miRTarBase - #MIRT635322 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BMS1   
Synonyms ACC, BMS1L
Description BMS1, ribosome biogenesis factor
Transcript NM_014753   
Expression
Putative miRNA Targets on BMS1
3'UTR of BMS1
(miRNA target sites are highlighted)
>BMS1|NM_014753|3'UTR
   1 GCCTTTGGACTGGAGGGACTGTCCCTGGATCTGCGGAGGTAGACAGTTTCAAACATCACAGTTTGAATGCCTGTGAATGA
  81 CAAGTCAGTGGGAAAGAGCTCAAGAGATGTCTCTACTCAAACTGTGCCTGCAGGAGGAGGAACAGAGAAGCCTGGGCTGC
 161 TGGGACTGGGTTCATTCTCATGACTTGGGGCTGTCGAGATTTAAAGTGATGTAAGCTGTGGTTATGTGGATTCTCTTACT
 241 TTCCTCTGCCTGCCTCAGTTTAATTATTTTGTCCTACAGAAATATCATTAAAATATTTTTTTGTTACTTTTGGCTTAGTA
 321 GTTTTCATTAGGGATGAATGCCTGACAATTCTTTGTGGATAATTATTTATACTACCACCTTCATGAGGAGTCTTCCAGAA
 401 GAGAAAGAAATATTCACTTGAACTCTGAGCTCCCATGGAAGATTTTAGAGAATAGTGTGTAGTGTTTTTGTTTTGTTTTT
 481 TGTTTGAGTGACACACAAACCTAGATGGTACAGCCTACTGTGCACCCAGGATCTATGGGCTCCTTTGATCACTGGCCCTT
 561 GTGGACATTTTCTATCTTATTTCATATGTTCTGCACATTAGTATAGTGACAAGGTAACAGTAAGTACTTTTTTAAAGCTT
 641 TAGACTTAGGAGATTATTGTCTCAGGTGCAGAGACCAAGGAAATCGTATGTATCAGTGAGATAGGCTTCCCGTATTATGC
 721 TCATGCGTTATACCTGCCTAGCTACATTGCCTTTTTTTAAATTAAACATTATGTTGAAGTAATCATACTATTACATAGGC
 801 GATGTATGTATTTTATGATTGTATGTTGATATAGTTATGGGGAATCTATTCCTATACGATGTAATCATAGATTCACATAT
 881 AGTTGTATATTTTGCCCAATTTCTCTCAGTGGTAATGTTTCACACATATAACAATCAGGATGTTGACATCAATACAGCCC
 961 GCTGATTTTATTCACATTTCCCCAGCTTTACTTTCCCCAACGTATACTCCTCCATGTATGCATGGGTGTGTAGAAATATG
1041 GAACGCAGCTGGGCACAGTGACTCACGCCTGTAATCCCAGCACTTTGGGATGCTAAGGCAGGAGGATCACTTGAGCCCAG
1121 GAATTTGAGACCAACTTGGGCAACATGGCAAAACCTCATCGCTACAAAAAATAAAAAATTCGCCAGGTGTGGTGGGTGCA
1201 CACCTGTAGTTCCAGCTGCTTGGGAGGCTGAGGTAGGAGGATCACTTGAGCTTGGGAGGTTGAGGCTGCAGTGAGCCATG
1281 ATAGCACCACTGCACTCCAGCCTGGGCGACAGGGCAAGACCCTGTTTCAAAAAAAAAAAATTATACATATATGTATGTAG
1361 AACACTTCATGAATTTGTGTGTCATCTGTGCATGGGGCCCATGCTGACCTCTGTGTTGTGCCAGTTATAGTATGTGTGCT
1441 GCTGATATGAGTGCCACATTGCCTTTACAACATCATAGGGGCCAAAGAGGGTTGGCAGGATTATGAGCAGTTGGCCTAGT
1521 CTGAGAGGCTCTCTAAAAGCCTAAAGTCTGTAGGCAGGTGCTCAGCTTTGTATCTCCATAAGAAGGGAAGAGGATGTGAG
1601 GATCCTGTCAGGGCTAGGTCCACCTGGGAAGTGACAATTGGAACACTCCCAGACCTCTCTGGGCAACTCTGGGTGTACAT
1681 TTTCCTCTGTTCCTCAAGAGCTATTATGAATTTCATCATCCATTATGCTGATAGGCCTGGGGACTGACACATAGTAAGCC
1761 CATAACAATTATAATTTAAAACTAATTTGTTATATAGCATAATTGATATATTTTAAAATGCAAAACTATAATTCAACTAA
1841 AATATACAAGGCACTCAAGTCATACCATGTTTTAAGTAGCTTACAAGGTGATCAGCAAGTGTCTTATACAACAAGCAAAT
1921 TTGTTCAAAGAGAAGCATTGCAAATAAGTATTTATAATTGTATAGTTTTATATTTTAGCCAGAAGAGTGGAATCCTTTAG
2001 CAATGGGGGAAATAAAAGAATGTTTAATTACAGTTGCAGATAATTGCCTTTTCCAAAGACAATGTATGTAGGCAGAACTC
2081 ATACCTGTTAATATTAAAAATCTTGGTTTATCATATTTGGAGAACAAGGGAAATAAAAAGTTTGCATATTAAGATTATTT
2161 AAACTAAAGTTAAGGAATCTCTAATGTCTGAAAGAAACAATAAATAGCATTTTTCATGTAGAATTTTTATTGGTGAAGGT
2241 TCCACCTGGCCAGGTTAGTAAAATACAGTCACACATCAGTTAAGGATGGGGATATATTCTGAGAAATGTATCATTAGGCA
2321 ATTTTGTCATTGTGTAAACATCATAGAGTGACACACAAACCTAGATGGTACAGCCTACTGTGCACCTGGGCTCTATGGTA
2401 TGGCCTGTTGCTCCTAGGCTACAAACCTGGGCAGCATGTGACTGTACTGACTACTGTAGGCAGTTGTAACACAGTGGTAA
2481 ACATTTGTGTATCGAAACATAGAAAAGGCGTAGCAAAAATACAGTATTGTGGAACCACTGCCATATACGTGGTCCATCCT
2561 TGACTGAACATCATGCGGCATGTGGCTGTATGTATACACATAGTTTTTGCTGTGAGTTTGCATCCATCTCATAGGAAGAC
