miRTarBase - #MIRT643123 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FAM71F2   
Synonyms FAM137B
Description family with sequence similarity 71 member F2
Transcript NM_001012454   
Other Transcripts NM_001128926   
Putative miRNA Targets on FAM71F2
3'UTR of FAM71F2
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            ::|:|||    |:|||||| 
Target 5' atGGCGCCA---CCGCACTCCa 3'
3006 - 3024 137.00 -20.60
            | ||||  || | |::|||| 
42 - 64 128.00 -10.22
            :|| :||  || | ||| |||| 
1968 - 1992 126.00 -9.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31560629 5 COSMIC
COSN20075957 33 COSMIC
COSN30511342 42 COSMIC
COSN31611491 123 COSMIC
COSN7653496 157 COSMIC
COSN25260217 826 COSMIC
COSN22512750 863 COSMIC
COSN20822938 1415 COSMIC
COSN22558270 1526 COSMIC
COSN19288350 1581 COSMIC
COSN20775116 1982 COSMIC
COSN7959529 1988 COSMIC
COSN27783930 2261 COSMIC
COSN6350743 2406 COSMIC
COSN20231074 3018 COSMIC
COSN24769252 3085 COSMIC
COSN9922720 3580 COSMIC
COSN16711022 4021 COSMIC
COSN14968964 4090 COSMIC
COSN15976663 4217 COSMIC
COSN8405125 4377 COSMIC
COSN5647621 4680 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs35518719 3 dbSNP
rs942967488 3 dbSNP
rs377602028 4 dbSNP
rs755996220 5 dbSNP
rs1156636606 10 dbSNP
rs779996070 12 dbSNP
rs1038602586 15 dbSNP
rs879346348 19 dbSNP
rs749046989 27 dbSNP
rs1200749468 29 dbSNP
rs768350887 32 dbSNP
rs370469503 33 dbSNP
rs748385699 34 dbSNP
rs772165297 35 dbSNP
rs1391221395 36 dbSNP
rs1305352429 38 dbSNP
rs773477917 39 dbSNP
rs896537344 41 dbSNP
rs1206562874 44 dbSNP
rs764564111 50 dbSNP
rs1309745219 52 dbSNP
rs1292908890 53 dbSNP
rs200518613 64 dbSNP
rs762176914 64 dbSNP
rs1367627401 72 dbSNP
rs1284812762 73 dbSNP
rs1045285529 74 dbSNP
rs1364761620 82 dbSNP
rs1308390307 89 dbSNP
rs1431597297 93 dbSNP
rs1352674136 94 dbSNP
rs550202035 96 dbSNP
rs926899165 104 dbSNP
rs936826666 106 dbSNP
rs1425906093 120 dbSNP
rs1201888758 125 dbSNP
rs1054336706 127 dbSNP
rs892654986 134 dbSNP
rs1353854670 141 dbSNP
rs1440006809 146 dbSNP
rs1183343194 149 dbSNP
rs1481941451 153 dbSNP
rs1250144262 170 dbSNP
rs79640132 173 dbSNP
rs1010028565 182 dbSNP
rs1264412919 184 dbSNP
rs1221361599 208 dbSNP
rs1041143285 209 dbSNP
rs1045128881 212 dbSNP
rs768372827 224 dbSNP
rs1392930041 229 dbSNP
rs1370821697 234 dbSNP
rs1297567815 240 dbSNP
rs778366919 241 dbSNP
rs996890130 242 dbSNP
rs1406986827 243 dbSNP
rs1178638452 257 dbSNP
rs1468494154 262 dbSNP
rs538648499 265 dbSNP
rs892297477 278 dbSNP
rs551702698 286 dbSNP
rs1009323253 291 dbSNP
rs1240688923 294 dbSNP
rs1314928529 294 dbSNP
rs1384903790 294 dbSNP
rs1396578443 294 dbSNP
rs148140930 294 dbSNP
rs531685008 296 dbSNP
rs1338847503 298 dbSNP
rs1016471348 299 dbSNP
rs1203047638 302 dbSNP
rs1289701696 302 dbSNP
rs187966312 306 dbSNP
rs1248462118 307 dbSNP
rs747727972 316 dbSNP
rs1158802346 320 dbSNP
rs77923066 329 dbSNP
rs961910917 337 dbSNP
rs985828119 347 dbSNP
rs1451639029 348 dbSNP
rs1168269553 351 dbSNP
rs1418545709 356 dbSNP
rs1017714797 363 dbSNP
rs1325485525 368 dbSNP
rs963046008 372 dbSNP
