miRTarBase - #MIRT637925 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LILRA2   
Synonyms CD85H, ILT1, LIR-7, LIR7
Description leukocyte immunoglobulin like receptor A2
Transcript NM_001130917   
Other Transcripts NM_006866   
Putative miRNA Targets on LILRA2
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM4081345 1 COSMIC
COSN32059494 8 COSMIC
COSN30156749 10 COSMIC
COSN30449439 12 COSMIC
COSN28189450 14 COSMIC
COSN8606444 19 COSMIC
COSN30179843 20 COSMIC
COSN31512403 23 COSMIC
COSN30487015 27 COSMIC
COSN30466440 46 COSMIC
COSN24315302 59 COSMIC
COSN13830485 66 COSMIC
COSN31596468 83 COSMIC
COSN6147397 93 COSMIC
COSN8606445 101 COSMIC
COSN28703846 104 COSMIC
COSN31557619 145 COSMIC
COSN30130046 167 COSMIC
COSN5762069 255 COSMIC
COSN25986518 439 COSMIC
COSN20920519 904 COSMIC
COSN26890508 1013 COSMIC
COSN1771944 1029 COSMIC
COSN17193371 1085 COSMIC
COSN1218638 1093 COSMIC
COSN5439484 1111 COSMIC
COSN15715199 1370 COSMIC
COSN1771946 1390 COSMIC
COSN21325738 1727 COSMIC
COSN21326057 1728 COSMIC
COSN22400111 1794 COSMIC
COSN7449791 1837 COSMIC
COSN26071814 1925 COSMIC
COSN9852365 1932 COSMIC
COSN30408763 2027 COSMIC
COSN17187453 2074 COSMIC
COSN8976115 2091 COSMIC
COSN22546348 2126 COSMIC
COSN1771949 2260 COSMIC
COSN21451638 2353 COSMIC
COSN29657905 2418 COSMIC
COSN9226912 2485 COSMIC
COSN26227281 2504 COSMIC
COSN8976116 2642 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs532604914 3 dbSNP
rs1177852650 7 dbSNP
rs200724105 8 dbSNP
rs1473763155 11 dbSNP
rs1275809343 15 dbSNP
rs201511003 16 dbSNP
rs922128976 20 dbSNP
rs141722714 22 dbSNP
rs1052122 23 dbSNP
rs754283670 30 dbSNP
rs755343223 31 dbSNP
rs1446471194 33 dbSNP
rs1337860554 34 dbSNP
rs753108981 35 dbSNP
rs1446501586 40 dbSNP
rs756854982 41 dbSNP
rs146045183 42 dbSNP
rs1214709114 46 dbSNP
rs1007637726 49 dbSNP
rs745329392 51 dbSNP
rs1309654956 70 dbSNP
rs532939298 75 dbSNP
rs1016719533 79 dbSNP
rs550082834 89 dbSNP
rs1363989198 90 dbSNP
rs1162735997 92 dbSNP
rs1458528528 93 dbSNP
rs189682852 96 dbSNP
rs1157476620 101 dbSNP
rs973971276 103 dbSNP
rs1252934873 105 dbSNP
rs1305041482 106 dbSNP
rs1184851807 108 dbSNP
rs56789693 110 dbSNP
rs1042060291 115 dbSNP
rs906159666 117 dbSNP
rs1003451068 118 dbSNP
rs1258435681 119 dbSNP
rs981707458 123 dbSNP
rs775071239 125 dbSNP
rs1054965399 130 dbSNP
rs139968405 133 dbSNP
rs1282745623 136 dbSNP
rs1323073364 137 dbSNP
rs1387567156 139 dbSNP
rs895004056 140 dbSNP
rs1392916657 149 dbSNP
rs73939009 150 dbSNP
rs549059140 152 dbSNP
rs947000205 153 dbSNP
rs1042002469 154 dbSNP
rs573664905 157 dbSNP
rs777645717 162 dbSNP
rs933539030 164 dbSNP
rs1197024177 166 dbSNP
rs566172495 169 dbSNP
rs1453006248 171 dbSNP
rs1052399317 174 dbSNP
rs1207612407 175 dbSNP
rs535084338 183 dbSNP
rs552021758 185 dbSNP
rs1343945820 188 dbSNP
rs1193839724 190 dbSNP
rs1234172010 191 dbSNP
rs181242773 195 dbSNP
rs1293480220 199 dbSNP
rs1434556310 200 dbSNP
rs141542769 207 dbSNP
rs1008062552 208 dbSNP
rs1175842452 211 dbSNP
rs1016318321 215 dbSNP
rs1018953286 216 dbSNP
rs966432859 218 dbSNP
rs750275726 225 dbSNP
rs975031433 227 dbSNP
rs1329924030 236 dbSNP
rs892195638 239 dbSNP
rs1441766023 240 dbSNP
rs1007994398 241 dbSNP
rs34448127 241 dbSNP
rs1019257225 244 dbSNP
rs146169708 248 dbSNP
rs957579561 259 dbSNP
rs1201644724 268 dbSNP
rs1441790531 271 dbSNP
rs1026255924 275 dbSNP
rs990334864 278 dbSNP
rs537635209 280 dbSNP
rs139105406 281 dbSNP
rs1206460927 286 dbSNP
rs116788087 287 dbSNP
rs1456891303 292 dbSNP
rs1365940276 293 dbSNP
rs386810930 302 dbSNP
rs73939010 303 dbSNP
rs73939011 304 dbSNP
rs938999767 309 dbSNP
rs149895927 313 dbSNP
rs1416574092 316 dbSNP
rs144939109 318 dbSNP
rs1394798987 319 dbSNP
rs148782921 325 dbSNP
rs577455492 327 dbSNP
rs1048890022 328 dbSNP
rs144811667 333 dbSNP
rs530067929 333 dbSNP
rs1189349776 335 dbSNP
rs1435809890 338 dbSNP
rs563602054 339 dbSNP
rs1273660096 341 dbSNP
rs1204655172 346 dbSNP
rs1462001843 347 dbSNP
rs368844517 348 dbSNP
