
rs1028467845 2084 dbSNP
rs149957037 2091 dbSNP
rs1476623319 2092 dbSNP
rs1266361834 2098 dbSNP
rs1259052175 2113 dbSNP
rs1483962167 2117 dbSNP
rs1188081628 2128 dbSNP
rs1203793080 2136 dbSNP
rs1339693283 2139 dbSNP
rs186992805 2143 dbSNP
rs1276429242 2146 dbSNP
rs1233465891 2151 dbSNP
rs1313172335 2153 dbSNP
rs1300945738 2155 dbSNP
rs1197410866 2156 dbSNP
rs566670234 2157 dbSNP
rs1308778480 2159 dbSNP
rs377619547 2161 dbSNP
rs1250533630 2165 dbSNP
rs1037072102 2168 dbSNP
rs1218300667 2169 dbSNP
rs1304842967 2175 dbSNP
rs1338759996 2177 dbSNP
rs1295302086 2181 dbSNP
rs1173613887 2182 dbSNP
rs940066033 2188 dbSNP
rs1327572007 2193 dbSNP
rs1387334881 2194 dbSNP
rs546821356 2204 dbSNP
rs1180876561 2205 dbSNP
rs1412591127 2205 dbSNP
rs1056989196 2209 dbSNP
rs1339882177 2212 dbSNP
rs1200686424 2216 dbSNP
rs938575059 2219 dbSNP
rs1412119491 2220 dbSNP
rs1397719472 2224 dbSNP
rs1170372016 2225 dbSNP
rs1228277772 2229 dbSNP
rs182324701 2231 dbSNP
rs369522459 2234 dbSNP
rs1396831084 2243 dbSNP
rs1401751780 2248 dbSNP
rs1300913623 2249 dbSNP
rs1419599472 2255 dbSNP
rs947200965 2256 dbSNP
rs1158360591 2258 dbSNP
rs554533727 2260 dbSNP
rs1369697306 2262 dbSNP
rs1235234435 2266 dbSNP
rs113078172 2269 dbSNP
rs530405358 2274 dbSNP
rs564577693 2276 dbSNP
rs1202219249 2278 dbSNP
rs1466556601 2283 dbSNP
rs190637252 2288 dbSNP
rs187504737 2289 dbSNP
rs560272523 2293 dbSNP
rs1336606224 2294 dbSNP
rs955700243 2304 dbSNP
rs1340137936 2305 dbSNP
rs1313227258 2307 dbSNP
rs1437484234 2309 dbSNP
rs1365675648 2310 dbSNP
rs147663190 2319 dbSNP
rs1398944914 2320 dbSNP
rs1392783571 2326 dbSNP
rs1163388346 2328 dbSNP
rs374046736 2330 dbSNP
rs1366163494 2331 dbSNP
rs1190137970 2333 dbSNP
rs1249041664 2343 dbSNP
rs1449638735 2343 dbSNP
rs1282479485 2354 dbSNP
rs1210916044 2358 dbSNP
rs1445041116 2362 dbSNP
rs1289606781 2371 dbSNP
rs1336900690 2372 dbSNP
rs1343130489 2373 dbSNP
rs1296667789 2374 dbSNP
rs1428362969 2378 dbSNP
rs866303598 2379 dbSNP
rs1332804372 2380 dbSNP
rs1234580170 2382 dbSNP
rs1324164510 2383 dbSNP
rs1386099986 2385 dbSNP
rs1363185281 2390 dbSNP
rs1169867862 2395 dbSNP
rs1430084636 2396 dbSNP
rs1164199800 2397 dbSNP
rs1389155593 2399 dbSNP
rs1168394137 2402 dbSNP
rs1446337504 2402 dbSNP
rs1331204573 2403 dbSNP
rs182001072 2404 dbSNP
rs867555943 2405 dbSNP
rs1383259387 2407 dbSNP
rs1207361484 2413 dbSNP
rs1165276201 2414 dbSNP
rs1274158306 2415 dbSNP
rs1212987722 2421 dbSNP
rs1346892727 2433 dbSNP
rs1404377234 2441 dbSNP
rs1411052634 2445 dbSNP
rs1343561604 2452 dbSNP
rs1159833360 2453 dbSNP
rs912203161 2457 dbSNP
rs1369358383 2458 dbSNP
rs1326469516 2462 dbSNP
rs575047716 2465 dbSNP