2641 ATATATCAAAATAAGGACCAGACTGGAGAGTGTGTAAATTACTTTTCAATACTAATGGCTTATTAATTTGATATTGTCAG
2721 CAAGTATGTTGCAAAAACAAATTCCACCAGAATGTGAGTTCCATGAGAGCAGGAACTGGGTTGTTCACCTTGTTGGCACT
2801 TGGAGTAGAGCCACTGAGCTTCGTGCTGCATAAAATTGCTTGGAAGAAAGAAGGGAGGGCATTCCAGGTAACTGAAGCAT
2881 TGCTATGCAAAGTAAGCATTTGCCCTCTGAAATATTTTAACAATGTTTATAGAAACCTTTCTCAATTGTATTAAACTTTG
2961 TAAATTGTAAAAATTATTCTGTTATACCTTTTCTATTTACTAGGCACAGGCAGCCATAGGTGCTAGGTATGTTTTGAAAA
3041 CATATTGAACCTACAGTGTACATATCATTCCATGCCATTAAATATTCTTATTTAATCATAGATGTGTTCAGGTGTGTTTG
3121 GTTTCCTATTTGTGGATGTACTAGATTGTTTTCTTTTTTTAACAAAACCTGTGAACTTGCTTTAAGTATTATCATTTGGT
3201 GACATGCCCGCCATTTCAGAAATAAATGTTTGAGCAAAGAGGAAAGCCACCGGGTCTGATTCAGCTCTCTGGAGGCTCCA
3281 GAGCTTACCTCGCTGATGGGAAAAAGAGCATCGATTTAATTGCCCTTGGTACCGACTTCTAGTATCTAGTATTTTGCCAG
3361 ACTCAGGTATTTCTTAAAGCCATTATTCAGAGTCTTCAGCAAGGACATTGTATTTTACTTGTGTCTCCTTAGTTTTACCT
3441 AGTTTATTTCATGGTTTTAAAGTATTGTACATTTTTATAATCCTTTAACAAGACAAAAGGTTGAGATGTTGGACATTTAA
3521 ATGCCAAAGGTGTTTTATTATGAGACTTAGCATTTCATATTTGGGGATGGTACCTTATCGAAAATCAGATAAACTTTGGT
3601 TGGATGGGTATTTGGAGGAATCTTTTAAGTCTTTTCTTAAGCAAAGTTTGGACACTCTAAAATAAGGTTGCCAACTGGCA
3681 TGTAGAGAGAAAAGGATGTGTCATACATTTAGACCAGGTGGCCTGTCCTGTAAATTTTTTTGAGGGGAGGGGTGGGCTTG
3761 TTTTTTTCTGTGTTTCGGTTTTTTCCAATTTTTGTTTTGTGATAAAATATGCATAATAAAACTTATTTTATCAATTTTTA
3841 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               || ||||  ||||||| 
Target 5' aagtgACAATTGGAACACTCCc 3'
1629 - 1650 161.00 -15.00
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:||||| |   :|||||| 
Target 5' atAGCACCACT---GCACTCCa 3'
1281 - 1299 145.00 -19.20
3
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              | |||  || |:||||| 
Target 5' ctttCCCCAACGT-ATACTCCt 3'
991 - 1011 137.00 -12.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28677105 84 COSMIC
COSN30122722 85 COSMIC
COSN6970583 108 COSMIC
COSN6071434 362 COSMIC
COSN20107047 476 COSMIC
COSN1489244 687 COSMIC
COSN8185379 930 COSMIC
COSN6970584 1230 COSMIC
COSN8933038 1983 COSMIC
COSN10067806 2146 COSMIC
COSN10067807 2151 COSMIC
COSN20107048 2164 COSMIC
COSN20092107 2215 COSMIC
COSN20092108 2216 COSMIC
COSN8530570 2233 COSMIC
COSN24831388 2316 COSMIC
COSN1489245 2395 COSMIC
COSN28550605 2408 COSMIC
COSN28583332 2473 COSMIC
COSN6970585 2550 COSMIC
COSN22854673 2590 COSMIC
COSN26747360 2787 COSMIC
COSN20107049 3154 COSMIC
COSN17444688 3208 COSMIC
COSN17447962 3210 COSMIC
COSN20792802 3262 COSMIC
COSN20107050 3306 COSMIC
COSN17448681 3469 COSMIC
COSN23987591 3504 COSMIC
COSN17182767 3524 COSMIC
COSN17446870 3552 COSMIC
COSN19379595 3577 COSMIC
COSN15682220 3758 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1405456297 2 dbSNP
rs1302350794 3 dbSNP
rs1329128117 4 dbSNP
rs748726412 9 dbSNP
rs770419053 10 dbSNP
rs774325018 12 dbSNP
rs745777353 13 dbSNP
rs1293266721 15 dbSNP
rs1438958004 26 dbSNP
rs189690445 26 dbSNP
rs924261180 35 dbSNP
rs375869684 36 dbSNP
rs183020555 41 dbSNP
rs1265793068 43 dbSNP
rs1430896999 52 dbSNP
rs775100340 53 dbSNP
rs1171819777 57 dbSNP
rs1426209456 58 dbSNP
rs1329694330 61 dbSNP
rs1191387003 65 dbSNP
rs990276874 78 dbSNP
rs7133 84 dbSNP
rs1284328950 85 dbSNP
rs1347893432 92 dbSNP
rs932436097 97 dbSNP
rs1217392905 100 dbSNP