rs771437180 375 dbSNP
rs112032361 376 dbSNP
rs145774603 386 dbSNP
rs1245226409 387 dbSNP
rs573402655 388 dbSNP
rs1366908964 389 dbSNP
rs982981932 392 dbSNP
rs1312843059 417 dbSNP
rs1245105960 424 dbSNP
rs918087924 426 dbSNP
rs537504824 446 dbSNP
rs1384180049 455 dbSNP
rs1045144769 459 dbSNP
rs1054046616 460 dbSNP
rs905211522 463 dbSNP
rs1367800729 469 dbSNP
rs936647626 470 dbSNP
rs1292667290 472 dbSNP
rs555829812 473 dbSNP
rs1336172510 482 dbSNP
rs892419027 488 dbSNP
rs577611086 491 dbSNP
rs945600028 494 dbSNP
rs1194691272 495 dbSNP
rs1009439381 496 dbSNP
rs901282467 499 dbSNP
rs1209995637 502 dbSNP
rs1490788933 505 dbSNP
rs1289263905 511 dbSNP
rs1466376738 512 dbSNP
rs1221722565 528 dbSNP
rs1030147442 530 dbSNP
rs996837968 540 dbSNP
rs1270920206 544 dbSNP
rs1049734054 545 dbSNP
rs189696198 546 dbSNP
rs548402611 549 dbSNP
rs1324705207 550 dbSNP
rs890271349 560 dbSNP
rs888451105 562 dbSNP
rs1194175090 563 dbSNP
rs1006516245 564 dbSNP
rs1007273970 573 dbSNP
rs1424658712 575 dbSNP
rs1474318925 578 dbSNP
rs1397819968 585 dbSNP
rs1016215560 588 dbSNP
rs1017329249 589 dbSNP
rs771424532 590 dbSNP
rs544655896 592 dbSNP
rs560873568 599 dbSNP
rs1481201106 611 dbSNP
rs973058350 612 dbSNP
rs1024665257 614 dbSNP
rs1438385753 618 dbSNP
rs1460914111 619 dbSNP
rs182591907 627 dbSNP
rs1193960067 628 dbSNP
rs1337554917 629 dbSNP
rs1026391535 632 dbSNP
rs951647543 633 dbSNP
rs1325921358 640 dbSNP
rs1281839303 641 dbSNP
rs1404732224 648 dbSNP
rs777039180 649 dbSNP
rs990132962 652 dbSNP
rs1390122256 660 dbSNP
rs1395206845 666 dbSNP
rs914200388 681 dbSNP
rs983013188 683 dbSNP
rs918103868 687 dbSNP
rs1175196793 693 dbSNP
rs1470394703 706 dbSNP
rs976948378 716 dbSNP
rs1437127995 720 dbSNP
rs1317237046 729 dbSNP
rs922779607 736 dbSNP
rs949508938 737 dbSNP
rs1049848092 742 dbSNP
rs1341281260 744 dbSNP
rs1281614999 745 dbSNP
rs572616370 746 dbSNP
rs759753068 747 dbSNP
rs1336887588 755 dbSNP
rs1454134814 760 dbSNP
rs114204218 780 dbSNP
rs752812246 785 dbSNP
rs1038002788 789 dbSNP
rs897769333 790 dbSNP
rs561421278 791 dbSNP
rs1469615259 807 dbSNP
rs913875892 808 dbSNP
rs1283804004 809 dbSNP
rs531851894 810 dbSNP
rs188058282 830 dbSNP
rs1189351544 840 dbSNP
rs1447769713 842 dbSNP
rs1286865311 846 dbSNP
rs879886674 855 dbSNP
rs1001878125 858 dbSNP
rs1316362047 859 dbSNP
rs192682346 863 dbSNP
rs957941121 868 dbSNP
rs1313690420 870 dbSNP
rs1185712593 874 dbSNP
rs1051600766 878 dbSNP
rs138727180 881 dbSNP
rs1399898888 885 dbSNP
rs147870270 887 dbSNP
rs966959042 893 dbSNP
rs1157533914 917 dbSNP
rs977004257 919 dbSNP
rs1442675987 920 dbSNP
rs1383512212 923 dbSNP
rs1181350817 924 dbSNP
rs1382284940 927 dbSNP
rs776778497 928 dbSNP
rs1244074657 929 dbSNP
rs185023137 940 dbSNP
rs751681977 946 dbSNP
rs1356511733 957 dbSNP
rs985538974 982 dbSNP
rs898946872 1003 dbSNP
rs1214658754 1005 dbSNP
rs1292007529 1008 dbSNP
rs994991318 1013 dbSNP
rs909990125 1016 dbSNP
rs1026003420 1030 dbSNP
rs1429533367 1039 dbSNP
rs941343152 1041 dbSNP
rs950349658 1053 dbSNP
rs1037004062 1059 dbSNP
rs1422742725 1062 dbSNP
rs1004487286 1064 dbSNP
