miRTarBase - #MIRT632596 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PDP2   
Synonyms PDPC 2, PPM2B, PPM2C2
Description pyruvate dehyrogenase phosphatase catalytic subunit 2
Transcript NM_020786   
Putative miRNA Targets on PDP2
3'UTR of PDP2
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             :|||||||   :|||||| 
Target 5' atcGCACCATT---GCACTCCa 3'
2030 - 2048 148.00 -21.80
            ||| :|| ||||| ||||| 
2652 - 2672 143.00 -15.50
             :::|||||   :|||||| 
Target 5' atcGTGCCATT---GCACTCCa 3'
4038 - 4056 140.00 -17.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30459762 6 COSMIC
COSN30164064 7 COSMIC
COSN15569227 27 COSMIC
COSN30108730 76 COSMIC
COSN30137177 90 COSMIC
COSN1189482 97 COSMIC
COSN30503697 129 COSMIC
COSN30536543 163 COSMIC
COSN31606649 181 COSMIC
COSN30133114 210 COSMIC
COSN24305504 231 COSMIC
COSN393896 263 COSMIC
COSN30136166 351 COSMIC
COSN15625791 426 COSMIC
COSN30142962 436 COSMIC
COSN30127849 504 COSMIC
COSN31534603 541 COSMIC
COSN20065735 542 COSMIC
COSN31568066 559 COSMIC
COSN26730815 635 COSMIC
COSN28830226 734 COSMIC
COSN15625792 826 COSMIC
COSN26637156 834 COSMIC
COSN30162371 834 COSMIC
COSN28857805 855 COSMIC
COSN20048057 882 COSMIC
COSN31603661 911 COSMIC
COSN15625793 945 COSMIC
COSN31485777 1003 COSMIC
COSN31521121 1028 COSMIC
COSN30112362 1059 COSMIC
COSN30534157 1066 COSMIC
COSN26958026 1115 COSMIC
COSN26566427 1146 COSMIC
COSN15625794 1177 COSMIC
COSN31540137 1183 COSMIC
COSN31553641 1230 COSMIC
COSN31590671 1360 COSMIC
COSN31535033 1479 COSMIC
COSN28796233 1480 COSMIC
COSN31596402 1536 COSMIC
COSN30543197 1569 COSMIC
COSN6092221 1603 COSMIC
COSN23012613 1626 COSMIC
COSN30135497 1686 COSMIC
COSN26639083 1722 COSMIC
COSN30114542 1744 COSMIC
COSN15625795 1765 COSMIC
COSN30163483 1801 COSMIC
COSN31480623 1864 COSMIC
COSN30512479 1877 COSMIC
COSN27450603 2121 COSMIC
COSN16130275 2142 COSMIC
COSN15584243 2183 COSMIC
COSN15584504 2184 COSMIC
COSN32093044 2419 COSMIC
COSN23533759 3697 COSMIC
COSN23359287 3804 COSMIC
COSN1706535 4228 COSMIC
COSN9651324 4379 COSMIC
COSN16331075 4507 COSMIC
COSN29549692 4764 COSMIC
COSN22560877 4830 COSMIC
COSN22926540 5216 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1011146662 4 dbSNP
rs1174792377 5 dbSNP
rs758366996 16 dbSNP
rs541803329 21 dbSNP
rs1160118062 24 dbSNP
rs1380495921 30 dbSNP
rs751132627 30 dbSNP
rs756831474 32 dbSNP
rs201365694 37 dbSNP
rs756443244 38 dbSNP
rs764594294 44 dbSNP
rs1344879047 45 dbSNP
rs1055832224 49 dbSNP
rs1156288251 51 dbSNP
rs1003681399 56 dbSNP
rs1035518059 62 dbSNP
rs1436799302 76 dbSNP
rs1364570077 84 dbSNP
rs894476771 86 dbSNP
rs1480982948 88 dbSNP
rs1380310301 96 dbSNP
rs772772137 97 dbSNP
rs990810119 99 dbSNP
rs1418957237 100 dbSNP
rs1406303632 101 dbSNP
rs1361678984 119 dbSNP
rs1488961421 120 dbSNP
rs1016870730 123 dbSNP
rs555661367 130 dbSNP
rs1045663372 131 dbSNP
rs1286762521 134 dbSNP
rs962641272 135 dbSNP
rs1158628334 138 dbSNP
rs575530494 140 dbSNP
rs544385087 149 dbSNP
rs1219575311 151 dbSNP
rs564255767 152 dbSNP
rs17767794 153 dbSNP
rs1401418487 159 dbSNP
rs918475093 161 dbSNP
rs1287760476 172 dbSNP
rs955384653 174 dbSNP
rs1343933091 179 dbSNP
rs986625127 186 dbSNP
rs1434122429 187 dbSNP
rs1304901057 193 dbSNP
rs1428978943 205 dbSNP
rs1333609323 209 dbSNP
rs998691957 212 dbSNP
rs758081116 214 dbSNP
rs1033225408 225 dbSNP
rs1264043440 226 dbSNP
rs1408959113 233 dbSNP
rs892922188 242 dbSNP