rs147959175 353 dbSNP
rs1348347591 356 dbSNP
rs1005002400 357 dbSNP
rs889292956 365 dbSNP
rs1019444158 366 dbSNP
rs1307831909 368 dbSNP
rs773769435 370 dbSNP
rs112780593 378 dbSNP
rs185750760 389 dbSNP
rs1161124378 391 dbSNP
rs551947952 392 dbSNP
rs77945897 393 dbSNP
rs1164861377 406 dbSNP
rs993530934 409 dbSNP
rs1026308231 411 dbSNP
rs1182697962 414 dbSNP
rs531139063 425 dbSNP
rs906539961 428 dbSNP
rs1233355064 430 dbSNP
rs759133979 431 dbSNP
rs550856761 433 dbSNP
rs1035578155 438 dbSNP
rs145366319 439 dbSNP
rs1242369722 440 dbSNP
rs374277801 442 dbSNP
rs1351930674 458 dbSNP
rs958799549 461 dbSNP
rs190405956 465 dbSNP
rs1349917251 468 dbSNP
rs369096376 469 dbSNP
rs1455558818 473 dbSNP
rs1411204778 476 dbSNP
rs1159623731 477 dbSNP
rs371696952 479 dbSNP
rs1167757959 481 dbSNP
rs536517793 494 dbSNP
rs181649025 495 dbSNP
rs187345912 497 dbSNP
rs534307932 504 dbSNP
rs1347221678 505 dbSNP
rs73939012 508 dbSNP
rs191977125 510 dbSNP
rs1339738245 514 dbSNP
rs1331594521 515 dbSNP
rs566469819 519 dbSNP
rs73939013 520 dbSNP
rs182647299 521 dbSNP
rs1276077300 522 dbSNP
rs977168742 524 dbSNP
rs924277980 538 dbSNP
rs1321065139 554 dbSNP
rs1227265342 561 dbSNP
rs753865620 565 dbSNP
rs1175153583 567 dbSNP
rs930571037 572 dbSNP
rs1049444447 579 dbSNP
rs886313458 582 dbSNP
rs187653783 615 dbSNP
rs73939014 619 dbSNP
rs1189735699 621 dbSNP
rs765145587 622 dbSNP
rs751760870 623 dbSNP
rs1486207568 624 dbSNP
rs901946699 627 dbSNP
rs150225791 629 dbSNP
rs1029004787 631 dbSNP
rs528545440 633 dbSNP
rs771484804 635 dbSNP
rs190137361 640 dbSNP
rs182603384 642 dbSNP
rs187308010 651 dbSNP
rs1302037955 652 dbSNP
rs1466407963 653 dbSNP
rs1175684580 655 dbSNP
rs1428101465 671 dbSNP
rs967598607 672 dbSNP
rs1389585060 675 dbSNP
rs1003468154 680 dbSNP
rs541173451 685 dbSNP
rs530876347 689 dbSNP
rs755156772 691 dbSNP
rs551177873 697 dbSNP
rs375455069 702 dbSNP
rs117457688 710 dbSNP
rs192131216 713 dbSNP
rs1341079388 714 dbSNP
rs1274688880 720 dbSNP
rs117041916 727 dbSNP
rs117511157 732 dbSNP
rs960447579 741 dbSNP
rs138803777 746 dbSNP
rs1381023809 747 dbSNP
rs1021501082 748 dbSNP
rs1277079540 749 dbSNP
rs968501198 766 dbSNP
rs8102050 777 dbSNP
rs6509887 783 dbSNP
rs1164611820 791 dbSNP
rs113966302 798 dbSNP
rs1420445178 806 dbSNP
rs1180518688 808 dbSNP
rs1482521145 810 dbSNP
rs1252161480 811 dbSNP
rs1197194323 813 dbSNP
rs907797031 814 dbSNP
rs1264380266 817 dbSNP
rs940595142 835 dbSNP
rs1286197166 838 dbSNP
rs149096967 846 dbSNP
rs1350091114 847 dbSNP
rs185364877 852 dbSNP
rs188859436 853 dbSNP
rs987178316 854 dbSNP
rs79063917 865 dbSNP
rs868447994 868 dbSNP
rs1413779280 878 dbSNP
rs1458836862 881 dbSNP
rs1329458607 886 dbSNP
rs1397404276 895 dbSNP
rs73612442 897 dbSNP
rs1443960828 923 dbSNP
rs1413162313 924 dbSNP
rs193104068 930 dbSNP
rs117591008 932 dbSNP
rs1266032850 936 dbSNP
rs184302436 942 dbSNP
rs745459176 943 dbSNP
rs1469763845 948 dbSNP
rs973624457 952 dbSNP
rs570320117 953 dbSNP
rs1344770653 955 dbSNP
rs893163636 966 dbSNP
rs1451738660 969 dbSNP
rs920765262 972 dbSNP
rs929442167 973 dbSNP
rs1011976709 975 dbSNP
rs111578730 980 dbSNP
rs867542890 981 dbSNP
rs272405 984 dbSNP
rs1470038854 985 dbSNP
rs760070754 986 dbSNP
rs574354803 987 dbSNP
rs1464205489 989 dbSNP
rs1376784472 996 dbSNP
rs1477591233 997 dbSNP
rs1011990971 1002 dbSNP
rs1245671026 1005 dbSNP
rs1187808452 1008 dbSNP
rs553308418 1010 dbSNP
rs1286048679 1013 dbSNP
rs1198586031 1019 dbSNP
rs1343120236 1020 dbSNP
rs1255567647 1030 dbSNP
rs951774632 1033 dbSNP
rs1042963033 1035 dbSNP
rs1434987184 1036 dbSNP
rs1463574394 1038 dbSNP
rs1320695420 1040 dbSNP
rs573136405 1041 dbSNP
rs113216762 1043 dbSNP
rs138761841 1044 dbSNP
rs1031903459 1049 dbSNP
rs1167459513 1053 dbSNP
rs1388095444 1054 dbSNP
rs113167553 1055 dbSNP
rs59979031 1056 dbSNP
rs1441562757 1057 dbSNP
rs1431961347 1061 dbSNP
rs1256627437 1062 dbSNP
rs1211802444 1063 dbSNP
rs561424420 1064 dbSNP
rs1272538277 1065 dbSNP
rs1419008165 1067 dbSNP
rs1280626310 1071 dbSNP