rs1279110189 1069 dbSNP
rs1170994407 1081 dbSNP
rs897163898 1092 dbSNP
rs756174741 1097 dbSNP
rs929188625 1112 dbSNP
rs1213307224 1135 dbSNP
rs1270128698 1138 dbSNP
rs1280689313 1142 dbSNP
rs1202020321 1144 dbSNP
rs1489944458 1150 dbSNP
rs1046308390 1151 dbSNP
rs1205786342 1153 dbSNP
rs970894827 1157 dbSNP
rs980999467 1181 dbSNP
rs1217684144 1183 dbSNP
rs926784096 1184 dbSNP
rs958174306 1185 dbSNP
rs532569613 1186 dbSNP
rs1366563032 1196 dbSNP
rs780086793 1206 dbSNP
rs1444240170 1222 dbSNP
rs1356391008 1226 dbSNP
rs1002033660 1230 dbSNP
rs945353359 1231 dbSNP
rs1430258107 1239 dbSNP
rs1178768684 1241 dbSNP
rs866637275 1255 dbSNP
rs753693620 1256 dbSNP
rs893585892 1260 dbSNP
rs943280857 1288 dbSNP
rs547461252 1297 dbSNP
rs1197446566 1300 dbSNP
rs1461331576 1303 dbSNP
rs898974467 1308 dbSNP
rs1173913644 1313 dbSNP
rs1221265834 1319 dbSNP
rs1311418684 1320 dbSNP
rs547989668 1330 dbSNP
rs754692033 1332 dbSNP
rs998430384 1339 dbSNP
rs886109226 1342 dbSNP
rs1434469270 1347 dbSNP
rs1406867902 1355 dbSNP
rs566778062 1364 dbSNP
rs1399257448 1366 dbSNP
rs1392535521 1368 dbSNP
rs1377462283 1373 dbSNP
rs778653430 1375 dbSNP
rs954174938 1389 dbSNP
rs1421457999 1395 dbSNP
rs1023970731 1400 dbSNP
rs1334057012 1401 dbSNP
rs971009283 1402 dbSNP
rs1002852578 1403 dbSNP
rs1444754140 1408 dbSNP
rs985653580 1416 dbSNP
rs1201445845 1419 dbSNP
rs1304470617 1423 dbSNP
rs1347491950 1426 dbSNP
rs1231761200 1436 dbSNP
rs1252922053 1439 dbSNP
rs1480885844 1442 dbSNP
rs1195164795 1444 dbSNP
rs1247756660 1447 dbSNP
rs910053099 1448 dbSNP
rs1452857049 1449 dbSNP
rs1193776373 1452 dbSNP
rs1246559606 1452 dbSNP
rs1383683194 1454 dbSNP
rs1289609537 1455 dbSNP
rs1317211623 1455 dbSNP
rs1401754242 1455 dbSNP
rs1491520851 1455 dbSNP
rs1181195439 1456 dbSNP
rs1223186415 1456 dbSNP
rs1261994910 1456 dbSNP
rs1285015637 1456 dbSNP
rs1294116944 1456 dbSNP
rs1339881572 1456 dbSNP
rs1361497714 1456 dbSNP
rs1455680483 1456 dbSNP
rs1484782614 1456 dbSNP
rs1484854541 1456 dbSNP
rs1491461295 1456 dbSNP
rs1491543989 1456 dbSNP
rs531686457 1456 dbSNP
rs768103351 1456 dbSNP
rs1491417138 1457 dbSNP
rs1452261559 1458 dbSNP
rs1384090918 1459 dbSNP
rs1172152205 1460 dbSNP
rs1375152035 1463 dbSNP
rs1297943187 1475 dbSNP
rs1462882839 1476 dbSNP
rs1298132589 1477 dbSNP
rs1425907386 1478 dbSNP
rs1394359403 1479 dbSNP
rs377761053 1479 dbSNP
rs1233875074 1480 dbSNP
rs1003793540 1483 dbSNP
rs1033883324 1494 dbSNP
rs17169609 1495 dbSNP
rs1439055170 1501 dbSNP
rs989595333 1510 dbSNP
rs1297372052 1511 dbSNP
rs1172147723 1519 dbSNP
rs973229372 1521 dbSNP
rs1262290271 1526 dbSNP
rs1307893172 1527 dbSNP
rs1226542513 1537 dbSNP
rs1209126825 1541 dbSNP
rs913947253 1541 dbSNP
rs1355761005 1566 dbSNP
rs11983903 1567 dbSNP
rs1185112643 1568 dbSNP
rs1316295636 1572 dbSNP
rs1277735063 1574 dbSNP
rs950090998 1582 dbSNP
rs1347725788 1584 dbSNP
rs1336912987 1597 dbSNP
rs1213772021 1600 dbSNP
rs567161041 1614 dbSNP
rs911889192 1627 dbSNP
rs1463787356 1629 dbSNP
rs1422489595 1636 dbSNP
rs1046296933 1645 dbSNP
rs1176622629 1666 dbSNP
rs1481314036 1674 dbSNP
rs549674283 1675 dbSNP