rs1415762537 2466 dbSNP
rs111597796 2471 dbSNP
rs1176630370 2474 dbSNP
rs538566148 2485 dbSNP
rs1469705895 2489 dbSNP
rs200953341 2490 dbSNP
rs1028982381 2495 dbSNP
rs140002360 2496 dbSNP
rs995725938 2497 dbSNP
rs1321390663 2498 dbSNP
rs1225559198 2501 dbSNP
rs1290169972 2502 dbSNP
rs1228879581 2507 dbSNP
rs1349349912 2523 dbSNP
rs1277194205 2527 dbSNP
rs963202883 2529 dbSNP
rs1359365332 2531 dbSNP
rs1335327279 2535 dbSNP
rs1469588218 2536 dbSNP
rs1404318936 2544 dbSNP
rs1162032783 2545 dbSNP
rs1407357383 2546 dbSNP
rs1473173614 2546 dbSNP
rs1175554535 2553 dbSNP
rs1015635749 2555 dbSNP
rs1309173471 2563 dbSNP
rs1004223786 2567 dbSNP
rs368634364 2568 dbSNP
rs1326964940 2569 dbSNP
rs1459829512 2573 dbSNP
rs1436162518 2574 dbSNP
rs1328382878 2579 dbSNP
rs1281592775 2581 dbSNP
rs1056411952 2596 dbSNP
rs1229511111 2596 dbSNP
rs1319820594 2598 dbSNP
rs1400791191 2600 dbSNP
rs1349346023 2602 dbSNP
rs1002600113 2605 dbSNP
rs1458291648 2613 dbSNP
rs1345103622 2615 dbSNP
rs1156842218 2616 dbSNP
rs1455515774 2618 dbSNP
rs1395502287 2621 dbSNP
rs1190438429 2638 dbSNP
rs566982967 2642 dbSNP
rs1476890776 2643 dbSNP
rs1245213395 2649 dbSNP
rs1218130729 2652 dbSNP
rs1442935640 2652 dbSNP
rs1188951229 2654 dbSNP
rs1485529879 2657 dbSNP
rs1488695093 2664 dbSNP
rs1240249266 2677 dbSNP
rs905813927 2681 dbSNP
rs1044702104 2682 dbSNP
rs375882709 2685 dbSNP
rs1343853030 2688 dbSNP
rs192056551 2691 dbSNP
rs536081676 2694 dbSNP
rs947243043 2697 dbSNP
rs112067060 2698 dbSNP
rs1365852079 2705 dbSNP
rs1208501806 2706 dbSNP
rs1302621769 2708 dbSNP
rs1271641886 2709 dbSNP
rs1392229377 2712 dbSNP
rs1169026122 2718 dbSNP
rs1430997969 2724 dbSNP
rs1339338444 2727 dbSNP
rs377316985 2728 dbSNP
rs878914618 2728 dbSNP
rs1295778974 2737 dbSNP
rs1435998608 2739 dbSNP
rs1376017831 2740 dbSNP
rs7416520 2744 dbSNP
rs1052869238 2753 dbSNP
rs185863724 2754 dbSNP
rs912297288 2756 dbSNP
rs1483860608 2757 dbSNP
rs1274875468 2765 dbSNP
rs1226191260 2774 dbSNP
rs1188563976 2776 dbSNP
rs1307296871 2780 dbSNP
rs1293795204 2781 dbSNP
rs530879060 2784 dbSNP
rs953837587 2785 dbSNP
rs1372439120 2786 dbSNP
rs564491251 2787 dbSNP
rs1461621642 2794 dbSNP
rs1352553579 2795 dbSNP
rs974693141 2796 dbSNP
rs1433760517 2800 dbSNP
rs1428490337 2803 dbSNP
rs962921867 2815 dbSNP
rs550969664 2819 dbSNP
rs1486663558 2820 dbSNP
rs181381268 2821 dbSNP
rs1251834758 2822 dbSNP
rs1194876775 2829 dbSNP
rs1250036265 2830 dbSNP
rs188593527 2832 dbSNP
rs960804679 2834 dbSNP
rs539141119 2838 dbSNP
rs1222165854 2843 dbSNP
rs1218905043 2846 dbSNP
rs1352426488 2847 dbSNP
rs559044163 2848 dbSNP
rs1391110609 2849 dbSNP
rs141732428 2849 dbSNP
rs1304423832 2852 dbSNP