rs1007720705 251 dbSNP
rs1017296172 274 dbSNP
rs1315332682 275 dbSNP
rs777534873 282 dbSNP
rs1241463303 286 dbSNP
rs910989621 287 dbSNP
rs1281086607 288 dbSNP
rs965671724 299 dbSNP
rs942415908 309 dbSNP
rs1340715613 320 dbSNP
rs1294300953 335 dbSNP
rs1380040667 337 dbSNP
rs1054147414 344 dbSNP
rs914240464 350 dbSNP
rs193235873 362 dbSNP
rs1405868108 363 dbSNP
rs1043041637 371 dbSNP
rs951590238 402 dbSNP
rs982976123 404 dbSNP
rs1192676541 412 dbSNP
rs1176984139 421 dbSNP
rs1258308014 425 dbSNP
rs902725215 426 dbSNP
rs557209341 429 dbSNP
rs1004138791 432 dbSNP
rs1056543944 433 dbSNP
rs991962654 434 dbSNP
rs895257431 436 dbSNP
rs915943341 438 dbSNP
rs184521572 443 dbSNP
rs1045738849 446 dbSNP
rs1341769219 447 dbSNP
rs1367328144 451 dbSNP
rs903108980 458 dbSNP
rs1382686968 482 dbSNP
rs1016924375 492 dbSNP
rs1335208735 493 dbSNP
rs528841581 497 dbSNP
rs934564379 510 dbSNP
rs370604800 511 dbSNP
rs573289988 511 dbSNP
rs1167593684 513 dbSNP
rs548474284 521 dbSNP
rs1007336515 532 dbSNP
rs1017319487 532 dbSNP
rs372166645 532 dbSNP
rs994141623 534 dbSNP
rs1025998856 541 dbSNP
rs568387467 543 dbSNP
rs1429089253 545 dbSNP
rs1296175749 546 dbSNP
rs756536680 549 dbSNP
rs780636633 551 dbSNP
rs531026993 554 dbSNP
rs1249496918 567 dbSNP
rs963828920 573 dbSNP
rs1193761244 575 dbSNP
rs550796293 577 dbSNP
rs1382374570 593 dbSNP
rs989892088 594 dbSNP
rs570935684 618 dbSNP
rs951668120 627 dbSNP
rs1307688375 628 dbSNP
rs749694985 630 dbSNP
rs1249286002 631 dbSNP
rs1489144564 633 dbSNP
rs1222665379 637 dbSNP
rs769219321 638 dbSNP
rs749772024 643 dbSNP
rs769308230 647 dbSNP
rs1422042304 648 dbSNP
rs1017127428 657 dbSNP
rs1169935644 658 dbSNP
rs924216572 659 dbSNP
rs991643971 666 dbSNP
rs1426622403 673 dbSNP
rs1269167944 674 dbSNP
rs11861556 676 dbSNP
rs950079232 677 dbSNP
rs1056596615 678 dbSNP
rs1364865736 681 dbSNP
rs1377903256 687 dbSNP
rs1287483779 689 dbSNP
rs981474505 698 dbSNP
rs1243019928 700 dbSNP
rs1403073910 701 dbSNP
rs1300000304 702 dbSNP
rs1362342341 704 dbSNP
rs1213793189 706 dbSNP
rs1237321231 710 dbSNP
rs748292579 712 dbSNP
rs1404512963 715 dbSNP
rs1363842320 717 dbSNP
rs772177177 719 dbSNP
rs28398401 734 dbSNP
rs898554478 735 dbSNP
rs1054766739 741 dbSNP
rs1427778357 750 dbSNP
rs1156681551 754 dbSNP
rs1478890822 763 dbSNP
rs1429687258 769 dbSNP
rs994586638 772 dbSNP
rs1025633652 786 dbSNP
rs1198269366 798 dbSNP
rs1479239755 836 dbSNP
rs914464106 839 dbSNP
rs943213092 840 dbSNP
rs1448138818 845 dbSNP
rs1284201648 846 dbSNP
rs78861024 847 dbSNP
rs1356009225 855 dbSNP
rs1326127217 859 dbSNP
rs1038801182 862 dbSNP
rs901611086 877 dbSNP
rs1343869201 880 dbSNP
rs955498265 896 dbSNP
rs1008146756 904 dbSNP
rs1325859696 909 dbSNP
rs1018156480 911 dbSNP
rs963882005 912 dbSNP
rs1416052412 913 dbSNP
rs1248868335 917 dbSNP
rs189449499 921 dbSNP
rs1406608955 928 dbSNP
rs1338717368 930 dbSNP
rs886088137 931 dbSNP
rs1175405069 936 dbSNP
rs1383622916 938 dbSNP
rs1214455524 941 dbSNP
rs1425313468 942 dbSNP
rs773407815 945 dbSNP
rs1309824450 949 dbSNP
rs1239810111 951 dbSNP
rs1228607774 952 dbSNP
rs535804744 953 dbSNP
rs1191724785 954 dbSNP
rs1463019545 957 dbSNP
rs1264216479 963 dbSNP
rs1203417842 969 dbSNP
rs1321779292 972 dbSNP
rs576539581 982 dbSNP
rs1215346876 990 dbSNP
rs1459653217 993 dbSNP
rs1268470580 994 dbSNP
rs1450175761 995 dbSNP
rs1383438079 1001 dbSNP
rs1021403145 1005 dbSNP
rs1205176103 1007 dbSNP
rs1335912018 1008 dbSNP
rs558692051 1010 dbSNP
rs575642882 1012 dbSNP