rs1375674090 1678 dbSNP
rs1198140511 1680 dbSNP
rs943323631 1682 dbSNP
rs6947542 1687 dbSNP
rs370336810 1692 dbSNP
rs1054938587 1706 dbSNP
rs1456445123 1719 dbSNP
rs1257697341 1725 dbSNP
rs1224301800 1731 dbSNP
rs1326157668 1736 dbSNP
rs556251507 1745 dbSNP
rs1233243213 1747 dbSNP
rs113666625 1748 dbSNP
rs1423984811 1748 dbSNP
rs149408498 1748 dbSNP
rs1010621044 1750 dbSNP
rs571237325 1757 dbSNP
rs1337009900 1758 dbSNP
rs77587167 1761 dbSNP
rs920453236 1762 dbSNP
rs1171781369 1763 dbSNP
rs902177543 1763 dbSNP
rs1170247210 1764 dbSNP
rs1371813553 1765 dbSNP
rs550424890 1766 dbSNP
rs1176654762 1767 dbSNP
rs1237614937 1768 dbSNP
rs997873514 1769 dbSNP
rs1165733139 1772 dbSNP
rs1393838033 1774 dbSNP
rs1016847770 1775 dbSNP
rs1444338763 1781 dbSNP
rs930434036 1788 dbSNP
rs538643609 1790 dbSNP
rs1200252935 1792 dbSNP
rs149631638 1793 dbSNP
rs1281801510 1794 dbSNP
rs886225198 1796 dbSNP
rs1238557765 1800 dbSNP
rs949780382 1801 dbSNP
rs1315107878 1802 dbSNP
rs1293262945 1805 dbSNP
rs560899573 1819 dbSNP
rs1333031077 1827 dbSNP
rs62483361 1829 dbSNP
rs1386823594 1832 dbSNP
rs1156822579 1834 dbSNP
rs1002475048 1836 dbSNP
rs1034322019 1846 dbSNP
rs1332065357 1847 dbSNP
rs1217429583 1858 dbSNP
rs893975347 1867 dbSNP
rs555293934 1874 dbSNP
rs918707407 1877 dbSNP
rs1447967443 1878 dbSNP
rs1215144413 1884 dbSNP
rs971354373 1889 dbSNP
rs1291952706 1892 dbSNP
rs1229538867 1897 dbSNP
rs1376288952 1902 dbSNP
rs555215341 1903 dbSNP
rs187295940 1904 dbSNP
rs565413496 1915 dbSNP
rs192185735 1920 dbSNP
rs1476439650 1929 dbSNP
rs541439745 1930 dbSNP
rs1399402588 1932 dbSNP
rs965041429 1935 dbSNP
rs184573736 1949 dbSNP
rs1407176967 1965 dbSNP
rs915070624 1967 dbSNP
rs770102792 1968 dbSNP
rs1162927752 1979 dbSNP
rs530024503 1983 dbSNP
rs920473484 1987 dbSNP
rs1265866047 1991 dbSNP
rs930570285 1994 dbSNP
rs983325013 1995 dbSNP
rs907693195 1998 dbSNP
rs374867885 2002 dbSNP
rs548911412 2006 dbSNP
rs1453393422 2019 dbSNP
rs1286847080 2020 dbSNP
rs571784342 2022 dbSNP
rs534363048 2027 dbSNP
rs775889381 2027 dbSNP
rs1292619468 2034 dbSNP
rs1345856950 2043 dbSNP
rs1304911600 2047 dbSNP
rs1434168520 2049 dbSNP
rs531436242 2050 dbSNP
rs1322954741 2051 dbSNP
rs763148926 2059 dbSNP
rs1426049309 2067 dbSNP
rs905549244 2077 dbSNP
rs1307169430 2085 dbSNP
rs1430387741 2096 dbSNP
rs1315951042 2106 dbSNP
rs865789573 2107 dbSNP
rs936961480 2112 dbSNP
rs549674140 2113 dbSNP
rs117061656 2114 dbSNP
rs1197574952 2116 dbSNP
rs1324052314 2123 dbSNP
rs1303106264 2131 dbSNP
rs73236051 2143 dbSNP
rs1366809760 2144 dbSNP
rs1021101287 2145 dbSNP
rs62483362 2155 dbSNP
rs1402485237 2156 dbSNP
rs1008949163 2162 dbSNP
rs1050724097 2168 dbSNP
rs1407376811 2175 dbSNP
rs1418660904 2175 dbSNP
rs766454541 2185 dbSNP
rs1431737389 2187 dbSNP
rs1425099677 2196 dbSNP
rs1178232053 2203 dbSNP
rs1441035425 2209 dbSNP
rs879815711 2215 dbSNP
rs189357206 2218 dbSNP
rs148705515 2226 dbSNP
rs975183602 2236 dbSNP
rs1257610010 2250 dbSNP
rs1207760459 2251 dbSNP
rs1027653943 2253 dbSNP
rs1373552097 2255 dbSNP
rs180677047 2259 dbSNP
rs1379277862 2262 dbSNP