rs1466333699 2860 dbSNP
rs1405034458 2868 dbSNP
rs1174215468 2869 dbSNP
rs1458685700 2871 dbSNP
rs1412149265 2872 dbSNP
rs74047817 2875 dbSNP
rs1278507509 2880 dbSNP
rs1416988267 2881 dbSNP
rs771858066 2886 dbSNP
rs1257790644 2888 dbSNP
rs1379175263 2895 dbSNP
rs1302259730 2897 dbSNP
rs905152897 2903 dbSNP
rs397780437 2906 dbSNP
rs1262843969 2916 dbSNP
rs1044326678 2926 dbSNP
rs1061892 2927 dbSNP
rs1334243945 2935 dbSNP
rs1011880445 2943 dbSNP
rs892994150 2952 dbSNP
rs561571857 2959 dbSNP
rs1381773158 2960 dbSNP
rs1052964756 2962 dbSNP
rs1437261321 2964 dbSNP
rs1464869727 2967 dbSNP
rs1157521790 2968 dbSNP
rs1389260763 2968 dbSNP
rs1423200990 2972 dbSNP
rs17162801 2973 dbSNP
rs1165052024 2977 dbSNP
rs1443564834 2982 dbSNP
rs17162798 2983 dbSNP
rs1256942908 2991 dbSNP
rs934468502 2993 dbSNP
rs1263006086 3002 dbSNP
rs1138961 3005 dbSNP
rs746047233 3008 dbSNP
rs539053744 3011 dbSNP
rs774014051 3013 dbSNP
rs1235064315 3020 dbSNP
rs1138964 3021 dbSNP
rs1247075656 3021 dbSNP
rs1330884207 3026 dbSNP
rs1138965 3032 dbSNP
rs1326762312 3033 dbSNP
rs1317615219 3039 dbSNP
rs112198495 3041 dbSNP
rs1392263745 3042 dbSNP
rs5772057 3042 dbSNP
rs1183086162 3044 dbSNP
rs1382986710 3049 dbSNP
rs1423673413 3049 dbSNP
rs573349696 3055 dbSNP
rs1051286852 3057 dbSNP
rs371528017 3061 dbSNP
rs562524486 3061 dbSNP
rs932339995 3066 dbSNP
rs1193118376 3076 dbSNP
rs553483637 3077 dbSNP
rs369307212 3085 dbSNP
rs536789626 3086 dbSNP
rs1375478133 3088 dbSNP
rs1223289042 3096 dbSNP
rs1490259011 3097 dbSNP
rs1289900278 3103 dbSNP
rs1230818425 3106 dbSNP
rs1331891855 3112 dbSNP
rs1339843726 3113 dbSNP
rs1445783333 3114 dbSNP
rs1332749664 3119 dbSNP
rs1283427894 3120 dbSNP
rs1397846902 3124 dbSNP
rs1363122105 3126 dbSNP
rs1309498734 3136 dbSNP
rs1329631108 3146 dbSNP
rs1410127375 3152 dbSNP
rs1459621807 3153 dbSNP
rs1369169723 3155 dbSNP
rs1474740665 3162 dbSNP
rs1379846795 3175 dbSNP
rs1200731115 3176 dbSNP
rs1480160999 3183 dbSNP
rs920896002 3187 dbSNP
rs1207561735 3189 dbSNP
rs567609429 3190 dbSNP
rs548986616 3196 dbSNP
rs1193838894 3197 dbSNP
rs1347092837 3199 dbSNP
rs1061902 3200 dbSNP
rs1222772408 3201 dbSNP
rs1343112927 3204 dbSNP
rs1179737788 3209 dbSNP
rs1289610519 3210 dbSNP
rs974369211 3218 dbSNP
rs1328649994 3221 dbSNP
rs1236716319 3224 dbSNP
rs1408604089 3225 dbSNP
rs1408690646 3227 dbSNP
rs1215226109 3229 dbSNP
rs941629295 3233 dbSNP
rs1427366504 3238 dbSNP
rs1179014534 3240 dbSNP
rs908784424 3248 dbSNP
rs567343832 3263 dbSNP
rs550753548 3264 dbSNP
rs1264449659 3265 dbSNP
rs529025585 3269 dbSNP
rs1443951687 3271 dbSNP
rs1263466519 3272 dbSNP
rs111764075 3278 dbSNP
rs1202966498 3283 dbSNP