rs1170734801 1014 dbSNP
rs1184311263 1022 dbSNP
rs1416815747 1027 dbSNP
rs977514866 1028 dbSNP
rs1447038957 1032 dbSNP
rs962969656 1040 dbSNP
rs928318613 1050 dbSNP
rs1183445744 1055 dbSNP
rs1175431287 1056 dbSNP
rs1460283293 1061 dbSNP
rs1234912764 1062 dbSNP
rs1013504522 1063 dbSNP
rs1426958856 1075 dbSNP
rs538112745 1081 dbSNP
rs1271053669 1088 dbSNP
rs557977062 1093 dbSNP
rs1248251230 1094 dbSNP
rs992377219 1096 dbSNP
rs760952360 1098 dbSNP
rs144226402 1099 dbSNP
rs1243630825 1104 dbSNP
rs948241030 1109 dbSNP
rs148698372 1111 dbSNP
rs1038469626 1115 dbSNP
rs898601729 1116 dbSNP
rs1287253741 1124 dbSNP
rs930060050 1125 dbSNP
rs559943999 1135 dbSNP
rs1424748923 1140 dbSNP
rs573602455 1145 dbSNP
rs1163533339 1146 dbSNP
rs914474286 1152 dbSNP
rs1410673174 1156 dbSNP
rs1282965273 1159 dbSNP
rs542183517 1171 dbSNP
rs10153119 1173 dbSNP
rs1018209095 1177 dbSNP
rs1224915762 1178 dbSNP
rs933096603 1179 dbSNP
rs1263350889 1187 dbSNP
rs759338903 1190 dbSNP
rs1183236447 1192 dbSNP
rs1047457664 1197 dbSNP
rs1223013253 1222 dbSNP
rs886161285 1224 dbSNP
rs1006318518 1230 dbSNP
rs181296729 1231 dbSNP
rs1300712982 1235 dbSNP
rs898776358 1236 dbSNP
rs1347450845 1259 dbSNP
rs1198612534 1262 dbSNP
rs1013171890 1273 dbSNP
rs184013069 1276 dbSNP
rs1021439604 1288 dbSNP
rs1160399899 1293 dbSNP
rs967571359 1296 dbSNP
rs564744881 1300 dbSNP
rs1480867016 1304 dbSNP
rs977189635 1315 dbSNP
rs1268350647 1320 dbSNP
rs141320847 1323 dbSNP
rs547076579 1331 dbSNP
rs1176939045 1335 dbSNP
rs189136008 1341 dbSNP
rs991090151 1348 dbSNP
rs535935301 1349 dbSNP
rs1214933343 1352 dbSNP
rs916841457 1354 dbSNP
rs1264749428 1375 dbSNP
rs956107463 1380 dbSNP
rs1344472267 1382 dbSNP
rs543819305 1396 dbSNP
rs1383432936 1400 dbSNP
rs1156934488 1401 dbSNP
rs1347044781 1408 dbSNP
rs569268927 1413 dbSNP
rs1453618756 1439 dbSNP
rs974237706 1441 dbSNP
rs76981189 1445 dbSNP
rs1386954655 1446 dbSNP
rs765247296 1447 dbSNP
rs541500962 1451 dbSNP
rs181512661 1467 dbSNP
rs557727748 1469 dbSNP
rs889526 1480 dbSNP
rs944039545 1483 dbSNP
rs889527 1488 dbSNP
rs113326865 1498 dbSNP
rs899779984 1501 dbSNP
rs868456357 1503 dbSNP
rs1021911494 1505 dbSNP
rs553848015 1507 dbSNP
rs907620776 1508 dbSNP
rs750898776 1514 dbSNP
rs1260873693 1515 dbSNP
rs999054319 1522 dbSNP
rs941755770 1524 dbSNP
rs1221592763 1532 dbSNP
rs1035461991 1536 dbSNP
rs573437598 1540 dbSNP
rs756978106 1542 dbSNP
rs1037811773 1545 dbSNP
rs894791853 1547 dbSNP
rs948977104 1551 dbSNP
rs1044680929 1560 dbSNP
rs907428492 1565 dbSNP
rs959752133 1567 dbSNP
rs1199859939 1588 dbSNP
rs542293530 1590 dbSNP
rs1012563375 1593 dbSNP
rs1022566008 1664 dbSNP
rs1463700869 1666 dbSNP
rs758813962 1679 dbSNP
rs1003042784 1680 dbSNP
rs1393065900 1694 dbSNP
rs562192792 1706 dbSNP
rs1387030416 1709 dbSNP
rs1410189391 1717 dbSNP
rs1420358633 1718 dbSNP
rs974344926 1721 dbSNP
rs891906898 1739 dbSNP
rs1364248892 1742 dbSNP
rs575625669 1766 dbSNP
rs777418228 1771 dbSNP
rs920141076 1771 dbSNP
rs1022069786 1782 dbSNP
rs964670724 1787 dbSNP
rs1360884177 1789 dbSNP
rs544901840 1792 dbSNP
rs951583194 1817 dbSNP
rs1308603766 1818 dbSNP
rs983332404 1819 dbSNP
rs1317812720 1836 dbSNP
rs912662266 1842 dbSNP
rs12934083 1845 dbSNP
rs1039765216 1850 dbSNP
rs1030224454 1851 dbSNP
rs769760269 1852 dbSNP
rs1427910444 1857 dbSNP
rs12934098 1862 dbSNP
rs1244594487 1867 dbSNP
rs12934100 1869 dbSNP
rs1312348928 1870 dbSNP
rs1361429517 1874 dbSNP
rs921257362 1877 dbSNP
rs954589333 1883 dbSNP