rs1253023026 101 dbSNP
rs1267866777 108 dbSNP
rs546445947 111 dbSNP
rs551851907 114 dbSNP
rs1302119937 118 dbSNP
rs1225557409 119 dbSNP
rs1343894368 129 dbSNP
rs1050942832 131 dbSNP
rs564752455 139 dbSNP
rs554284112 144 dbSNP
rs939907458 146 dbSNP
rs1221412261 181 dbSNP
rs1036976896 186 dbSNP
rs796312908 191 dbSNP
rs1198351892 194 dbSNP
rs898477334 196 dbSNP
rs995535184 197 dbSNP
rs1372573715 211 dbSNP
rs1256608814 219 dbSNP
rs1205678843 223 dbSNP
rs1475815934 228 dbSNP
rs187978682 234 dbSNP
rs895235602 245 dbSNP
rs145068378 253 dbSNP
rs1337876030 263 dbSNP
rs1025091132 268 dbSNP
rs1391277041 274 dbSNP
rs1304076835 277 dbSNP
rs373961821 282 dbSNP
rs192972007 291 dbSNP
rs1380568305 295 dbSNP
rs776211807 302 dbSNP
rs966872156 304 dbSNP
rs1470678363 310 dbSNP
rs59335833 322 dbSNP
rs1032568018 333 dbSNP
rs183373416 335 dbSNP
rs989833876 336 dbSNP
rs920966784 343 dbSNP
rs1156694932 349 dbSNP
rs1418385398 351 dbSNP
rs953810195 356 dbSNP
rs143662849 370 dbSNP
rs1185428094 376 dbSNP
rs1460025193 379 dbSNP
rs1227439527 382 dbSNP
rs912383491 382 dbSNP
rs1259294585 389 dbSNP
rs1238784818 401 dbSNP
rs1317975350 402 dbSNP
rs1271462176 405 dbSNP
rs1356766713 407 dbSNP
rs867420799 408 dbSNP
rs1317764739 412 dbSNP
rs1244856637 414 dbSNP
rs939856924 416 dbSNP
rs1292189155 418 dbSNP
rs1382390316 419 dbSNP
rs1036923000 420 dbSNP
rs1490798586 421 dbSNP
rs554466519 444 dbSNP
rs1260881197 445 dbSNP
rs543087136 449 dbSNP
rs1442760581 450 dbSNP
rs1384639335 451 dbSNP
rs1195363909 454 dbSNP
rs1448889775 457 dbSNP
rs1259933331 460 dbSNP
rs147538396 466 dbSNP
rs369849154 466 dbSNP
rs895172200 471 dbSNP
rs1294450768 476 dbSNP
rs1359381147 480 dbSNP
rs1313684810 483 dbSNP
rs1227521791 489 dbSNP
rs1327767097 493 dbSNP
rs1444206322 499 dbSNP
rs1013659129 501 dbSNP
rs1046483157 502 dbSNP
rs902660979 520 dbSNP
rs1422627807 524 dbSNP
rs1364895389 534 dbSNP
rs999655752 536 dbSNP
rs1452010416 538 dbSNP
rs1288660778 540 dbSNP
rs1032516225 541 dbSNP
rs1386263004 541 dbSNP
rs958311048 553 dbSNP
rs1384445273 554 dbSNP
rs551992554 557 dbSNP
rs1353411159 569 dbSNP
rs1271435404 573 dbSNP
rs1321948287 575 dbSNP
rs996863726 580 dbSNP
rs1198138254 584 dbSNP
rs1027973718 586 dbSNP
rs1267951386 589 dbSNP
rs753156134 594 dbSNP
rs1402886130 598 dbSNP
rs1344705796 605 dbSNP
rs1329452479 615 dbSNP
rs758660163 625 dbSNP
rs1411632033 628 dbSNP
rs1451456033 632 dbSNP
rs953869220 646 dbSNP
rs1167430177 647 dbSNP
rs1470401870 650 dbSNP
rs1315377444 669 dbSNP
rs1323158798 670 dbSNP
rs570409410 672 dbSNP
rs537699911 686 dbSNP
rs764654311 687 dbSNP
rs912329659 689 dbSNP
rs1253068949 691 dbSNP
rs961167368 693 dbSNP
rs1436605361 703 dbSNP
rs760609164 706 dbSNP
rs1194744625 710 dbSNP
rs1206874549 712 dbSNP
rs111535934 713 dbSNP
rs1221380331 715 dbSNP
rs1460976019 719 dbSNP
rs1184308627 724 dbSNP
rs757706789 727 dbSNP
rs1245128110 728 dbSNP
rs1328187505 739 dbSNP
rs931238528 742 dbSNP
rs1408458952 743 dbSNP
rs568406071 744 dbSNP
rs1174538599 745 dbSNP
rs1469516984 747 dbSNP
rs61844834 751 dbSNP
rs1409113863 752 dbSNP
rs1417591168 752 dbSNP
rs75734052 753 dbSNP
rs1055481613 759 dbSNP
rs1468995463 768 dbSNP
rs1232824214 770 dbSNP
rs916561934 770 dbSNP