rs1321331870 3284 dbSNP
rs377386046 3286 dbSNP
rs960858418 3294 dbSNP
rs1035068385 3307 dbSNP
rs1449687704 3310 dbSNP
rs371881484 3321 dbSNP
rs1239325356 3322 dbSNP
rs981228749 3327 dbSNP
rs1404514337 3328 dbSNP
rs1161429596 3330 dbSNP
rs969429880 3333 dbSNP
rs1407291349 3341 dbSNP
rs1387096177 3342 dbSNP
rs1391754728 3344 dbSNP
rs368447223 3345 dbSNP
rs1360963616 3346 dbSNP
rs1010889381 3347 dbSNP
rs530552106 3348 dbSNP
rs1159845277 3350 dbSNP
rs1243806467 3355 dbSNP
rs1439595566 3356 dbSNP
rs1445925766 3357 dbSNP
rs1281438492 3360 dbSNP
rs1229739129 3366 dbSNP
rs1378893167 3368 dbSNP
rs1195925797 3373 dbSNP
rs893088215 3375 dbSNP
rs571222486 3385 dbSNP
rs10968 3386 dbSNP
rs998729759 3393 dbSNP
rs1383055849 3395 dbSNP
rs1207697928 3397 dbSNP
rs1163126799 3410 dbSNP
rs1486597684 3411 dbSNP
rs1286088396 3415 dbSNP
rs1421314083 3423 dbSNP
rs569657454 3424 dbSNP
rs1351459488 3430 dbSNP
rs528054094 3431 dbSNP
rs1233724433 3432 dbSNP
rs1490423851 3435 dbSNP
rs1290623705 3436 dbSNP
rs1219741264 3440 dbSNP
rs1330228885 3445 dbSNP
rs1298099339 3450 dbSNP
rs1215740116 3454 dbSNP
rs1300928598 3493 dbSNP
rs1385295024 3502 dbSNP
rs1268529780 3508 dbSNP
rs932368942 3511 dbSNP
rs899560464 3520 dbSNP
rs1302793159 3522 dbSNP
rs1422899066 3527 dbSNP
rs1419123284 3532 dbSNP
rs1359207216 3535 dbSNP
rs1427897100 3536 dbSNP
rs1417262981 3539 dbSNP
rs558956810 3540 dbSNP
rs1480491472 3542 dbSNP
rs1267485810 3546 dbSNP
rs548796082 3547 dbSNP
rs1466938360 3549 dbSNP
rs529032723 3550 dbSNP
rs1377414426 3551 dbSNP
rs1196370011 3556 dbSNP
rs1173318201 3559 dbSNP
rs1225824669 3560 dbSNP
rs1282720830 3562 dbSNP
rs561277861 3568 dbSNP
rs1263406982 3571 dbSNP
rs1403397689 3571 dbSNP
rs1298573783 3574 dbSNP
rs1478397543 3575 dbSNP
rs1352497317 3580 dbSNP
rs1178517292 3585 dbSNP
rs1470194139 3596 dbSNP
rs1428075416 3600 dbSNP
rs1192328925 3601 dbSNP
rs941020368 3609 dbSNP
rs1176216846 3614 dbSNP
rs1282390883 3617 dbSNP
rs908838400 3618 dbSNP
rs1200958290 3619 dbSNP
rs982956580 3621 dbSNP
rs1324873748 3624 dbSNP
rs1262641227 3630 dbSNP
rs1231118730 3634 dbSNP
rs1344107098 3637 dbSNP
rs1308006464 3638 dbSNP
rs1390982650 3642 dbSNP
rs1254002388 3650 dbSNP
rs1370915386 3652 dbSNP
rs544800901 3653 dbSNP
rs1320307732 3655 dbSNP
rs928092834 3656 dbSNP
rs1454911856 3660 dbSNP
rs980898316 3662 dbSNP
rs113367697 3664 dbSNP
rs531199562 3668 dbSNP
rs1336787022 3669 dbSNP
rs1378915972 3669 dbSNP
rs1243103265 3671 dbSNP
rs1199197817 3676 dbSNP
rs1486898641 3677 dbSNP
rs1261318015 3695 dbSNP
rs1238688616 3701 dbSNP
rs969902455 3704 dbSNP
rs1316963680 3708 dbSNP
rs1246402877 3719 dbSNP
rs1022365605 3725 dbSNP
rs1381723970 3725 dbSNP