rs983698149 1885 dbSNP
rs907697553 1898 dbSNP
rs1271972841 1906 dbSNP
rs1435889089 1907 dbSNP
rs1206422267 1908 dbSNP
rs947335837 1909 dbSNP
rs1291839773 1910 dbSNP
rs533597510 1930 dbSNP
rs903073912 1936 dbSNP
rs9930406 1937 dbSNP
rs1383477764 1939 dbSNP
rs560712708 1952 dbSNP
rs1306603942 1955 dbSNP
rs895591114 1957 dbSNP
rs1012619698 1960 dbSNP
rs1303808256 1967 dbSNP
rs1423999680 1968 dbSNP
rs11644168 1971 dbSNP
rs201006308 1972 dbSNP
rs897360576 1977 dbSNP
rs140313822 1986 dbSNP
rs1408554861 1987 dbSNP
rs1331344583 2000 dbSNP
rs199968981 2001 dbSNP
rs139375073 2002 dbSNP
rs1288355943 2003 dbSNP
rs1207369595 2004 dbSNP
rs1046056142 2010 dbSNP
rs1260487032 2011 dbSNP
rs28442193 2018 dbSNP
rs938904279 2019 dbSNP
rs1284092896 2020 dbSNP
rs1404413903 2024 dbSNP
rs1269497611 2029 dbSNP
rs1337412693 2034 dbSNP
rs1382688970 2036 dbSNP
rs1384023309 2037 dbSNP
rs28682911 2042 dbSNP
rs1470785972 2044 dbSNP
rs1175185987 2046 dbSNP
rs1476774725 2047 dbSNP
rs1243298934 2050 dbSNP
rs1273522494 2053 dbSNP
rs75484429 2060 dbSNP
rs1207230564 2061 dbSNP
rs1326007705 2070 dbSNP
rs368162680 2070 dbSNP
rs891946866 2071 dbSNP
rs1012106381 2073 dbSNP
rs1431477630 2073 dbSNP
rs1256954628 2079 dbSNP
rs1318393386 2079 dbSNP
rs1325771035 2079 dbSNP
rs1421078610 2079 dbSNP
rs1021726237 2085 dbSNP
rs900572578 2086 dbSNP
rs1390101867 2091 dbSNP
rs996136869 2101 dbSNP
rs1244101552 2103 dbSNP
rs1209729970 2107 dbSNP
rs1440904027 2112 dbSNP
rs1248020278 2113 dbSNP
rs201517165 2113 dbSNP
rs538195395 2113 dbSNP
rs1383323431 2114 dbSNP
rs954661635 2117 dbSNP
rs1168671649 2118 dbSNP
rs1205439080 2118 dbSNP
rs1224686562 2118 dbSNP
rs1226416676 2118 dbSNP
rs1234820973 2118 dbSNP
rs1272547790 2118 dbSNP
rs1311818577 2118 dbSNP
rs1329030356 2118 dbSNP
rs1355910627 2118 dbSNP
rs373306980 2118 dbSNP
rs1188396429 2119 dbSNP
rs1279789544 2120 dbSNP
rs1348127121 2120 dbSNP
rs1372979107 2120 dbSNP
rs1304426120 2121 dbSNP
rs1474744948 2121 dbSNP
rs879031000 2121 dbSNP
rs72794233 2122 dbSNP
rs1169947678 2125 dbSNP
rs1273448320 2125 dbSNP
rs143482045 2126 dbSNP
rs1468925587 2129 dbSNP
rs376970761 2130 dbSNP
rs1407907120 2132 dbSNP
rs755238735 2134 dbSNP
rs1317102011 2135 dbSNP
rs1472370928 2137 dbSNP
rs779323241 2138 dbSNP
rs1490518583 2139 dbSNP
rs865883230 2142 dbSNP
rs1432825523 2146 dbSNP
rs1284655748 2147 dbSNP
rs1227472275 2148 dbSNP
rs1326623689 2150 dbSNP
rs1284742118 2151 dbSNP
rs186883540 2153 dbSNP
rs1293482473 2154 dbSNP
rs1434917600 2156 dbSNP
rs143374824 2157 dbSNP
rs1456970686 2158 dbSNP
rs1410056704 2160 dbSNP
rs890445313 2160 dbSNP
rs951688239 2161 dbSNP
rs1223085085 2162 dbSNP
rs1266727290 2164 dbSNP
rs983000551 2164 dbSNP
rs1189440799 2165 dbSNP
rs1486802815 2167 dbSNP
rs1242546389 2168 dbSNP
rs1261477795 2168 dbSNP
rs1347453134 2170 dbSNP
rs1207890123 2171 dbSNP
rs1463325275 2172 dbSNP
rs1201107274 2174 dbSNP
rs1261141326 2175 dbSNP
rs1264650492 2176 dbSNP
rs1445708656 2176 dbSNP
rs1311157147 2178 dbSNP
rs912717578 2179 dbSNP
rs1195986776 2180 dbSNP
rs1298523298 2180 dbSNP
rs1264283347 2182 dbSNP
rs1480300890 2183 dbSNP
rs200228122 2183 dbSNP
rs1206229541 2184 dbSNP
rs965486332 2186 dbSNP
rs551674140 2189 dbSNP
rs1197764247 2191 dbSNP
rs1256003047 2193 dbSNP
rs1386843242 2193 dbSNP
rs199618821 2193 dbSNP
rs373833754 2193 dbSNP
rs192075839 2197 dbSNP
rs1430321174 2204 dbSNP
rs1420145783 2211 dbSNP
rs1157424253 2215 dbSNP
rs1382147984 2219 dbSNP
rs182383086 2225 dbSNP