rs376475580 2272 dbSNP
rs1446413410 2280 dbSNP
rs1380174280 2288 dbSNP
rs983356245 2289 dbSNP
rs907724457 2290 dbSNP
rs1304749916 2291 dbSNP
rs971198138 2292 dbSNP
rs1371985645 2298 dbSNP
rs1358908733 2300 dbSNP
rs981188889 2301 dbSNP
rs1221669526 2305 dbSNP
rs1159825334 2312 dbSNP
rs898663816 2317 dbSNP
rs1305146036 2322 dbSNP
rs1444638832 2323 dbSNP
rs926998599 2336 dbSNP
rs544011742 2339 dbSNP
rs753672501 2348 dbSNP
rs1025672416 2349 dbSNP
rs1242468515 2360 dbSNP
rs1218782612 2370 dbSNP
rs1351418258 2371 dbSNP
rs1285138643 2372 dbSNP
rs1239537606 2375 dbSNP
rs1322353879 2381 dbSNP
rs76526010 2390 dbSNP
rs981511260 2395 dbSNP
rs1441134745 2399 dbSNP
rs1299171351 2407 dbSNP
rs1207256112 2415 dbSNP
rs1359188915 2418 dbSNP
rs754923037 2422 dbSNP
rs764982993 2423 dbSNP
rs1162324143 2424 dbSNP
rs1176902149 2431 dbSNP
rs1397082027 2437 dbSNP
rs1195585685 2441 dbSNP
rs990750042 2455 dbSNP
rs915165736 2456 dbSNP
rs1223084047 2465 dbSNP
rs946998865 2476 dbSNP
rs1267278189 2480 dbSNP
rs1042589960 2481 dbSNP
rs1242958636 2482 dbSNP
rs902708344 2497 dbSNP
rs1171087609 2498 dbSNP
rs1353911206 2511 dbSNP
rs1008986605 2521 dbSNP
rs577274368 2549 dbSNP
rs1220860699 2550 dbSNP
rs923787005 2554 dbSNP
rs1298149353 2555 dbSNP
rs1387822622 2558 dbSNP
rs1327411913 2563 dbSNP
rs900624562 2568 dbSNP
rs1392333833 2572 dbSNP
rs1291287373 2575 dbSNP
rs1371266354 2578 dbSNP
rs763291682 2582 dbSNP
rs1456911263 2586 dbSNP
rs1028100177 2587 dbSNP
rs933685895 2588 dbSNP
rs1172314517 2591 dbSNP
rs1439728985 2592 dbSNP
rs952052980 2593 dbSNP
rs1199552795 2603 dbSNP
rs541204384 2608 dbSNP
rs1269640563 2610 dbSNP
rs1343355390 2613 dbSNP
rs1488163373 2619 dbSNP
rs75228562 2629 dbSNP
rs1316484525 2636 dbSNP
rs1277952977 2657 dbSNP
rs1014813130 2661 dbSNP
rs1234694057 2662 dbSNP
rs971224288 2671 dbSNP
rs574519257 2687 dbSNP
rs1299749117 2691 dbSNP
rs927148220 2693 dbSNP
rs118135504 2696 dbSNP
rs1333000025 2703 dbSNP
rs1307463091 2707 dbSNP
rs147468349 2710 dbSNP
rs989904300 2713 dbSNP
rs531473343 2735 dbSNP
rs994443809 2738 dbSNP
rs914236872 2739 dbSNP
rs112658130 2745 dbSNP
rs758105403 2746 dbSNP
rs1238830891 2750 dbSNP
rs1180797027 2751 dbSNP
rs1244724950 2755 dbSNP
rs1476258753 2759 dbSNP
rs549950911 2763 dbSNP
rs924229840 2769 dbSNP
rs564890198 2772 dbSNP
rs1456609861 2773 dbSNP
rs1257596260 2781 dbSNP
rs1201405892 2782 dbSNP
rs532324739 2795 dbSNP
rs1040964517 2797 dbSNP
rs1233123876 2799 dbSNP
rs1377059661 2803 dbSNP
rs375706856 2804 dbSNP
rs547223791 2818 dbSNP
rs990584050 2819 dbSNP
rs1375697446 2825 dbSNP
rs565760531 2826 dbSNP
rs1166399251 2827 dbSNP
rs1394589249 2828 dbSNP
rs1171961900 2835 dbSNP
rs139976376 2838 dbSNP
rs548175383 2839 dbSNP
rs570388282 2860 dbSNP
rs1433283466 2864 dbSNP
rs1014928517 2868 dbSNP
rs1271203353 2874 dbSNP
rs1232547450 2880 dbSNP
rs1188460392 2881 dbSNP
rs1361850853 2882 dbSNP
rs971345484 2884 dbSNP
rs1254485585 2886 dbSNP
rs1210869776 2902 dbSNP
rs1002773972 2905 dbSNP
rs1275055997 2914 dbSNP
rs1034627534 2916 dbSNP
rs1335583115 2918 dbSNP
rs958538151 2920 dbSNP
rs990325477 2922 dbSNP