rs1461377860 773 dbSNP
rs949427632 776 dbSNP
rs1455779030 780 dbSNP
rs1201364386 788 dbSNP
rs1322426058 791 dbSNP
rs1174988823 792 dbSNP
rs1403247666 800 dbSNP
rs556753780 801 dbSNP
rs1278870177 802 dbSNP
rs766237583 802 dbSNP
rs1246706445 803 dbSNP
rs1385042365 816 dbSNP
rs1259873578 820 dbSNP
rs113925789 830 dbSNP
rs1346017598 836 dbSNP
rs1380832203 838 dbSNP
rs1320625958 839 dbSNP
rs113721691 840 dbSNP
rs902607196 847 dbSNP
rs1164744308 849 dbSNP
rs999603273 853 dbSNP
rs1053873034 855 dbSNP
rs1230140253 858 dbSNP
rs866315631 859 dbSNP
rs1242347775 865 dbSNP
rs996422990 868 dbSNP
rs745900615 872 dbSNP
rs1445061252 873 dbSNP
rs1283343673 877 dbSNP
rs866848252 877 dbSNP
rs1223104611 879 dbSNP
rs754723410 880 dbSNP
rs1322743123 881 dbSNP
rs1204342207 885 dbSNP
rs187249437 888 dbSNP
rs1265103929 900 dbSNP
rs1479768990 906 dbSNP
rs1245357086 908 dbSNP
rs1362820608 929 dbSNP
rs775570502 930 dbSNP
rs756385676 939 dbSNP
rs1421308176 942 dbSNP
rs1427062737 945 dbSNP
rs953711001 951 dbSNP
rs1161062316 953 dbSNP
rs1422712070 960 dbSNP
rs1197729983 961 dbSNP
rs7894010 962 dbSNP
rs1474250007 973 dbSNP
rs1019336971 981 dbSNP
rs1262140210 982 dbSNP
rs961114744 985 dbSNP
rs748039271 987 dbSNP
rs545808971 992 dbSNP
rs1176452874 998 dbSNP
rs138984886 1001 dbSNP
rs200669494 1001 dbSNP
rs540030619 1002 dbSNP
rs1212979524 1003 dbSNP
rs1361568694 1005 dbSNP
rs1284250694 1013 dbSNP
rs192177467 1015 dbSNP
rs773082624 1023 dbSNP
rs56085448 1027 dbSNP
rs1354587940 1031 dbSNP
rs982074689 1033 dbSNP
rs544056025 1046 dbSNP
rs555801111 1067 dbSNP
rs751827844 1068 dbSNP
rs1199771616 1069 dbSNP
rs1481293239 1071 dbSNP
rs1303462346 1072 dbSNP
rs1266563333 1083 dbSNP
rs1305907857 1087 dbSNP
rs150912444 1098 dbSNP
rs541448846 1101 dbSNP
rs1234634659 1103 dbSNP
rs1252048974 1120 dbSNP
rs1053820947 1122 dbSNP
rs200191310 1125 dbSNP
rs893952627 1131 dbSNP
rs1225648780 1140 dbSNP
rs932156477 1147 dbSNP
rs1301073374 1148 dbSNP
rs1268649807 1149 dbSNP
rs1392428864 1155 dbSNP
rs1481035954 1161 dbSNP
rs554975459 1162 dbSNP
rs560178170 1166 dbSNP
rs1399003883 1170 dbSNP
rs1175134579 1173 dbSNP
rs1176670066 1173 dbSNP
rs1426887149 1173 dbSNP
rs1419535530 1179 dbSNP
rs1009193592 1182 dbSNP
rs1426165946 1183 dbSNP
rs1019282938 1187 dbSNP
rs1243865439 1189 dbSNP
rs758947811 1202 dbSNP
rs866750685 1203 dbSNP
rs767821545 1209 dbSNP
rs1373252347 1210 dbSNP
rs1240227569 1217 dbSNP
rs1319168332 1224 dbSNP
rs773593815 1233 dbSNP
rs1240114818 1234 dbSNP
rs1375495703 1247 dbSNP
rs527429837 1252 dbSNP
rs6593498 1254 dbSNP
rs563897298 1255 dbSNP
rs1403449650 1261 dbSNP
rs1301981037 1286 dbSNP
rs1454107634 1293 dbSNP
rs952541985 1294 dbSNP
rs1156795608 1298 dbSNP
rs111735060 1300 dbSNP
rs991063444 1303 dbSNP
rs531418287 1308 dbSNP
rs775002226 1309 dbSNP
rs1344520834 1314 dbSNP
rs1244114170 1321 dbSNP
rs1206015939 1324 dbSNP
rs1291456275 1328 dbSNP
rs112489895 1329 dbSNP
rs1259389623 1329 dbSNP
rs1360835919 1329 dbSNP
rs528985968 1329 dbSNP
rs55818372 1329 dbSNP
rs200736724 1330 dbSNP
rs1247555051 1331 dbSNP
rs1490634009 1336 dbSNP
rs1311561445 1340 dbSNP
rs1224261028 1342 dbSNP
rs1382470557 1343 dbSNP
rs1240798727 1346 dbSNP
rs1386841351 1346 dbSNP