rs1463396255 2232 dbSNP
rs973620366 2233 dbSNP
rs553713907 2236 dbSNP
rs1203950882 2244 dbSNP
rs1043418932 2245 dbSNP
rs1298756517 2250 dbSNP
rs1344864077 2252 dbSNP
rs924577365 2265 dbSNP
rs567120707 2273 dbSNP
rs1307503174 2274 dbSNP
rs1057001738 2284 dbSNP
rs1228277974 2290 dbSNP
rs1332989530 2297 dbSNP
rs895646782 2298 dbSNP
rs1234241870 2312 dbSNP
rs1012670688 2319 dbSNP
rs1044130306 2320 dbSNP
rs1218950661 2323 dbSNP
rs898898100 2325 dbSNP
rs994526755 2329 dbSNP
rs1371188418 2330 dbSNP
rs1287331908 2335 dbSNP
rs1447548759 2339 dbSNP
rs1386935331 2342 dbSNP
rs1187986378 2343 dbSNP
rs1422971478 2346 dbSNP
rs981804993 2347 dbSNP
rs1178540099 2349 dbSNP
rs8046372 2351 dbSNP
rs1273238277 2356 dbSNP
rs938940190 2357 dbSNP
rs555801539 2362 dbSNP
rs1433344668 2364 dbSNP
rs1004863200 2365 dbSNP
rs947599352 2366 dbSNP
rs376209716 2373 dbSNP
rs1470869012 2378 dbSNP
rs1158772760 2379 dbSNP
rs1364884987 2380 dbSNP
rs1422733383 2381 dbSNP
rs1351228674 2382 dbSNP
rs1307497611 2384 dbSNP
rs1304658063 2386 dbSNP
rs900603531 2389 dbSNP
rs965538259 2390 dbSNP
rs1163706291 2392 dbSNP
rs1457248990 2394 dbSNP
rs754252011 2395 dbSNP
rs1028422606 2396 dbSNP
rs1387513206 2401 dbSNP
rs1250501321 2404 dbSNP
rs969192585 2414 dbSNP
rs1490677643 2418 dbSNP
rs978807105 2419 dbSNP
rs185962257 2421 dbSNP
rs1051738217 2426 dbSNP
rs890443201 2429 dbSNP
rs1334243570 2434 dbSNP
rs1264016273 2436 dbSNP
rs369377190 2440 dbSNP
rs1014860721 2442 dbSNP
rs1287903225 2451 dbSNP
rs544652112 2452 dbSNP
rs189555211 2454 dbSNP
rs963585123 2460 dbSNP
rs11542442 2464 dbSNP
rs1347430861 2467 dbSNP
rs992713424 2472 dbSNP
rs994687182 2476 dbSNP
rs1388387491 2479 dbSNP
rs917127263 2480 dbSNP
rs578206537 2491 dbSNP
rs1410775251 2500 dbSNP
rs948576783 2528 dbSNP
rs1044180200 2529 dbSNP
rs1481144403 2531 dbSNP
rs1377675690 2541 dbSNP
rs182579882 2543 dbSNP
rs771021122 2545 dbSNP
rs1210987653 2546 dbSNP
rs1465578396 2561 dbSNP
rs1267778730 2565 dbSNP
rs755400309 2570 dbSNP
rs1267566830 2582 dbSNP
rs1023463611 2583 dbSNP
rs1275503797 2593 dbSNP
rs1232511510 2597 dbSNP
rs1195638541 2602 dbSNP
rs1247946846 2603 dbSNP
rs1458867707 2620 dbSNP
rs1178703966 2621 dbSNP
rs969164028 2624 dbSNP
rs930371879 2625 dbSNP
rs1318179198 2629 dbSNP
rs927645327 2630 dbSNP
rs774466877 2635 dbSNP
rs1425331365 2637 dbSNP
rs1171479094 2642 dbSNP
rs956413502 2644 dbSNP
rs1376442669 2664 dbSNP
rs988190697 2669 dbSNP
rs1442654763 2672 dbSNP
rs540915038 2673 dbSNP
rs779446548 2682 dbSNP
rs913488392 2689 dbSNP
rs1207129406 2694 dbSNP
rs146849635 2699 dbSNP
rs73584980 2702 dbSNP
rs1296304344 2720 dbSNP
rs901396986 2721 dbSNP
rs997043995 2724 dbSNP
rs1364255071 2740 dbSNP
rs922101572 2746 dbSNP
rs1295109946 2750 dbSNP
rs1454307867 2751 dbSNP
rs932096643 2755 dbSNP
rs543147279 2757 dbSNP
rs373181565 2760 dbSNP
rs1412280599 2761 dbSNP
rs1397957466 2775 dbSNP
rs1171075909 2782 dbSNP
rs1430925064 2783 dbSNP
rs1390023233 2786 dbSNP
rs1187077062 2787 dbSNP
rs1449294442 2789 dbSNP
rs1332047781 2806 dbSNP
rs1473947479 2811 dbSNP
rs968869389 2821 dbSNP
rs1238293437 2824 dbSNP
rs1187058104 2836 dbSNP
rs1382168609 2838 dbSNP
rs979245101 2851 dbSNP
rs1031723796 2865 dbSNP
rs1244356492 2867 dbSNP
rs1341364148 2872 dbSNP
rs956238837 2878 dbSNP
rs531752193 2879 dbSNP
rs1229832699 2880 dbSNP
rs551519318 2883 dbSNP
rs1379560605 2887 dbSNP
rs992767345 2902 dbSNP
rs1315411216 2906 dbSNP
rs1445311823 2909 dbSNP
rs1337063022 2910 dbSNP