rs1021336257 2923 dbSNP
rs537302147 2924 dbSNP
rs1449025260 2927 dbSNP
rs1193618497 2928 dbSNP
rs967093516 2932 dbSNP
rs559191058 2938 dbSNP
rs1333243231 2941 dbSNP
rs879752385 2945 dbSNP
rs145483252 2948 dbSNP
rs1474579907 2950 dbSNP
rs942369302 2953 dbSNP
rs944987907 2954 dbSNP
rs1473891559 2959 dbSNP
rs746553574 2960 dbSNP
rs898179878 2969 dbSNP
rs756707607 2977 dbSNP
rs922110270 2982 dbSNP
rs1047311136 2987 dbSNP
rs907377985 2988 dbSNP
rs1003018725 2999 dbSNP
rs932127902 3004 dbSNP
rs1398649458 3011 dbSNP
rs535196753 3012 dbSNP
rs557180420 3017 dbSNP
rs553082490 3018 dbSNP
rs1219038431 3019 dbSNP
rs894522188 3021 dbSNP
rs1296309894 3026 dbSNP
rs1399300121 3030 dbSNP
rs770326154 3033 dbSNP
rs1324280764 3034 dbSNP
rs1407086254 3045 dbSNP
rs201665320 3048 dbSNP
rs775771374 3049 dbSNP
rs184331744 3050 dbSNP
rs377249363 3054 dbSNP
rs189611127 3058 dbSNP
rs1192182035 3059 dbSNP
rs967410502 3063 dbSNP
rs1246848980 3068 dbSNP
rs999432973 3080 dbSNP
rs1030964052 3082 dbSNP
rs1272192027 3085 dbSNP
rs1003217036 3086 dbSNP
rs1485340352 3093 dbSNP
rs1184758560 3099 dbSNP
rs1034247778 3102 dbSNP
rs566388409 3102 dbSNP
rs894303078 3105 dbSNP
rs1438731225 3120 dbSNP
rs1348159068 3132 dbSNP
rs1325523025 3138 dbSNP
rs1011374934 3140 dbSNP
rs1470266567 3144 dbSNP
rs1021410673 3157 dbSNP
rs576400595 3161 dbSNP
rs977126752 3166 dbSNP
rs1019251433 3171 dbSNP
rs964989113 3174 dbSNP
rs976741857 3183 dbSNP
rs749604407 3184 dbSNP
rs1193393499 3188 dbSNP
rs78567332 3191 dbSNP
rs1376580673 3196 dbSNP
rs1178930315 3197 dbSNP
rs985017745 3201 dbSNP
rs1458813116 3202 dbSNP
rs1395974596 3205 dbSNP
rs988048349 3211 dbSNP
rs1332203616 3212 dbSNP
rs11982488 3220 dbSNP
rs929692991 3222 dbSNP
rs1280690456 3238 dbSNP
rs762010179 3244 dbSNP
rs575939622 3245 dbSNP
rs938950580 3246 dbSNP
rs1447880369 3248 dbSNP
rs1379398466 3249 dbSNP
rs1296621380 3250 dbSNP
rs113609660 3265 dbSNP
rs938657572 3268 dbSNP
rs1360083529 3269 dbSNP
rs1344142722 3272 dbSNP
rs1198664505 3278 dbSNP
rs1251996814 3279 dbSNP
rs1437926865 3282 dbSNP
rs1158731646 3283 dbSNP
rs1180531744 3284 dbSNP
rs1440938396 3285 dbSNP
rs1055865695 3288 dbSNP
rs1176227898 3295 dbSNP
rs543392983 3310 dbSNP
rs1455353499 3316 dbSNP
rs1012038920 3321 dbSNP
rs1208001790 3325 dbSNP
rs1347051014 3327 dbSNP
rs1043179916 3337 dbSNP
rs562070015 3342 dbSNP
rs894431791 3347 dbSNP
rs181212324 3349 dbSNP
rs998881844 3351 dbSNP
rs1021441565 3360 dbSNP
rs902994665 3364 dbSNP
rs955247923 3368 dbSNP
rs998578477 3377 dbSNP
rs1467719421 3384 dbSNP
rs1019282069 3399 dbSNP
rs1465947701 3414 dbSNP
rs532236386 3421 dbSNP
rs147605058 3425 dbSNP
rs1421018663 3427 dbSNP
rs1018486019 3429 dbSNP
rs1399324788 3437 dbSNP
rs1424012917 3438 dbSNP
rs1415774002 3441 dbSNP
rs963919779 3445 dbSNP
rs996557289 3446 dbSNP
rs1028407445 3453 dbSNP
rs559507719 3457 dbSNP
rs1218668036 3460 dbSNP
rs1374931817 3465 dbSNP
rs1259031377 3466 dbSNP
rs919726272 3470 dbSNP
rs951037212 3480 dbSNP
rs773313103 3486 dbSNP
rs909394539 3493 dbSNP
rs982384512 3494 dbSNP
rs1231871136 3527 dbSNP
rs1355179120 3530 dbSNP