rs1017311014 1074 dbSNP
rs1340667813 1084 dbSNP
rs964689850 1085 dbSNP
rs973632681 1086 dbSNP
rs923137572 1088 dbSNP
rs1313897551 1095 dbSNP
rs1416221650 1099 dbSNP
rs1368387190 1100 dbSNP
rs950903686 1101 dbSNP
rs1161346963 1102 dbSNP
rs1429762761 1102 dbSNP
rs180943055 1102 dbSNP
rs1472437828 1105 dbSNP
rs1368803180 1108 dbSNP
rs1189854209 1110 dbSNP
rs1273825958 1111 dbSNP
rs1249968474 1112 dbSNP
rs546742199 1117 dbSNP
rs560421011 1118 dbSNP
rs947473244 1120 dbSNP
rs1042116364 1121 dbSNP
rs903152189 1122 dbSNP
rs746422799 1125 dbSNP
rs938966450 1133 dbSNP
rs939483328 1134 dbSNP
rs1349030525 1136 dbSNP
rs532631429 1139 dbSNP
rs550982117 1147 dbSNP
rs1321064493 1148 dbSNP
rs916594891 1152 dbSNP
rs1391448249 1153 dbSNP
rs894670556 1156 dbSNP
rs1476835871 1157 dbSNP
rs1471457277 1159 dbSNP
rs112416574 1164 dbSNP
rs1027086542 1176 dbSNP
rs1043015857 1178 dbSNP
rs444632 1180 dbSNP
rs904466104 1182 dbSNP
rs934551895 1191 dbSNP
rs1365624699 1192 dbSNP
rs112927674 1193 dbSNP
rs444250 1197 dbSNP
rs420685 1203 dbSNP
rs1274288540 1205 dbSNP
rs1401619720 1206 dbSNP
rs1005934970 1207 dbSNP
rs373207 1209 dbSNP
rs1008652365 1213 dbSNP
rs370518429 1215 dbSNP
rs976018452 1217 dbSNP
rs183916439 1218 dbSNP
rs1027258115 1220 dbSNP
rs950994549 1224 dbSNP
rs433810 1226 dbSNP
rs1327763186 1230 dbSNP
rs983658509 1231 dbSNP
rs1265048709 1239 dbSNP
rs1159628843 1246 dbSNP
rs1401474500 1251 dbSNP
rs112643467 1252 dbSNP
rs555294016 1256 dbSNP
rs866969111 1258 dbSNP
rs1477700973 1259 dbSNP
rs1491268294 1259 dbSNP
rs1195989613 1260 dbSNP
rs1347925873 1260 dbSNP
rs1432781698 1260 dbSNP
rs200173819 1260 dbSNP
rs576332421 1260 dbSNP
rs770565167 1260 dbSNP
rs953245532 1269 dbSNP
rs1364424972 1275 dbSNP
rs1287825154 1276 dbSNP
rs1487190609 1277 dbSNP
rs1039249100 1278 dbSNP
rs1432564229 1282 dbSNP
rs1357216967 1286 dbSNP
rs1174170128 1287 dbSNP
rs899564385 1288 dbSNP
rs1192804660 1289 dbSNP
rs1256807966 1298 dbSNP
rs914374081 1300 dbSNP
rs947468875 1304 dbSNP
rs1448197859 1308 dbSNP
rs996629930 1317 dbSNP
rs977527197 1321 dbSNP
rs1048508829 1325 dbSNP
rs1236123448 1326 dbSNP
rs924646433 1328 dbSNP
rs1281805669 1330 dbSNP
rs1485823197 1330 dbSNP
rs1225634000 1333 dbSNP
rs1340857463 1337 dbSNP
rs553171298 1338 dbSNP
rs990935024 1341 dbSNP
rs1376636515 1343 dbSNP
rs373075206 1344 dbSNP
rs374654337 1345 dbSNP
rs979457177 1347 dbSNP
rs1314815519 1353 dbSNP
rs1313996287 1357 dbSNP
rs538963921 1360 dbSNP
rs1427839694 1362 dbSNP
rs1372586515 1372 dbSNP
rs1171690000 1377 dbSNP
rs1430836124 1380 dbSNP
rs1405029807 1382 dbSNP
rs188707164 1386 dbSNP
rs948933891 1389 dbSNP
rs1396358441 1390 dbSNP
rs111825921 1391 dbSNP
rs573629432 1394 dbSNP
rs1312099034 1400 dbSNP
rs544590889 1403 dbSNP
rs1206510854 1406 dbSNP
rs1411545812 1407 dbSNP
rs944508276 1411 dbSNP
rs1288919154 1414 dbSNP
rs1311735963 1415 dbSNP
rs1215691992 1416 dbSNP
rs1038800346 1418 dbSNP
rs900281592 1423 dbSNP
rs1327806333 1424 dbSNP
rs117855300 1435 dbSNP
rs574834086 1445 dbSNP
rs181547100 1446 dbSNP
rs78355464 1450 dbSNP
rs1348715531 1453 dbSNP
rs1027310262 1457 dbSNP
rs1475700112 1462 dbSNP
rs1420514075 1471 dbSNP
rs1180071546 1477 dbSNP
rs115220149 1480 dbSNP
rs577528736 1481 dbSNP
rs1177329311 1486 dbSNP
rs1379861242 1487 dbSNP
rs186795929 1492 dbSNP
rs1302783633 1493 dbSNP
rs1266038856 1494 dbSNP
rs1397256493 1501 dbSNP
rs1335440736 1503 dbSNP
rs753005093 1504 dbSNP
rs1329538080 1506 dbSNP
rs1012854408 1508 dbSNP
rs1462446988 1508 dbSNP
rs960924903 1508 dbSNP
rs1023795848 1509 dbSNP
rs552483123 1511 dbSNP
rs1364071737 1512 dbSNP
rs1021913094 1513 dbSNP
rs8105598 1515 dbSNP
rs1301791709 1517 dbSNP
rs1313743966 1518 dbSNP
rs1230925016 1519 dbSNP
rs1255361020 1524 dbSNP
rs756165919 1525 dbSNP
rs114350991 1527 dbSNP
rs1200024948 1528 dbSNP
rs1235972375 1529 dbSNP
rs938740129 1532 dbSNP
rs1457084112 1545 dbSNP
rs192153830 1547 dbSNP
rs144825533 1551 dbSNP
rs1427623464 1556 dbSNP
rs992790767 1559 dbSNP
rs536325747 1560 dbSNP