rs1308109653 2913 dbSNP
rs1428471960 2927 dbSNP
rs1004887300 2928 dbSNP
rs1167209181 2929 dbSNP
rs1407471050 2938 dbSNP
rs1322898587 2941 dbSNP
rs748653570 2962 dbSNP
rs1250039128 2974 dbSNP
rs1319493022 2975 dbSNP
rs1198915465 3008 dbSNP
rs1241930045 3012 dbSNP
rs1249554913 3024 dbSNP
rs1459570703 3029 dbSNP
rs1322144546 3041 dbSNP
rs1288848598 3061 dbSNP
rs948627532 3063 dbSNP
rs772133634 3073 dbSNP
rs1330782744 3076 dbSNP
rs559861256 3080 dbSNP
rs1183132590 3088 dbSNP
rs1288529401 3093 dbSNP
rs571596344 3096 dbSNP
rs527635120 3103 dbSNP
rs1256771740 3111 dbSNP
rs1350890967 3116 dbSNP
rs1427909114 3119 dbSNP
rs979929574 3122 dbSNP
rs1167984586 3124 dbSNP
rs1414483662 3127 dbSNP
rs920422483 3134 dbSNP
rs1023494733 3136 dbSNP
rs1425512350 3140 dbSNP
rs969199863 3141 dbSNP
rs1409806649 3142 dbSNP
rs1192898988 3154 dbSNP
rs1003351857 3165 dbSNP
rs1467343041 3169 dbSNP
rs930458968 3170 dbSNP
rs112355335 3180 dbSNP
rs776215658 3180 dbSNP
rs112439524 3181 dbSNP
rs1047937681 3184 dbSNP
rs1466052115 3187 dbSNP
rs1268407708 3188 dbSNP
rs1227366075 3192 dbSNP
rs547661932 3196 dbSNP
rs1302748883 3201 dbSNP
rs907592863 3202 dbSNP
rs1368923108 3214 dbSNP
rs1274718985 3215 dbSNP
rs1405691712 3220 dbSNP
rs987833664 3221 dbSNP
rs1450506777 3233 dbSNP
rs1321511540 3243 dbSNP
rs1456890366 3250 dbSNP
rs567135080 3260 dbSNP
rs1022370818 3264 dbSNP
rs1040047311 3275 dbSNP
rs74909952 3276 dbSNP
rs997096437 3289 dbSNP
rs1451146368 3290 dbSNP
rs1293828305 3296 dbSNP
rs1320467451 3302 dbSNP
rs1219681333 3319 dbSNP
rs1463265821 3324 dbSNP
rs780793454 3332 dbSNP
rs922158841 3333 dbSNP
rs932168472 3338 dbSNP
rs987560313 3350 dbSNP
rs1262085745 3377 dbSNP
rs1321054612 3379 dbSNP
rs911986568 3381 dbSNP
rs1049954402 3382 dbSNP
rs904699369 3384 dbSNP
rs1434724443 3418 dbSNP
rs1211601216 3430 dbSNP
rs1360156858 3439 dbSNP
rs555864533 3463 dbSNP
rs1466646434 3466 dbSNP
rs1358622520 3467 dbSNP
rs1171743585 3494 dbSNP
rs1431537702 3495 dbSNP
rs1036401887 3500 dbSNP
rs1187703791 3503 dbSNP
rs186893857 3505 dbSNP
rs1257862339 3509 dbSNP
rs1184743146 3510 dbSNP
rs538702517 3514 dbSNP
rs1182041112 3516 dbSNP
rs866981443 3517 dbSNP
rs1265002933 3523 dbSNP
rs1482665650 3524 dbSNP
rs1478013598 3526 dbSNP
rs930607933 3532 dbSNP
rs1045019411 3533 dbSNP
rs1198474212 3533 dbSNP
rs905088823 3536 dbSNP
rs1275888537 3537 dbSNP
rs1428858738 3537 dbSNP
rs558314395 3538 dbSNP
rs1315158133 3542 dbSNP
rs1396808336 3543 dbSNP
rs956122236 3545 dbSNP
rs1311143759 3547 dbSNP
rs1178259668 3550 dbSNP
rs1359823753 3554 dbSNP
rs1371102646 3557 dbSNP
rs1167830494 3573 dbSNP
rs1014238357 3574 dbSNP
rs892250750 3585 dbSNP
rs1453611449 3586 dbSNP
rs1165100635 3588 dbSNP
rs1009728384 3589 dbSNP
rs1254859307 3590 dbSNP
rs1183716203 3595 dbSNP
rs747176385 3601 dbSNP
rs1342976397 3609 dbSNP
rs1205040310 3612 dbSNP
rs1337916908 3614 dbSNP
rs1293045180 3624 dbSNP
rs1267593557 3625 dbSNP
rs368394136 3625 dbSNP
rs1245889919 3631 dbSNP
rs1321354496 3634 dbSNP
rs373023927 3642 dbSNP
rs1400983721 3644 dbSNP
rs1351136404 3657 dbSNP
rs771164799 3665 dbSNP
rs968130997 3687 dbSNP
rs560909806 3689 dbSNP
rs776245753 3695 dbSNP
rs1283106622 3703 dbSNP
rs1293889035 3706 dbSNP
rs1457156966 3718 dbSNP
rs1343188263 3720 dbSNP
rs1029201993 3741 dbSNP
rs4783742 3744 dbSNP
rs1220603790 3749 dbSNP
rs1301308013 3753 dbSNP
rs953595800 3757 dbSNP
rs979981577 3758 dbSNP
rs190009980 3759 dbSNP
rs1410557907 3765 dbSNP
rs1213093489 3767 dbSNP