rs1296136724 1348 dbSNP
rs1366119448 1352 dbSNP
rs923924085 1353 dbSNP
rs1442854818 1361 dbSNP
rs1485847135 1364 dbSNP
rs550019246 1365 dbSNP
rs1430547892 1367 dbSNP
rs1185385336 1371 dbSNP
rs201656232 1376 dbSNP
rs989552744 1391 dbSNP
rs1419673482 1402 dbSNP
rs1294567746 1410 dbSNP
rs1450911357 1416 dbSNP
rs915321092 1417 dbSNP
rs1264397788 1427 dbSNP
rs11239788 1429 dbSNP
rs890662223 1430 dbSNP
rs764458214 1435 dbSNP
rs1036640115 1446 dbSNP
rs76027098 1448 dbSNP
rs1343321882 1449 dbSNP
rs993840700 1450 dbSNP
rs547513334 1453 dbSNP
rs1463664505 1471 dbSNP
rs139691694 1475 dbSNP
rs1170311657 1477 dbSNP
rs55930857 1479 dbSNP
rs888189542 1481 dbSNP
rs184516095 1488 dbSNP
rs1427611973 1489 dbSNP
rs6593499 1494 dbSNP
rs1451554803 1495 dbSNP
rs570229506 1504 dbSNP
rs1003390225 1507 dbSNP
rs537269365 1511 dbSNP
rs556005304 1512 dbSNP
rs1255755931 1529 dbSNP
rs956672748 1533 dbSNP
rs1284983556 1536 dbSNP
rs1434163643 1537 dbSNP
rs1360448657 1543 dbSNP
rs142626723 1544 dbSNP
rs1393203278 1545 dbSNP
rs541804716 1548 dbSNP
rs748647303 1549 dbSNP
rs1170198598 1551 dbSNP
rs1316821513 1554 dbSNP
rs915286502 1555 dbSNP
rs1171222546 1557 dbSNP
rs953579544 1559 dbSNP
rs986261649 1560 dbSNP
rs1184674394 1562 dbSNP
rs1439013946 1565 dbSNP
rs566352907 1567 dbSNP
rs1235882675 1569 dbSNP
rs865927782 1573 dbSNP
rs756140823 1575 dbSNP
rs553303239 1576 dbSNP
rs1264704144 1579 dbSNP
rs1242069608 1581 dbSNP
rs1217283097 1588 dbSNP
rs1344113684 1595 dbSNP
rs1280064045 1618 dbSNP
rs1241144150 1620 dbSNP
rs1374733013 1623 dbSNP
rs1330787999 1630 dbSNP
rs1472939872 1634 dbSNP
rs912047516 1637 dbSNP
rs1332541312 1638 dbSNP
rs1414248564 1639 dbSNP
rs772606275 1640 dbSNP
rs944875461 1642 dbSNP
rs1160775805 1647 dbSNP
rs1235465138 1650 dbSNP
rs1438410615 1652 dbSNP
rs1377905499 1656 dbSNP
rs1282934213 1674 dbSNP
rs1036581474 1686 dbSNP
rs1238835941 1688 dbSNP
rs1207674045 1701 dbSNP
rs1405577723 1704 dbSNP
rs113604728 1707 dbSNP
rs780378327 1708 dbSNP
rs112367237 1715 dbSNP
rs930949492 1721 dbSNP
rs113134183 1724 dbSNP
rs1351456077 1731 dbSNP
rs571717081 1732 dbSNP
rs1246819724 1739 dbSNP
rs545456936 1740 dbSNP
rs1385156716 1743 dbSNP
rs1447638134 1752 dbSNP
rs1390907391 1753 dbSNP
rs1048526857 1759 dbSNP
rs1418338600 1760 dbSNP
rs888145739 1761 dbSNP
rs1468238957 1763 dbSNP
rs563858188 1767 dbSNP
rs1415385439 1773 dbSNP
rs1179724155 1776 dbSNP
rs1044809647 1778 dbSNP
rs1242443546 1783 dbSNP
rs796420339 1784 dbSNP
rs1195577804 1789 dbSNP
rs1487234070 1790 dbSNP
rs1285201743 1795 dbSNP
rs1383743395 1799 dbSNP
rs1361653784 1804 dbSNP
rs1287842933 1809 dbSNP
rs1450528497 1819 dbSNP
rs1227919599 1825 dbSNP
rs1362927465 1829 dbSNP
rs1278116985 1834 dbSNP
rs531377687 1846 dbSNP
rs1373142999 1847 dbSNP
rs1398532764 1853 dbSNP
rs1340375278 1877 dbSNP
rs1304253307 1882 dbSNP
rs1224815518 1883 dbSNP
rs1270517295 1897 dbSNP
rs1351062938 1902 dbSNP
rs906345066 1906 dbSNP
rs189352007 1907 dbSNP
rs1030838324 1908 dbSNP
rs778672762 1910 dbSNP
rs1476715485 1912 dbSNP
rs1261988759 1938 dbSNP
rs1262253760 1941 dbSNP
rs150155375 1944 dbSNP
rs1489441653 1945 dbSNP
rs1387246714 1949 dbSNP
rs116806586 1963 dbSNP
rs1469487929 1965 dbSNP
rs564931760 1966 dbSNP