rs1383780788 3729 dbSNP
rs1397103798 3731 dbSNP
rs1401997360 3734 dbSNP
rs1171223922 3735 dbSNP
rs1367016479 3736 dbSNP
rs1467466027 3737 dbSNP
rs1423915572 3745 dbSNP
rs1169434449 3754 dbSNP
rs1186056422 3755 dbSNP
rs1476592086 3768 dbSNP
rs1262594252 3769 dbSNP
rs989922058 3773 dbSNP
rs1238686467 3776 dbSNP
rs1204612774 3778 dbSNP
rs1487455645 3779 dbSNP
rs1188222161 3780 dbSNP
rs1223427621 3787 dbSNP
rs1441738254 3788 dbSNP
rs1253943842 3789 dbSNP
rs1229592514 3794 dbSNP
rs1326929975 3794 dbSNP
rs1200327225 3796 dbSNP
rs1397625609 3798 dbSNP
rs1423536699 3801 dbSNP
rs1457998483 3801 dbSNP
rs1390550253 3802 dbSNP
rs565602013 3803 dbSNP
rs956691465 3804 dbSNP
rs1374113422 3810 dbSNP
rs1316198852 3812 dbSNP
rs1286002913 3814 dbSNP
rs1245568357 3818 dbSNP
rs1271057205 3821 dbSNP
rs1340422711 3828 dbSNP
rs1490242717 3829 dbSNP
rs1287525124 3834 dbSNP
rs1197300618 3842 dbSNP
rs1332706204 3850 dbSNP
rs1031597618 3857 dbSNP
rs1250712493 3858 dbSNP
rs1216661986 3869 dbSNP
rs1346856996 3878 dbSNP
rs1283361828 3883 dbSNP
rs1328979659 3892 dbSNP
rs1404015426 3892 dbSNP
rs1393534433 3893 dbSNP
rs1397602347 3897 dbSNP
rs1170595965 3898 dbSNP
rs998739541 3910 dbSNP
rs1401478815 3911 dbSNP
rs1245233817 3918 dbSNP
rs890979481 3920 dbSNP
rs1029931894 3921 dbSNP
rs1249477529 3929 dbSNP
rs1196744972 3941 dbSNP
rs1263276097 3945 dbSNP
rs1342214732 3946 dbSNP
rs1330329016 3947 dbSNP
rs1463711872 3951 dbSNP
rs1415381893 3959 dbSNP
rs1336789809 3969 dbSNP
rs1331079794 3970 dbSNP
rs1445275680 3971 dbSNP
rs1408900526 3978 dbSNP
rs545746322 3987 dbSNP
rs1413997263 3991 dbSNP
rs1423080031 3992 dbSNP
rs1160519082 3993 dbSNP
rs1487142656 4000 dbSNP
rs1379519811 4001 dbSNP
rs1176522448 4005 dbSNP
rs1462631198 4008 dbSNP
rs1472147410 4009 dbSNP
rs1202908959 4011 dbSNP
rs899611972 4016 dbSNP
rs1366657832 4039 dbSNP
rs1285738055 4041 dbSNP
rs1224048071 4055 dbSNP
rs879035151 4057 dbSNP
rs1309036279 4061 dbSNP
rs1238468266 4068 dbSNP
rs1458095229 4070 dbSNP
rs1237320176 4071 dbSNP
rs1198302033 4078 dbSNP
rs1436325803 4080 dbSNP
rs1357569073 4084 dbSNP
rs1320356882 4087 dbSNP
rs1401554165 4110 dbSNP
rs1360099937 4113 dbSNP
rs1157043456 4115 dbSNP
rs1292233560 4120 dbSNP
rs1385572771 4122 dbSNP
rs751506242 4123 dbSNP
rs1181215647 4128 dbSNP
rs1038118164 4135 dbSNP
rs1243392915 4137 dbSNP
rs1005177027 4138 dbSNP
rs886741394 4142 dbSNP
rs1283466815 4148 dbSNP
rs1210525754 4153 dbSNP
rs1047314264 4155 dbSNP
rs1355651353 4164 dbSNP
rs1316165758 4169 dbSNP
rs1228312941 4170 dbSNP
rs1377592659 4178 dbSNP
rs1272040259 4180 dbSNP
rs551157223 4183 dbSNP
rs939582702 4184 dbSNP
rs928220658 4189 dbSNP
rs1296599827 4191 dbSNP