rs60329257 3779 dbSNP
rs1436576334 3783 dbSNP
rs1270015488 3793 dbSNP
rs951988476 3800 dbSNP
rs1488332519 3802 dbSNP
rs1271539415 3811 dbSNP
rs72794235 3812 dbSNP
rs554458934 3813 dbSNP
rs944418939 3815 dbSNP
rs1332763416 3818 dbSNP
rs769261969 3819 dbSNP
rs182997044 3820 dbSNP
rs1386026820 3826 dbSNP
rs145789049 3839 dbSNP
rs549753653 3845 dbSNP
rs1045049523 3846 dbSNP
rs1457433387 3850 dbSNP
rs931601430 3862 dbSNP
rs1477127425 3873 dbSNP
rs1193179303 3897 dbSNP
rs563057322 3900 dbSNP
rs1478692028 3904 dbSNP
rs1379904157 3911 dbSNP
rs1200148491 3914 dbSNP
rs1454139222 3915 dbSNP
rs1465507836 3926 dbSNP
rs778797014 3926 dbSNP
rs915186436 3926 dbSNP
rs1426195586 3927 dbSNP
rs531742352 3936 dbSNP
rs1203478125 3939 dbSNP
rs1347150163 3940 dbSNP
rs1418545131 3941 dbSNP
rs1156997498 3942 dbSNP
rs1368593670 3944 dbSNP
rs1362989534 3946 dbSNP
rs1420851118 3950 dbSNP
rs369824779 3952 dbSNP
rs1299543496 3956 dbSNP
rs1435461260 3958 dbSNP
rs1364028240 3964 dbSNP
rs144172239 3969 dbSNP
rs1315732311 3973 dbSNP
rs1415715707 3980 dbSNP
rs1135450 3983 dbSNP
rs1402254249 3984 dbSNP
rs1173721755 3986 dbSNP
rs1434628058 3990 dbSNP
rs1393728025 3991 dbSNP
rs905121353 3994 dbSNP
rs939243228 3996 dbSNP
rs953437772 4004 dbSNP
rs1438107045 4011 dbSNP
rs569988966 4013 dbSNP
rs1050434888 4016 dbSNP
rs1444249771 4019 dbSNP
rs904751153 4041 dbSNP
rs28739533 4042 dbSNP
rs1009372845 4043 dbSNP
rs1372210507 4049 dbSNP
rs763634410 4053 dbSNP
rs1022481675 4063 dbSNP
rs1228898864 4067 dbSNP
rs1354260454 4068 dbSNP
rs1341148624 4078 dbSNP
rs1245163478 4081 dbSNP
rs1340613225 4085 dbSNP
rs1449735732 4085 dbSNP
rs903561329 4085 dbSNP
rs1412305647 4094 dbSNP
rs996475658 4094 dbSNP
rs911224361 4095 dbSNP
rs375301074 4098 dbSNP
rs1170975901 4099 dbSNP
rs1453089480 4102 dbSNP
rs111703048 4103 dbSNP
rs1238110313 4103 dbSNP
rs1238204684 4103 dbSNP
rs1270605282 4103 dbSNP
rs1437064011 4103 dbSNP
rs1473898159 4103 dbSNP
rs1027935663 4104 dbSNP
rs1356617503 4121 dbSNP
rs565175930 4124 dbSNP
rs1014290568 4125 dbSNP
rs1019138368 4129 dbSNP
rs188631172 4134 dbSNP
rs1247503091 4135 dbSNP
rs944122205 4137 dbSNP
rs1310426254 4138 dbSNP
rs1410964029 4146 dbSNP
rs1480460762 4155 dbSNP
rs962537808 4161 dbSNP
rs565402088 4165 dbSNP
rs1407375571 4166 dbSNP
rs1414828867 4174 dbSNP
rs1041144959 4181 dbSNP
rs1382249633 4183 dbSNP
rs972236540 4187 dbSNP
rs1414246194 4201 dbSNP
rs1163529637 4202 dbSNP
rs1469558533 4205 dbSNP
rs970041128 4213 dbSNP
rs1223507378 4214 dbSNP
rs1451913229 4221 dbSNP
rs879502396 4232 dbSNP
rs573901805 4244 dbSNP
rs1211399249 4274 dbSNP
rs1001466115 4275 dbSNP
rs547295399 4276 dbSNP
rs951984564 4289 dbSNP
rs983711308 4293 dbSNP
rs1444145228 4295 dbSNP
rs751131786 4297 dbSNP
rs1278245456 4309 dbSNP
rs1439088645 4313 dbSNP
rs1395636520 4317 dbSNP
rs567197838 4321 dbSNP
rs1325541395 4324 dbSNP
rs965817993 4332 dbSNP
rs975836634 4337 dbSNP
rs921642859 4344 dbSNP
rs138356162 4360 dbSNP
rs1160009159 4365 dbSNP
rs913794461 4366 dbSNP
rs979093435 4372 dbSNP
rs1405727574 4374 dbSNP
rs1192806232 4379 dbSNP
rs1478255487 4381 dbSNP
rs1252121922 4385 dbSNP
rs140979562 4394 dbSNP
rs1043532744 4395 dbSNP
rs926229984 4398 dbSNP
rs1268311516 4400 dbSNP
rs1214489371 4403 dbSNP
rs767231661 4419 dbSNP
rs779414125 4421 dbSNP
rs936248843 4423 dbSNP
rs1358465126 4442 dbSNP
rs150199082 4443 dbSNP
rs996547763 4444 dbSNP
rs1303122590 4445 dbSNP
rs79449131 4469 dbSNP
rs1272039504 4478 dbSNP
rs1307066477 4484 dbSNP