rs953428981 1970 dbSNP
rs1479430613 1971 dbSNP
rs1317662441 1973 dbSNP
rs1284346338 1974 dbSNP
rs1175778206 1977 dbSNP
rs1225843601 1980 dbSNP
rs986598507 1984 dbSNP
rs911993741 1988 dbSNP
rs192276563 1997 dbSNP
rs1354676910 2005 dbSNP
rs1416378828 2006 dbSNP
rs1327174035 2010 dbSNP
rs146561334 2012 dbSNP
rs1463756606 2019 dbSNP
rs533383238 2020 dbSNP
rs1422603491 2022 dbSNP
rs919459231 2029 dbSNP
rs1422961443 2031 dbSNP
rs1443297550 2033 dbSNP
rs1480984985 2034 dbSNP
rs930878601 2041 dbSNP
rs1049339167 2042 dbSNP
rs1457504698 2050 dbSNP
rs1264067863 2061 dbSNP
rs909512726 2063 dbSNP
rs947758465 2065 dbSNP
rs148650517 2079 dbSNP
rs1223492792 2103 dbSNP
rs1376963866 2109 dbSNP
rs1310855845 2118 dbSNP
rs1044761380 2122 dbSNP
rs1345190245 2134 dbSNP
rs906295916 2135 dbSNP
rs1337052739 2144 dbSNP
rs139700940 2146 dbSNP
rs112772563 2151 dbSNP
rs184669749 2154 dbSNP
rs1357257425 2159 dbSNP
rs1175250683 2160 dbSNP
rs147817749 2161 dbSNP
rs771877607 2167 dbSNP
rs1253771289 2169 dbSNP
rs570192457 2170 dbSNP
rs61844835 2177 dbSNP
rs1378268524 2178 dbSNP
rs1243958562 2179 dbSNP
rs1052214258 2182 dbSNP
rs1166236838 2186 dbSNP
rs1255820612 2207 dbSNP
rs1382268047 2215 dbSNP
rs1298415901 2216 dbSNP
rs1217069051 2225 dbSNP
rs1310211547 2232 dbSNP
rs200513807 2233 dbSNP
rs892329133 2234 dbSNP
rs1287470391 2239 dbSNP
rs746787178 2244 dbSNP
rs189477587 2251 dbSNP
rs370679442 2255 dbSNP
rs1312953293 2257 dbSNP
rs1397471292 2270 dbSNP
rs1376641461 2271 dbSNP
rs181530913 2278 dbSNP
rs185790096 2280 dbSNP
rs1362387674 2283 dbSNP
rs1234733995 2291 dbSNP
rs777741300 2292 dbSNP
rs1267923534 2295 dbSNP
rs1385981944 2296 dbSNP
rs143772750 2309 dbSNP
rs188893120 2314 dbSNP
rs373802404 2314 dbSNP
rs766599026 2314 dbSNP
rs1255829410 2330 dbSNP
rs1228736591 2333 dbSNP
rs1276511732 2339 dbSNP
rs571679489 2340 dbSNP
rs1489509607 2343 dbSNP
rs1357090068 2345 dbSNP
rs61844836 2356 dbSNP
rs1216575506 2358 dbSNP
rs1352307205 2359 dbSNP
rs999116144 2374 dbSNP
rs1265541971 2387 dbSNP
rs35229973 2394 dbSNP
rs398013299 2394 dbSNP
rs771144515 2395 dbSNP
rs1311669897 2397 dbSNP
rs1400364347 2404 dbSNP
rs376555236 2408 dbSNP
rs1241642681 2415 dbSNP
rs1450287282 2438 dbSNP
rs1296231789 2445 dbSNP
rs1007560173 2453 dbSNP
rs1391479239 2454 dbSNP
rs1175618964 2458 dbSNP
rs746750905 2471 dbSNP
rs73254277 2473 dbSNP
rs1368104689 2475 dbSNP
rs36021243 2492 dbSNP
rs539072624 2492 dbSNP
rs966110197 2494 dbSNP
rs117397195 2495 dbSNP
rs562520454 2499 dbSNP
rs201215639 2511 dbSNP
rs1490666555 2517 dbSNP
rs1267352835 2522 dbSNP
rs1381071115 2523 dbSNP
rs1315575790 2525 dbSNP
rs1264485970 2537 dbSNP
rs952262221 2541 dbSNP
rs1363913458 2544 dbSNP
rs1276095987 2547 dbSNP
rs1435351079 2549 dbSNP
rs1331624915 2550 dbSNP
rs1325512416 2552 dbSNP
rs985417166 2566 dbSNP
rs181628192 2571 dbSNP
rs1332273718 2574 dbSNP
rs947673419 2576 dbSNP
rs1421888975 2577 dbSNP
rs376992587 2578 dbSNP
rs1265832038 2579 dbSNP
rs927670350 2583 dbSNP
rs1358348186 2586 dbSNP
rs939093275 2596 dbSNP
rs1283639760 2600 dbSNP
rs1465445898 2601 dbSNP
rs1052159284 2602 dbSNP
rs1266112834 2603 dbSNP
rs1190608473 2617 dbSNP
rs892271193 2623 dbSNP
rs1241446961 2627 dbSNP
rs543598244 2631 dbSNP