rs1425036730 1561 dbSNP
rs1302827265 1564 dbSNP
rs1442237479 1565 dbSNP
rs911772385 1568 dbSNP
rs1467222104 1572 dbSNP
rs944619018 1573 dbSNP
rs147501729 1575 dbSNP
rs35328325 1580 dbSNP
rs1015455864 1582 dbSNP
rs1295535255 1583 dbSNP
rs921760458 1586 dbSNP
rs1048636870 1591 dbSNP
rs749759184 1593 dbSNP
rs940188555 1597 dbSNP
rs1037576407 1601 dbSNP
rs959975637 1602 dbSNP
rs12983953 1606 dbSNP
rs1022815247 1612 dbSNP
rs1447298405 1614 dbSNP
rs997229742 1616 dbSNP
rs1051439536 1617 dbSNP
rs1332308322 1622 dbSNP
rs76828736 1626 dbSNP
rs1007523584 1628 dbSNP
rs1279693279 1638 dbSNP
rs1235193228 1640 dbSNP
rs558625642 1644 dbSNP
rs779282229 1645 dbSNP
rs8106636 1647 dbSNP
rs1320748868 1649 dbSNP
rs978877164 1651 dbSNP
rs772524625 1654 dbSNP
rs1033387859 1659 dbSNP
rs956063290 1660 dbSNP
rs960121756 1665 dbSNP
rs988845918 1666 dbSNP
rs992864460 1668 dbSNP
rs1406049199 1669 dbSNP
rs1475727278 1670 dbSNP
rs767638124 1684 dbSNP
rs970011998 1687 dbSNP
rs984806198 1688 dbSNP
rs272406 1691 dbSNP
rs944964750 1692 dbSNP
rs940241034 1693 dbSNP
rs974885963 1694 dbSNP
rs1000960384 1697 dbSNP
rs922138446 1698 dbSNP
rs1276266553 1704 dbSNP
rs879291262 1708 dbSNP
rs1031061743 1710 dbSNP
rs922733914 1721 dbSNP
rs79717751 1722 dbSNP
rs1293459548 1726 dbSNP
rs932361054 1727 dbSNP
rs574613160 1728 dbSNP
rs1319623032 1736 dbSNP
rs540353905 1737 dbSNP
rs60289078 1752 dbSNP
rs768237313 1765 dbSNP
rs117433298 1775 dbSNP
rs1263163592 1777 dbSNP
rs761783553 1778 dbSNP
rs769839139 1781 dbSNP
rs773264826 1790 dbSNP
rs373623589 1793 dbSNP
rs577060623 1794 dbSNP
rs545947747 1795 dbSNP
rs930443611 1803 dbSNP
rs1411878088 1811 dbSNP
rs1274249412 1815 dbSNP
rs113130030 1821 dbSNP
rs1159475367 1822 dbSNP
rs1278428051 1823 dbSNP
rs907654382 1826 dbSNP
rs1337020584 1828 dbSNP
rs940439800 1831 dbSNP
rs1056566950 1835 dbSNP
rs999144032 1840 dbSNP
rs754045838 1841 dbSNP
rs762626612 1848 dbSNP
rs896153683 1852 dbSNP
rs1012917968 1863 dbSNP
rs1470517467 1865 dbSNP
rs1031537334 1866 dbSNP
rs1296248324 1868 dbSNP
rs1303013400 1871 dbSNP
rs35031040 1871 dbSNP
rs67467929 1874 dbSNP
rs201163994 1876 dbSNP
rs1468456601 1885 dbSNP
rs959862336 1893 dbSNP
rs1045309570 1894 dbSNP
rs367753288 1894 dbSNP
rs1014315155 1895 dbSNP
rs904036858 1896 dbSNP
rs182212262 1898 dbSNP
rs34634665 1910 dbSNP
rs560967679 1913 dbSNP
rs1023186186 1916 dbSNP
rs905698390 1921 dbSNP
rs117980180 1925 dbSNP
rs746333120 1930 dbSNP
rs1327656763 1933 dbSNP
rs1214958405 1934 dbSNP
rs909833033 1939 dbSNP
rs1344396832 1942 dbSNP
rs1317857600 1943 dbSNP
rs1285922139 1954 dbSNP
rs1443553906 1958 dbSNP
rs1401529403 1959 dbSNP
rs1382212744 1960 dbSNP
rs1212874890 1961 dbSNP
rs1235736647 1963 dbSNP
rs1482983011 1965 dbSNP
rs1396148012 1966 dbSNP
rs1179443062 1972 dbSNP
rs1196058975 1973 dbSNP
rs546758220 1974 dbSNP
rs566570479 1976 dbSNP
rs1441284760 1979 dbSNP
rs570281848 1980 dbSNP
rs1241915392 1983 dbSNP
rs1216035831 1984 dbSNP
rs1156688977 1990 dbSNP
rs1407148674 1991 dbSNP
rs758907969 1992 dbSNP
rs892572463 1996 dbSNP
rs866367597 2002 dbSNP
rs1347993447 2007 dbSNP
rs922805975 2008 dbSNP
rs1212771300 2016 dbSNP
rs1336097064 2018 dbSNP
rs1270604187 2022 dbSNP
rs1356893721 2026 dbSNP
rs8108938 2027 dbSNP
rs987249045 2030 dbSNP
rs374495232 2031 dbSNP
rs552307817 2042 dbSNP
rs1028837114 2045 dbSNP
rs1279274697 2051 dbSNP
rs951946062 2053 dbSNP
rs984618752 2067 dbSNP
rs59401092 2070 dbSNP
rs145394402 2072 dbSNP
rs554543376 2073 dbSNP
rs1485692384 2074 dbSNP
rs934634358 2075 dbSNP
rs1052947184 2081 dbSNP
rs1306911290 2082 dbSNP
rs568148639 2088 dbSNP
rs1216043383 2099 dbSNP
rs1240263152 2106 dbSNP
rs1291623623 2118 dbSNP
rs1414420258 2127 dbSNP
rs991886668 2130 dbSNP
rs1014053563 2139 dbSNP
rs1456656316 2148 dbSNP
rs1178272798 2149 dbSNP
rs1354531349 2151 dbSNP
rs1171748435 2152 dbSNP
rs764097890 2153 dbSNP
rs1467450474 2162 dbSNP
rs1232029336 2165 dbSNP
rs1416190208 2165 dbSNP
rs1186724962 2170 dbSNP
rs1478252812 2171 dbSNP