rs1289612198 4498 dbSNP
rs1197019667 4500 dbSNP
rs1453178987 4504 dbSNP
rs1343474131 4515 dbSNP
rs950188264 4518 dbSNP
rs1414969285 4531 dbSNP
rs1045811702 4537 dbSNP
rs890777750 4547 dbSNP
rs1007862541 4555 dbSNP
rs1248293347 4572 dbSNP
rs1185541640 4574 dbSNP
rs1019633942 4580 dbSNP
rs962282557 4583 dbSNP
rs905927289 4584 dbSNP
rs994082087 4590 dbSNP
rs1212937656 4595 dbSNP
rs1458252673 4603 dbSNP
rs1027817008 4611 dbSNP
rs952147443 4617 dbSNP
rs552206919 4621 dbSNP
rs376128668 4622 dbSNP
rs755349980 4625 dbSNP
rs1419259302 4628 dbSNP
rs1381838917 4636 dbSNP
rs1360022920 4650 dbSNP
rs1304667211 4652 dbSNP
rs370795003 4653 dbSNP
rs867424954 4654 dbSNP
rs765584918 4655 dbSNP
rs1004792423 4660 dbSNP
rs992131927 4661 dbSNP
rs1015219493 4675 dbSNP
rs913815449 4688 dbSNP
rs1426362334 4692 dbSNP
rs765280696 4700 dbSNP
rs945304668 4701 dbSNP
rs1451269101 4715 dbSNP
rs1331692521 4716 dbSNP
rs1342129911 4717 dbSNP
rs965869784 4721 dbSNP
rs1484267878 4722 dbSNP
rs753134375 4738 dbSNP
rs1252237513 4744 dbSNP
rs193151255 4746 dbSNP
rs1269333959 4755 dbSNP
rs975891003 4759 dbSNP
rs1234016270 4760 dbSNP
rs925096980 4764 dbSNP
rs1028761082 4772 dbSNP
rs779536075 4778 dbSNP
rs1311046030 4786 dbSNP
rs1411573174 4787 dbSNP
rs1397031826 4806 dbSNP
rs1297397188 4822 dbSNP
rs953096963 4828 dbSNP
rs979533816 4830 dbSNP
rs796793321 4831 dbSNP
rs758918437 4839 dbSNP
rs1165146013 4848 dbSNP
rs924969926 4858 dbSNP
rs932430534 4864 dbSNP
rs1220290130 4866 dbSNP
rs1260203087 4877 dbSNP
rs534582696 4878 dbSNP
rs989085612 4886 dbSNP
rs1421390388 4894 dbSNP
rs1203101544 4898 dbSNP
rs1479841864 4901 dbSNP
rs1267502800 4904 dbSNP
rs554520068 4907 dbSNP
rs574419914 4909 dbSNP
rs149326594 4920 dbSNP
rs1475316197 4930 dbSNP
rs950232030 4932 dbSNP
rs1291509522 4943 dbSNP
rs1008312315 4957 dbSNP
rs1336290804 4960 dbSNP
rs1306138683 4962 dbSNP
rs1389492050 4966 dbSNP
rs1369419579 4968 dbSNP
rs1047198 4971 dbSNP
rs1036668727 4973 dbSNP
rs556842852 4976 dbSNP
rs1188892695 4977 dbSNP
rs898107685 4987 dbSNP
rs1241847720 4990 dbSNP
rs1391730631 4999 dbSNP
rs1477035951 5006 dbSNP
rs534853060 5014 dbSNP
rs747119191 5015 dbSNP
rs905979808 5017 dbSNP
rs937437276 5024 dbSNP
rs1423874850 5025 dbSNP
rs1181688532 5029 dbSNP
rs576571043 5036 dbSNP
rs147419006 5037 dbSNP
rs1005251705 5048 dbSNP
rs1002345302 5051 dbSNP
rs1468210132 5053 dbSNP
rs1271438302 5066 dbSNP
rs1014869733 5070 dbSNP
rs750988314 5086 dbSNP
rs960746062 5101 dbSNP
rs565336061 5112 dbSNP
rs992602037 5115 dbSNP
rs1332666902 5126 dbSNP
rs1020951798 5127 dbSNP
rs1439802909 5131 dbSNP
rs116121472 5134 dbSNP
rs1322095548 5136 dbSNP
rs1382341096 5150 dbSNP
rs1383595991 5154 dbSNP
rs1414922212 5161 dbSNP
rs183882031 5162 dbSNP
rs1452257435 5169 dbSNP
rs1028814940 5175 dbSNP
rs1397358393 5182 dbSNP
rs746131693 5184 dbSNP
rs1358593127 5185 dbSNP
rs1174668814 5186 dbSNP
rs1401613386 5188 dbSNP
rs953147159 5190 dbSNP
rs1278670888 5195 dbSNP
rs1251404888 5201 dbSNP
rs769629844 5210 dbSNP
rs1232817597 5211 dbSNP
rs1261113639 5216 dbSNP
rs1203386665 5218 dbSNP
rs1273114728 5224 dbSNP
rs560933517 5228 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             :::|||||   :|||||| 
Target 5' auuGUGCCAUU---GCACUCCa 3'
7 - 25
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084073
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000311765.2 | 3UTR | GCUGAGAUUGUGCCAUUGCACUCCAGCCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1