rs561686793 2637 dbSNP
rs1188654540 2638 dbSNP
rs1370604022 2642 dbSNP
rs1345534672 2643 dbSNP
rs113190084 2645 dbSNP
rs1231044216 2646 dbSNP
rs889035002 2648 dbSNP
rs1158559601 2659 dbSNP
rs1390042801 2662 dbSNP
rs1398389140 2664 dbSNP
rs541301535 2671 dbSNP
rs34879863 2678 dbSNP
rs1404847898 2683 dbSNP
rs1415396607 2683 dbSNP
rs1018943595 2686 dbSNP
rs1322011501 2690 dbSNP
rs147323016 2695 dbSNP
rs901868201 2696 dbSNP
rs533343692 2702 dbSNP
rs993555131 2703 dbSNP
rs1313117683 2715 dbSNP
rs201579421 2720 dbSNP
rs1026409465 2723 dbSNP
rs1235974937 2727 dbSNP
rs1177670390 2730 dbSNP
rs1442768173 2732 dbSNP
rs1280503201 2741 dbSNP
rs369096840 2743 dbSNP
rs1342108056 2745 dbSNP
rs952275536 2752 dbSNP
rs1286751459 2753 dbSNP
rs1242394415 2760 dbSNP
rs1374856418 2765 dbSNP
rs1308765781 2768 dbSNP
rs1236775105 2770 dbSNP
rs1287583229 2772 dbSNP
rs551835039 2773 dbSNP
rs984978270 2780 dbSNP
rs563764126 2790 dbSNP
rs1261396783 2799 dbSNP
rs970330034 2804 dbSNP
rs1161045124 2807 dbSNP
rs981690211 2814 dbSNP
rs1377999357 2816 dbSNP
rs147344587 2823 dbSNP
rs139571775 2824 dbSNP
rs759633717 2827 dbSNP
rs1417648367 2834 dbSNP
rs1238918036 2837 dbSNP
rs1181548494 2840 dbSNP
rs1485258018 2859 dbSNP
rs1263814594 2862 dbSNP
rs939039206 2868 dbSNP
rs1413294137 2873 dbSNP
rs987821544 2885 dbSNP
rs1473872495 2886 dbSNP
rs1160709449 2899 dbSNP
rs1403315138 2908 dbSNP
rs1358745080 2910 dbSNP
rs186413738 2916 dbSNP
rs946497462 2921 dbSNP
rs1300561217 2935 dbSNP
rs1398717921 2944 dbSNP
rs1303122273 2946 dbSNP
rs1358023991 2960 dbSNP
rs1043557959 2962 dbSNP
rs1403924208 2967 dbSNP
rs1389393227 2976 dbSNP
rs1287522560 2985 dbSNP
rs535241880 2986 dbSNP
rs1161168203 2989 dbSNP
rs1474742091 2993 dbSNP
rs888975243 3005 dbSNP
rs1195695328 3008 dbSNP
rs1487286678 3009 dbSNP
rs1230196555 3010 dbSNP
rs1241525441 3012 dbSNP
rs192511896 3017 dbSNP
rs943249223 3020 dbSNP
rs1287954335 3027 dbSNP
rs1228009615 3028 dbSNP
rs1281450938 3037 dbSNP
rs1280522256 3042 dbSNP
rs1318975301 3042 dbSNP
rs1217265287 3043 dbSNP
rs1040330869 3047 dbSNP
rs1294685563 3052 dbSNP
rs901814328 3053 dbSNP
rs763066327 3055 dbSNP
rs993502817 3059 dbSNP
rs1234078693 3063 dbSNP
rs1321154243 3068 dbSNP
rs1257915630 3069 dbSNP
rs1460619119 3071 dbSNP
rs571638873 3075 dbSNP
rs1195545550 3079 dbSNP
rs1253045975 3082 dbSNP
rs1476767662 3085 dbSNP
rs1484302948 3099 dbSNP
rs887867339 3100 dbSNP
rs1191740406 3104 dbSNP
rs1479035445 3105 dbSNP
rs1245076656 3109 dbSNP
rs539035908 3113 dbSNP
rs1458385641 3121 dbSNP
rs1260327427 3129 dbSNP
rs1432033909 3141 dbSNP
rs1023122846 3143 dbSNP
rs1302556349 3147 dbSNP
rs970226500 3148 dbSNP
rs373416943 3149 dbSNP
rs3834412 3149 dbSNP
rs772236100 3149 dbSNP
rs796547541 3150 dbSNP
rs557375429 3152 dbSNP
rs575994375 3168 dbSNP
rs1307148367 3171 dbSNP
rs1371010597 3175 dbSNP
rs1411572919 3183 dbSNP
rs1301155120 3191 dbSNP
rs536709194 3192 dbSNP
rs1463863863 3193 dbSNP
rs1366828858 3195 dbSNP
rs144044483 3196 dbSNP
rs960330665 3202 dbSNP
rs386743151 3207 dbSNP
rs1303532210 3208 dbSNP
rs28508417 3210 dbSNP
rs987770602 3211 dbSNP
rs913591090 3212 dbSNP
rs1275790532 3217 dbSNP
rs1240253430 3227 dbSNP
rs3758517 3227 dbSNP