rs549834499 2174 dbSNP
rs956137936 2176 dbSNP
rs1175029522 2183 dbSNP
rs1480032068 2184 dbSNP
rs533920450 2186 dbSNP
rs1006014026 2187 dbSNP
rs1016972048 2195 dbSNP
rs553855249 2196 dbSNP
rs568105911 2197 dbSNP
rs904126542 2200 dbSNP
rs988793739 2204 dbSNP
rs576888930 2208 dbSNP
rs1314926611 2212 dbSNP
rs546097669 2217 dbSNP
rs142269687 2223 dbSNP
rs1299206581 2228 dbSNP
rs1449685515 2239 dbSNP
rs936891613 2242 dbSNP
rs1273553935 2243 dbSNP
rs1461623620 2246 dbSNP
rs1323533963 2250 dbSNP
rs1369777308 2260 dbSNP
rs1156494511 2261 dbSNP
rs151277467 2264 dbSNP
rs1250641635 2272 dbSNP
rs892632080 2275 dbSNP
rs372302972 2282 dbSNP
rs550623983 2286 dbSNP
rs1214159649 2287 dbSNP
rs1358220836 2288 dbSNP
rs1267386535 2290 dbSNP
rs117710270 2291 dbSNP
rs187594656 2292 dbSNP
rs140568872 2300 dbSNP
rs540188594 2302 dbSNP
rs1442012226 2303 dbSNP
rs1393363346 2309 dbSNP
rs560298684 2312 dbSNP
rs189790775 2316 dbSNP
rs779254630 2317 dbSNP
rs1160002269 2318 dbSNP
rs552107880 2319 dbSNP
rs978916055 2321 dbSNP
rs925663960 2322 dbSNP
rs1166932993 2326 dbSNP
rs984669789 2328 dbSNP
rs1407436653 2334 dbSNP
rs934307611 2335 dbSNP
rs569060072 2336 dbSNP
rs1286825483 2337 dbSNP
rs1449958423 2337 dbSNP
rs9304761 2338 dbSNP
rs1401072087 2339 dbSNP
rs115602566 2341 dbSNP
rs1235695840 2342 dbSNP
rs1415666416 2342 dbSNP
rs1333167854 2346 dbSNP
rs568009010 2349 dbSNP
rs895753966 2350 dbSNP
rs1299670177 2353 dbSNP
rs949929129 2357 dbSNP
rs1044214433 2359 dbSNP
rs9676790 2363 dbSNP
rs547356361 2364 dbSNP
rs924931479 2366 dbSNP
rs936944403 2368 dbSNP
rs1289238597 2369 dbSNP
rs272407 2373 dbSNP
rs1017417023 2376 dbSNP
rs1201494806 2386 dbSNP
rs897184691 2392 dbSNP
rs1249961270 2394 dbSNP
rs892635574 2397 dbSNP
rs1265304068 2398 dbSNP
rs1426192122 2399 dbSNP
rs1191936525 2400 dbSNP
rs944191082 2408 dbSNP
rs1041542756 2410 dbSNP
rs1473544212 2416 dbSNP
rs1161100723 2417 dbSNP
rs1394324660 2417 dbSNP
rs1167263096 2418 dbSNP
rs1365298776 2419 dbSNP
rs1425532627 2421 dbSNP
rs1420719928 2422 dbSNP
rs1256891203 2423 dbSNP
rs1300563630 2423 dbSNP
rs899944159 2424 dbSNP
rs746593470 2428 dbSNP
rs1248952722 2430 dbSNP
rs1313455261 2431 dbSNP
rs1342347642 2432 dbSNP
rs1192834177 2444 dbSNP
rs768435777 2444 dbSNP
rs1242826577 2445 dbSNP
rs1314654676 2447 dbSNP
rs1231044603 2448 dbSNP
rs1358431787 2448 dbSNP
rs1333789040 2449 dbSNP
rs1333507404 2453 dbSNP
rs182465170 2453 dbSNP
rs1328038092 2455 dbSNP
rs1240648190 2464 dbSNP
rs567624317 2465 dbSNP
rs1162609276 2467 dbSNP
rs895493066 2475 dbSNP
rs1417347434 2476 dbSNP
rs985676581 2476 dbSNP
rs556368452 2479 dbSNP
rs968602536 2483 dbSNP
rs949932208 2485 dbSNP
rs1458638857 2486 dbSNP
rs1044317046 2490 dbSNP
rs962205408 2496 dbSNP
rs1181321180 2509 dbSNP
rs1384278838 2515 dbSNP
rs576619054 2516 dbSNP
rs1160881134 2517 dbSNP
rs747654541 2518 dbSNP
rs1278480657 2519 dbSNP
rs1453590860 2521 dbSNP
rs570439022 2523 dbSNP
rs1025214391 2524 dbSNP
rs1303959802 2524 dbSNP
rs955789869 2528 dbSNP
rs1379096110 2529 dbSNP
rs1404379233 2533 dbSNP
rs1394411311 2534 dbSNP
rs1323821506 2536 dbSNP
rs535668893 2538 dbSNP
rs772123275 2539 dbSNP
rs950002841 2540 dbSNP
rs1158139017 2543 dbSNP
rs1440834667 2545 dbSNP
rs1447231391 2551 dbSNP
rs556100120 2553 dbSNP
rs1311113480 2555 dbSNP
rs1314917774 2561 dbSNP
rs1238193610 2563 dbSNP
rs1256540555 2565 dbSNP
rs769388685 2566 dbSNP
rs1282924863 2567 dbSNP
rs773001683 2573 dbSNP
rs187173990 2574 dbSNP
rs1457887232 2575 dbSNP
rs1233503141 2580 dbSNP
rs1368014278 2590 dbSNP
rs980512780 2595 dbSNP
rs565218066 2598 dbSNP
rs1248811414 2614 dbSNP
rs1418881486 2617 dbSNP
rs1177390813 2618 dbSNP
rs1379919005 2627 dbSNP
rs1172287180 2639 dbSNP
rs1468292157 2643 dbSNP
rs1175869832 2645 dbSNP
rs1193341821 2647 dbSNP
rs1401145484 2649 dbSNP
rs1449195925 2660 dbSNP
rs1241090751 2662 dbSNP
rs1329598997 2662 dbSNP
rs1370847026 2663 dbSNP
rs1390654830 2666 dbSNP
rs1301860042 2668 dbSNP
rs1488956932 2672 dbSNP
rs924942958 2673 dbSNP
rs1221624762 2677 dbSNP