rs529788777 3535 dbSNP
rs1402374055 3543 dbSNP
rs867481662 3547 dbSNP
rs759459599 3555 dbSNP
rs1303786270 3564 dbSNP
rs1457906922 3567 dbSNP
rs962182044 3568 dbSNP
rs938895166 3570 dbSNP
rs1351267363 3571 dbSNP
rs548213565 3577 dbSNP
rs569632585 3581 dbSNP
rs1424050192 3584 dbSNP
rs947617844 3588 dbSNP
rs1252978458 3590 dbSNP
rs1043518546 3591 dbSNP
rs527772017 3599 dbSNP
rs1488821467 3601 dbSNP
rs938757347 3602 dbSNP
rs1267487485 3604 dbSNP
rs185798266 3605 dbSNP
rs149732940 3610 dbSNP
rs866564027 3612 dbSNP
rs199686248 3613 dbSNP
rs1325199295 3621 dbSNP
rs947337957 3629 dbSNP
rs1042929280 3635 dbSNP
rs1193913167 3637 dbSNP
rs534920647 3642 dbSNP
rs1253972043 3655 dbSNP
rs188946606 3657 dbSNP
rs568217331 3664 dbSNP
rs1197253037 3666 dbSNP
rs1008114028 3667 dbSNP
rs1462994133 3674 dbSNP
rs998609556 3677 dbSNP
rs1018227174 3680 dbSNP
rs1040846100 3682 dbSNP
rs1372454175 3683 dbSNP
rs752448620 3686 dbSNP
rs1433881224 3689 dbSNP
rs1463171614 3702 dbSNP
rs1254940908 3707 dbSNP
rs899662666 3709 dbSNP
rs1039292044 3717 dbSNP
rs1251285497 3717 dbSNP
rs767683206 3717 dbSNP
rs995380709 3717 dbSNP
rs1027245964 3718 dbSNP
rs76644231 3719 dbSNP
rs535516573 3725 dbSNP
rs982497585 3726 dbSNP
rs1035282609 3728 dbSNP
rs1439436386 3728 dbSNP
rs1332899519 3729 dbSNP
rs959730699 3729 dbSNP
rs111661040 3730 dbSNP
rs1395462174 3730 dbSNP
rs199992829 3730 dbSNP
rs139164891 3731 dbSNP
rs10277993 3732 dbSNP
rs879801484 3734 dbSNP
rs1184198986 3738 dbSNP
rs1436482406 3739 dbSNP
rs1336339842 3742 dbSNP
rs1250246264 3752 dbSNP
rs1201601838 3755 dbSNP
rs1484530903 3786 dbSNP
rs915477341 3790 dbSNP
rs1232959396 3791 dbSNP
rs564693418 3794 dbSNP
rs1264458833 3797 dbSNP
rs947531139 3797 dbSNP
rs946426061 3805 dbSNP
rs1335008675 3809 dbSNP
rs558615300 3810 dbSNP
rs1397488011 3813 dbSNP
rs1208421989 3833 dbSNP
rs577034996 3840 dbSNP
rs924794145 3849 dbSNP
rs1264318838 3852 dbSNP
rs1380978366 3853 dbSNP
rs751260840 3857 dbSNP
rs1478398187 3868 dbSNP
rs1160575978 3874 dbSNP
rs1468796887 3875 dbSNP
rs1028019533 3876 dbSNP
rs756870589 3883 dbSNP
rs934695490 3884 dbSNP
rs1188702061 3889 dbSNP
rs6958788 3902 dbSNP
rs1256064759 3911 dbSNP
rs866871257 3917 dbSNP
rs890453625 3920 dbSNP
rs1016486832 3921 dbSNP
rs943391547 3925 dbSNP
rs1040009047 3927 dbSNP
rs745367941 3928 dbSNP
rs1203076100 3930 dbSNP
rs1349504260 3942 dbSNP
rs1284364729 3947 dbSNP
rs1246747296 3954 dbSNP
rs1353284843 3955 dbSNP
rs367669547 3958 dbSNP
rs1400523280 3963 dbSNP
rs1361326890 3966 dbSNP
rs1320375504 3968 dbSNP
rs962213001 3971 dbSNP
rs1398965544 3977 dbSNP
rs1421513298 3987 dbSNP
rs972260122 3990 dbSNP
rs928777013 3993 dbSNP
rs1164013710 3998 dbSNP
rs1476416074 4008 dbSNP
rs145634123 4017 dbSNP
rs1026780489 4023 dbSNP
rs1244266254 4033 dbSNP
rs1165801868 4037 dbSNP
rs1349503177 4041 dbSNP
rs886949063 4048 dbSNP
rs1456595433 4049 dbSNP
rs1290185279 4050 dbSNP
rs991952709 4054 dbSNP
rs568828892 4055 dbSNP
rs1332488181 4061 dbSNP
rs1272313936 4065 dbSNP
rs6977126 4071 dbSNP
rs947335264 4077 dbSNP
rs563347905 4078 dbSNP
rs530456537 4080 dbSNP
rs1042960313 4082 dbSNP