rs1220733935 3236 dbSNP
rs113881837 3240 dbSNP
rs1256978761 3249 dbSNP
rs1246567202 3253 dbSNP
rs979614034 3255 dbSNP
rs1489111088 3256 dbSNP
rs1191218392 3277 dbSNP
rs1268902785 3282 dbSNP
rs1232911844 3283 dbSNP
rs148664390 3286 dbSNP
rs1167638884 3289 dbSNP
rs910362147 3292 dbSNP
rs559670207 3293 dbSNP
rs1450055067 3297 dbSNP
rs3834411 3301 dbSNP
rs1173002088 3302 dbSNP
rs1420346816 3303 dbSNP
rs79299791 3306 dbSNP
rs1382303320 3307 dbSNP
rs1349183628 3313 dbSNP
rs578029728 3314 dbSNP
rs1257225222 3319 dbSNP
rs1183980256 3321 dbSNP
rs545418783 3328 dbSNP
rs111466868 3334 dbSNP
rs3758516 3335 dbSNP
rs1257427171 3340 dbSNP
rs1218038253 3342 dbSNP
rs113135749 3345 dbSNP
rs1360035019 3347 dbSNP
rs1353737640 3350 dbSNP
rs1287580565 3351 dbSNP
rs1434625458 3357 dbSNP
rs1236347084 3366 dbSNP
rs1047716963 3368 dbSNP
rs1313056319 3381 dbSNP
rs1397555742 3401 dbSNP
rs539614724 3409 dbSNP
rs111545137 3419 dbSNP
rs1353369145 3421 dbSNP
rs76137580 3428 dbSNP
rs1312178735 3440 dbSNP
rs1400564950 3445 dbSNP
rs1289642202 3455 dbSNP
rs1322825287 3466 dbSNP
rs1224516546 3467 dbSNP
rs68092530 3469 dbSNP
rs1306035229 3470 dbSNP
rs1453254193 3477 dbSNP
rs530949819 3484 dbSNP
rs1365962029 3485 dbSNP
rs1369259094 3488 dbSNP
rs1167255240 3489 dbSNP
rs1422404300 3490 dbSNP
rs764090014 3490 dbSNP
rs1463118233 3496 dbSNP
rs75635205 3504 dbSNP
rs1194981556 3505 dbSNP
rs1489558722 3506 dbSNP
rs552853900 3507 dbSNP
rs1450972613 3510 dbSNP
rs1202837578 3517 dbSNP
rs887806282 3531 dbSNP
rs1246592085 3533 dbSNP
rs144884743 3533 dbSNP
rs1006290253 3536 dbSNP
rs1292487994 3545 dbSNP
rs76540874 3552 dbSNP
rs1219095457 3574 dbSNP
rs538351871 3575 dbSNP
rs78983865 3580 dbSNP
rs1456708459 3581 dbSNP
rs1381719361 3589 dbSNP
rs78875545 3605 dbSNP
rs1391044824 3608 dbSNP
rs1450785516 3610 dbSNP
rs1283939788 3611 dbSNP
rs1394119694 3618 dbSNP
rs1044893242 3623 dbSNP
rs1479039793 3632 dbSNP
rs1422100039 3633 dbSNP
rs1193144535 3647 dbSNP
rs182493926 3652 dbSNP
rs1267473519 3655 dbSNP
rs76563616 3656 dbSNP
rs774723260 3667 dbSNP
rs76496801 3669 dbSNP
rs1272252900 3672 dbSNP
rs1199025422 3686 dbSNP
rs80049877 3692 dbSNP
rs1319816134 3694 dbSNP
rs1268313567 3698 dbSNP
rs111627818 3715 dbSNP
rs1035865992 3719 dbSNP
rs1329116196 3720 dbSNP
rs1331712089 3728 dbSNP
rs77161708 3735 dbSNP
rs1010933162 3736 dbSNP
rs1020600106 3751 dbSNP
rs1207503929 3753 dbSNP
rs368206453 3758 dbSNP
rs386743152 3767 dbSNP
rs1041205275 3769 dbSNP
rs1465953084 3771 dbSNP
rs374880471 3775 dbSNP
rs1167789865 3778 dbSNP
rs1467034067 3779 dbSNP
rs1207666253 3784 dbSNP
rs1377636013 3790 dbSNP
rs768075345 3797 dbSNP
rs1452095115 3809 dbSNP
rs1472968415 3810 dbSNP
rs1251987977 3814 dbSNP
rs910309923 3818 dbSNP
rs1270651392 3823 dbSNP
rs1458910090 3823 dbSNP
rs1195087607 3827 dbSNP
rs750877402 3833 dbSNP
rs761183711 3834 dbSNP
rs561460794 3838 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:||||| |   :|||||| 
Target 5' auAGCACCACU---GCACUCCa 3'
2 - 20
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000374518.5 | 3UTR | GAUAGCACCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000374518.5 | 3UTR | AUAGCACCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*