rs1261895175 2680 dbSNP
rs1318039042 2685 dbSNP
rs957657755 2691 dbSNP
rs988811073 2701 dbSNP
rs1249304800 2703 dbSNP
rs1480491589 2718 dbSNP
rs1361022098 2720 dbSNP
rs1277766391 2725 dbSNP
rs536226825 2726 dbSNP
rs1192202247 2732 dbSNP
rs1342413759 2741 dbSNP
rs1311207668 2753 dbSNP
rs1465965652 2757 dbSNP
rs1270082763 2761 dbSNP
rs914134480 2762 dbSNP
rs1199339500 2764 dbSNP
rs1408531855 2765 dbSNP
rs1423382168 2767 dbSNP
rs1170920415 2772 dbSNP
rs1424378844 2773 dbSNP
rs1478622179 2773 dbSNP
rs944275459 2780 dbSNP
rs1483300285 2783 dbSNP
rs1168575263 2784 dbSNP
rs1239065896 2785 dbSNP
rs1306659484 2786 dbSNP
rs1354207945 2787 dbSNP
rs1219471264 2794 dbSNP
rs1320343741 2796 dbSNP
rs1291680677 2803 dbSNP
rs1395458026 2810 dbSNP
rs1380020592 2817 dbSNP
rs1305058862 2823 dbSNP
rs1461292962 2837 dbSNP
rs747834936 2841 dbSNP
rs1041251115 2844 dbSNP
rs1415139061 2848 dbSNP
rs11320412 2850 dbSNP
rs372053541 2850 dbSNP
rs762970283 2854 dbSNP
rs932742046 2856 dbSNP
rs1282585965 2858 dbSNP
rs1340568251 2862 dbSNP
rs1219974266 2863 dbSNP
rs1200230389 2870 dbSNP
rs1292987628 2872 dbSNP
rs1271462534 2877 dbSNP
rs201153209 2879 dbSNP
rs888462979 2890 dbSNP
rs1004195134 2893 dbSNP
rs540248285 2895 dbSNP
rs190247307 2901 dbSNP
rs114217110 2903 dbSNP
rs775638569 2904 dbSNP
rs1222336328 2905 dbSNP
rs1024845681 2911 dbSNP
rs1161772912 2925 dbSNP
rs1351107825 2926 dbSNP
rs1264591589 2932 dbSNP
rs1438552390 2935 dbSNP
rs1478826684 2937 dbSNP
rs1184926933 2940 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084068
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000251377.3 | 3UTR | UUGCCAUUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE17498 Multiple myeloma 0.413 4.0e-3 0.434 2.6e-3 40 Click to see details
GSE42095 Differentiated embryonic stem cells -0.436 1.9e-2 -0.607 1.1e-3 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.386 2.8e-2 -0.409 2.1e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.394 2.8e-2 0.368 3.8e-2 24 Click to see details
GSE14794 Lymphoblastoid cells 0.155 7.2e-2 0.167 5.8e-2 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.264 1.0e-1 0.313 6.4e-2 25 Click to see details
GSE28260 Renal cortex and medulla -0.307 1.5e-1 -0.176 2.8e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.244 1.8e-1 -0.244 1.8e-1 16 Click to see details
GSE19350 CNS germ cell tumors 0.254 2.1e-1 0.059 4.3e-1 12 Click to see details
GSE32688 Pancreatic cancer 0.124 2.5e-1 0.159 1.9e-1 32 Click to see details
GSE21687 Ependynoma primary tumors -0.08 2.6e-1 -0.157 1.1e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.283 2.9e-1 -0.371 2.3e-1 6 Click to see details
GSE38226 Liver fibrosis 0.119 3.0e-1 0.202 1.9e-1 21 Click to see details
GSE21849 B cell lymphoma 0.046 4.1e-1 0.054 3.9e-1 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.047 4.2e-1 -0.149 2.7e-1 20 Click to see details
GSE17306 Multiple myeloma 0.019 4.5e-1 0.067 3.2e-1 49 Click to see details
GSE28544 Breast cancer 0.009 4.8e-1 0.042 4.2e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.481 0 -0.346 0.01 49 Click to see details
STAD -0.55 0.08 -0.690 0.03 8 Click to see details
KIRP 0.501 0.08 0.300 0.22 9 Click to see details
KICH 0.53 0.09 0.619 0.05 8 Click to see details
ESCA -0.471 0.21 -0.600 0.14 5 Click to see details
CHOL 0.266 0.24 0.300 0.22 9 Click to see details
KIRC 0.075 0.35 0.035 0.43 29 Click to see details
THCA -0.131 0.42 0.000 0.5 5 Click to see details
HNSC 1 0.5 1.000 0.5 3 Click to see details
HNSC 1 0.5 1.000 0.5 3 Click to see details
HNSC 1 0.5 1.000 0.5 3 Click to see details
HNSC 1 0.5 1.000 0.5 3 Click to see details
HNSC 1 0.5 1.000 0.5 3 Click to see details
HNSC 1 0.5 1.000 0.5 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627420 THAP2 THAP domain containing 2 2 2
MIRT627441 TAS2R5 taste 2 receptor member 5 2 2
MIRT628078 KAT7 lysine acetyltransferase 7 2 4