rs924563316 4084 dbSNP
rs959679034 4088 dbSNP
rs113532367 4089 dbSNP
rs181636172 4112 dbSNP
rs1324515609 4114 dbSNP
rs1463196316 4119 dbSNP
rs571079156 4123 dbSNP
rs1357329046 4125 dbSNP
rs1040882292 4137 dbSNP
rs570323481 4140 dbSNP
rs1311467830 4151 dbSNP
rs6976879 4162 dbSNP
rs1164662536 4163 dbSNP
rs76011192 4166 dbSNP
rs1422299107 4177 dbSNP
rs1185247200 4196 dbSNP
rs1474817559 4198 dbSNP
rs968975624 4203 dbSNP
rs1049921210 4208 dbSNP
rs888122656 4209 dbSNP
rs568355287 4210 dbSNP
rs979428586 4213 dbSNP
rs1199062054 4221 dbSNP
rs1005189176 4225 dbSNP
rs1270848527 4241 dbSNP
rs934849428 4242 dbSNP
rs1015260757 4243 dbSNP
rs1182462950 4246 dbSNP
rs1413171608 4247 dbSNP
rs1443106737 4249 dbSNP
rs565300888 4252 dbSNP
rs1325411373 4253 dbSNP
rs186294612 4258 dbSNP
rs200899528 4261 dbSNP
rs3042024 4261 dbSNP
rs397772077 4261 dbSNP
rs35271900 4262 dbSNP
rs72576910 4263 dbSNP
rs1035876226 4273 dbSNP
rs1426408441 4274 dbSNP
rs1174989843 4278 dbSNP
rs943461496 4279 dbSNP
rs557062285 4280 dbSNP
rs774837156 4286 dbSNP
rs991590380 4296 dbSNP
rs931212289 4302 dbSNP
rs1023435051 4305 dbSNP
rs78793820 4316 dbSNP
rs191030984 4321 dbSNP
rs924599224 4335 dbSNP
rs934610361 4339 dbSNP
rs1301685509 4340 dbSNP
rs184217412 4343 dbSNP
rs577068258 4374 dbSNP
rs1302999801 4376 dbSNP
rs977047193 4382 dbSNP
rs148913235 4386 dbSNP
rs76659776 4395 dbSNP
rs772420675 4396 dbSNP
rs773224317 4412 dbSNP
rs1376617671 4414 dbSNP
rs1350597790 4415 dbSNP
rs1432377284 4419 dbSNP
rs1393934941 4423 dbSNP
rs888227054 4428 dbSNP
rs1420501094 4435 dbSNP
rs941086997 4445 dbSNP
rs151315837 4447 dbSNP
rs1176420674 4452 dbSNP
rs1236925472 4469 dbSNP
rs574710358 4473 dbSNP
rs1208602179 4481 dbSNP
rs1484759276 4485 dbSNP
rs1279683101 4490 dbSNP
rs1031968220 4504 dbSNP
rs896795984 4505 dbSNP
rs769623009 4507 dbSNP
rs1036313075 4509 dbSNP
rs142508496 4511 dbSNP
rs1413462168 4512 dbSNP
rs920597096 4534 dbSNP
rs1013535379 4551 dbSNP
rs930674797 4555 dbSNP
rs1343091204 4557 dbSNP
rs1023128056 4568 dbSNP
rs775449585 4578 dbSNP
rs1048279009 4580 dbSNP
rs1405780199 4584 dbSNP
rs908493110 4590 dbSNP
rs968796135 4591 dbSNP
rs1474836762 4592 dbSNP
rs557383429 4597 dbSNP
rs1187210720 4598 dbSNP
rs146431632 4604 dbSNP
rs770148359 4612 dbSNP
rs868176325 4625 dbSNP
rs530598414 4628 dbSNP
rs1056870526 4630 dbSNP
rs1031648847 4631 dbSNP
rs956017908 4634 dbSNP
rs976700391 4637 dbSNP
rs1044572595 4638 dbSNP
rs922478314 4641 dbSNP
rs1383443134 4643 dbSNP
rs1298319781 4645 dbSNP
rs545483677 4653 dbSNP
rs999887312 4656 dbSNP
rs1396498777 4659 dbSNP
rs571117317 4663 dbSNP
rs1307478893 4666 dbSNP
rs1373605552 4671 dbSNP
rs909698745 4672 dbSNP
rs941101699 4679 dbSNP
rs1430431742 4684 dbSNP
rs1259732594 4685 dbSNP
rs1186220877 4699 dbSNP
rs1469080804 4700 dbSNP
rs372382317 4703 dbSNP
rs528067688 4704 dbSNP
rs537241340 4709 dbSNP
rs1212232666 4714 dbSNP
rs761508116 4715 dbSNP
rs1252444498 4719 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000480462.1 | 3UTR | CUGGGGAGGCAGAGGUUGCAGUGAGCCGAGAUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*