rs1426716964 4191 dbSNP
rs1200621788 4192 dbSNP
rs1163777334 4193 dbSNP
rs1403570062 4199 dbSNP
rs573261160 4202 dbSNP
rs1477217596 4206 dbSNP
rs1308948933 4207 dbSNP
rs948239102 4209 dbSNP
rs915352474 4210 dbSNP
rs1490408158 4213 dbSNP
rs553376312 4216 dbSNP
rs1062088 4220 dbSNP
rs1275753376 4221 dbSNP
rs1320250994 4221 dbSNP
rs1215614830 4224 dbSNP
rs1323738431 4228 dbSNP
rs1317381961 4230 dbSNP
rs15438 4232 dbSNP
rs533057236 4233 dbSNP
rs542706158 4237 dbSNP
rs956701356 4238 dbSNP
rs1160438470 4242 dbSNP
rs1293115043 4246 dbSNP
rs565290060 4247 dbSNP
rs1379575015 4249 dbSNP
rs1176573658 4253 dbSNP
rs1420914745 4256 dbSNP
rs1177939703 4263 dbSNP
rs987448930 4269 dbSNP
rs574086989 4272 dbSNP
rs1029570044 4282 dbSNP
rs1234896782 4288 dbSNP
rs1457690608 4292 dbSNP
rs997121478 4292 dbSNP
rs1256277290 4293 dbSNP
rs1225461870 4294 dbSNP
rs540861992 4295 dbSNP
rs1451168833 4300 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             :::|||||   :|||||| 
Target 5' aucGUGCCAUU---GCACUCCa 3'
4 - 22
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000378662.1 | 3UTR | AAGAUCGUGCCAUUGCACUCCAGCCUGGGCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.774 7.3e-6 0.772 8.0e-6 23 Click to see details
GSE28544 Breast cancer 0.736 2.1e-5 0.653 2.7e-4 24 Click to see details
GSE28260 Renal cortex and medulla 0.762 1.2e-3 0.681 5.2e-3 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.243 1.2e-1 0.268 9.8e-2 25 Click to see details
GSE32688 Pancreatic cancer 0.191 1.5e-1 0.075 3.4e-1 32 Click to see details
GSE19350 CNS germ cell tumors 0.263 2.0e-1 0.521 4.1e-2 12 Click to see details
GSE17306 Multiple myeloma -0.058 3.5e-1 0.014 4.6e-1 49 Click to see details
GSE21687 Ependynoma primary tumors 0.046 3.6e-1 0.065 3.0e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.147 3.9e-1 0.029 4.8e-1 6 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL 0.859 0 0.833 0 9 Click to see details
KIRP 0.723 0.01 0.500 0.09 9 Click to see details
THCA -0.901 0.02 -1.000 0.5 5 Click to see details
LIHC -0.298 0.02 -0.208 0.08 49 Click to see details
KIRC -0.351 0.03 -0.266 0.08 29 Click to see details
KICH -0.414 0.15 -0.405 0.16 8 Click to see details
HNSC 0.716 0.25 0.500 0.33 3 Click to see details
STAD 0.113 0.39 0.333 0.21 8 Click to see details
ESCA -0.075 0.45 -0.300 0.31 5 Click to see details
ESCA -0.075 0.45 -0.300 0.31 5 Click to see details
ESCA -0.075 0.45 -0.300 0.31 5 Click to see details
ESCA -0.075 0.45 -0.300 0.31 5 Click to see details
ESCA -0.075 0.45 -0.300 0.31 5 Click to see details
ESCA -0.075 0.45 -0.300 0.31 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1