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629094 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629286 UNC13A unc-13 homolog A 2 2
MIRT629407 ADM2 adrenomedullin 2 2 2
MIRT629584 RFC2 replication factor C subunit 2 2 2
MIRT629635 WDR31 WD repeat domain 31 2 2
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629984 NARS asparaginyl-tRNA synthetase 2 2
MIRT630043 TERF2 telomeric repeat binding factor 2 2 2
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630252 SMTNL2 smoothelin like 2 2 2
MIRT630278 PSMB5 proteasome subunit beta 5 2 2
MIRT630347 NKAP NFKB activating protein 2 2
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT631264 CENPM centromere protein M 2 2
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632470 RPS15A ribosomal protein S15a 2 2
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632994 DUSP18 dual specificity phosphatase 18 2 2
MIRT633082 CXorf21 chromosome X open reading frame 21 2 2
MIRT633239 ZNF573 zinc finger protein 573 2 2
MIRT633286 SLC1A5 solute carrier family 1 member 5 2 2
MIRT633536 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634338 SGOL1 shugoshin 1 2 2
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635050 MYH11 myosin heavy chain 11 2 2
MIRT635236 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636268 RNF157 ring finger protein 157 2 2
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636516 FMN1 formin 1 2 2
MIRT636755 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637188 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637693 CEP89 centrosomal protein 89 2 2
MIRT637788 OLA1 Obg like ATPase 1 2 2
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638449 PLXDC2 plexin domain containing 2 2 2
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT642643 PTGR2 prostaglandin reductase 2 2 2
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644236 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645092 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646508 FAM217B family with sequence similarity 217 member B 2 2
MIRT647013 ADCY2 adenylate cyclase 2 2 2
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648040 FADS6 fatty acid desaturase 6 2 2
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649182 DNPEP aspartyl aminopeptidase 2 2
MIRT649660 TEP1 telomerase associated protein 1 2 2
MIRT651465 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652398 TMEM40 transmembrane protein 40 2 2
MIRT653691 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654577 PXMP4 peroxisomal membrane protein 4 2 2
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658905 DPY19L4 dpy-19 like 4 2 2
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 2 4
MIRT661101 SPIB Spi-B transcription factor 2 2
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662235 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662544 MTAP methylthioadenosine phosphorylase 2 2
MIRT662736 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662844 OMD osteomodulin 2 2
MIRT662907 MED18 mediator complex subunit 18 2 2
MIRT662956 JPH2 junctophilin 2 2 2
MIRT663340 ZNF74 zinc finger protein 74 2 2
MIRT663496 IYD iodotyrosine deiodinase 2 2
MIRT663523 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663542 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663973 ZNF786 zinc finger protein 786 2 2
MIRT664350 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664417 TIGD6 tigger transposable element derived 6 2 2
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664970 TDRD1 tudor domain containing 1 2 2
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665359 XKR4 XK related 4 2 2
MIRT665454 WDR17 WD repeat domain 17 2 2
MIRT665486 VPS53 VPS53, GARP complex subunit 2 2
MIRT666078 SSTR2 somatostatin receptor 2 2 2
MIRT666258 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666324 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666486 SBNO1 strawberry notch homolog 1 2 2
MIRT666696 RBM23 RNA binding motif protein 23 2 2
MIRT666712 RBL1 RB transcriptional corepressor like 1 2 2
MIRT666762 RAB10 RAB10, member RAS oncogene family 2 2
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667474 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667558 LRAT lecithin retinol acyltransferase 2 2
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668119 GK5 glycerol kinase 5 (putative) 2 2
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668346 STXBP2 syntaxin binding protein 2 2 2
MIRT668509 ESYT2 extended synaptotagmin 2 2 2
MIRT669291 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669778 CNDP1 carnosine dipeptidase 1 2 2
MIRT669858 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670177 CCDC142 coiled-coil domain containing 142 2 2
MIRT671107 ZNF841 zinc finger protein 841 2 2
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671476 FLYWCH2 FLYWCH family member 2 2 2
MIRT671492 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672196 F2 coagulation factor II, thrombin 2 2
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672252 SIK2 salt inducible kinase 2 2 2
MIRT672290 GP2 glycoprotein 2 2 2
MIRT672430 POLR2D RNA polymerase II subunit D 2 2
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672901 KRBA2 KRAB-A domain containing 2 2 2
MIRT672958 ZNF655 zinc finger protein 655 2 2
MIRT673096 SYNPO2L synaptopodin 2 like 2 2
MIRT673171 TMEM56 transmembrane protein 56 2 2
MIRT673251 INO80 INO80 complex subunit 2 2
MIRT673296 RNF19B ring finger protein 19B 2 2
MIRT673574 KDELC2 KDEL motif containing 2 2 2
MIRT673586 KIF1C kinesin family member 1C 2 2
MIRT673737 TCF23 transcription factor 23 2 2
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674283 NAGK N-acetylglucosamine kinase 2 2
MIRT674338 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674517 PRR23A proline rich 23A 2 2
MIRT675100 SNTB2 syntrophin beta 2 2 2
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675223 CLK4 CDC like kinase 4 2 2
MIRT675263 ZNF431 zinc finger protein 431 2 2
MIRT675577 WWC1 WW and C2 domain containing 1 2 2
MIRT676025 C9orf69 transmembrane protein 250 2 2
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678576 TMEM168 transmembrane protein 168 2 2
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680344 ZNF281 zinc finger protein 281 2 2
MIRT680467 C3 complement C3 2 2
MIRT682826 FLG2 filaggrin family member 2 2 2
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685275 KIAA1143 KIAA1143 2 2
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT687526 NASP nuclear autoantigenic sperm protein 2 2
MIRT691760 BCL2L15 BCL2 like 15 2 2
MIRT693890 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699342 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699909 RUNDC1 RUN domain containing 1 2 2
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702174 LYRM4 LYR motif containing 4 2 2
MIRT706205 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706659 RNF216 ring finger protein 216 2 2
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706705 GPR155 G protein-coupled receptor 155 2 2
MIRT706777 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706863 MAFF MAF bZIP transcription factor F 2 2
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706916 THAP6 THAP domain containing 6 2 2
MIRT706962 FANCC Fanconi anemia complementation group C 2 2
MIRT706980 XPO5 exportin 5 2 2
MIRT707015 RRP36 ribosomal RNA processing 36 2 2
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707072 MED29 mediator complex subunit 29 2 2
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT724198 MED7 mediator complex subunit 7 2 2
MIRT725403 KIF6 kinesin family member 6 2 2
MIRT733035 COL4A2 collagen type IV alpha 2 chain 1 0
MIRT733036 COL26A1 collagen type XXVI alpha 1 chain 1 0
MIRT733426 PLK1 polo like kinase 1 3 0
MIRT734484 PLD1 phospholipase D1 3 0
MIRT736044 CBL Cbl proto-oncogene 3 0
Error report submission
Your e-Mail*