miRTarBase - #MIRT631403 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol IL2RA   
Synonyms CD25, IDDM10, IL2R, IMD41, TCGFR, p55
Description interleukin 2 receptor subunit alpha
Transcript NM_000417   
Expression
Putative miRNA Targets on IL2RA
3'UTR of IL2RA
(miRNA target sites are highlighted)
>IL2RA|NM_000417|3'UTR
   1 AAAACCAAAAGAACAAGAATTTCTTGGTAAGAAGCCGGGAACAGACAACAGAAGTCATGAAGCCCAAGTGAAATCAAAGG
  81 TGCTAAATGGTCGCCCAGGAGACATCCGTTGTGCTTGCCTGCGTTTTGGAAGCTCTGAAGTCACATCACAGGACACGGGG
 161 CAGTGGCAACCTTGTCTCTATGCCAGCTCAGTCCCATCAGAGAGCGAGCGCTACCCACTTCTAAATAGCAATTTCGCCGT
 241 TGAAGAGGAAGGGCAAAACCACTAGAACTCTCCATCTTATTTTCATGTATATGTGTTCATTAAAGCATGAATGGTATGGA
 321 ACTCTCTCCACCCTATATGTAGTATAAAGAAAAGTAGGTTTACATTCATCTCATTCCAACTTCCCAGTTCAGGAGTCCCA
 401 AGGAAAGCCCCAGCACTAACGTAAATACACAACACACACACTCTACCCTATACAACTGGACATTGTCTGCGTGGTTCCTT
 481 TCTCAGCCGCTTCTGACTGCTGATTCTCCCGTTCACGTTGCCTAATAAACATCCTTCAAGAACTCTGGGCTGCTACCCAG
 561 AAATCATTTTACCCTTGGCTCAATCCTCTAAGCTAACCCCCTTCTACTGAGCCTTCAGTCTTGAATTTCTAAAAAACAGA
 641 GGCCATGGCAGAATAATCTTTGGGTAACTTCAAAACGGGGCAGCCAAACCCATGAGGCAATGTCAGGAACAGAAGGATGA
 721 ATGAGGTCCCAGGCAGAGAATCATACTTAGCAAAGTTTTACCTGTGCGTTACTAATTGGCCTCTTTAAGAGTTAGTTTCT
 801 TTGGGATTGCTATGAATGATACCCTGAATTTGGCCTGCACTAATTTGATGTTTACAGGTGGACACACAAGGTGCAAATCA
 881 ATGCGTACGTTTCCTGAGAAGTGTCTAAAAACACCAAAAAGGGATCCGTACATTCAATGTTTATGCAAGGAAGGAAAGAA
 961 AGAAGGAAGTGAAGAGGGAGAAGGGATGGAGGTCACACTGGTAGAACGTAACCACGGAAAAGAGCGCATCAGGCCTGGCA
1041 CGGTGGCTCAGGCCTATAACCCCAGCTCCCTAGGAGACCAAGGCGGGAGCATCTCTTGAGGCCAGGAGTTTGAGACCAGC
1121 CTGGGCAGCATAGCAAGACACATCCCTACAAAAAATTAGAAATTGGCTGGATGTGGTGGCATACGCCTGTAGTCCTAGCC
1201 ACTCAGGAGGCTGAGGCAGGAGGATTGCTTGAGCCCAGGAGTTCGAGGCTGCAGTCAGTCATGATGGCACCACTGCACTC
1281 CAGCCTGGGCAACAGAGCAAGATCCTGTCTTTAAGGAAAAAAAGACAAGATGAGCATACCAGCAGTCCTTGAACATTATC
1361 AAAAAGTTCAGCATATTAGAATCACCGGGAGGCCTTGTTAAAAGAGTTCGCTGGGCCCATCTTCAGAGTCTCTGAGTTGT
1441 TGGTCTGGAATAGAGCCAAATGTTTTGTGTGTCTAACAATTCCCAGGTGCTGTTGCTGCTGCTACTATTCCAGGAACACA
1521 CTTTGAGAACCATTGTGTTATTGCTCTGCACGCCCACCCACTCTCAACTCCCACGAAAAAAATCAACTTCCAGAGCTAAG
1601 ATTTCGGTGGAAGTCCTGGTTCCATATCTGGTGCAAGATCTCCCCTCACGAATCAGTTGAGTCAACATTCTAGCTCAACA
1681 ACATCACACGATTAACATTAACGAAAATTATTCATTTGGGAAACTATCAGCCAGTTTTCACTTCTGAAGGGGCAGGAGAG
1761 TGTTATGAGAAATCACGGCAGTTTTCAGCAGGGTCCAGATTCAGATTAAATAACTATTTTCTGTCATTTCTGTGACCAAC
1841 CACATACAAACAGACTCATCTGTGCACTCTCCCCCTCCCCCTTCAGGTATATGTTTTCTGAGTAAAGTTGAAAAGAATCT
1921 CAGACCAGAAAATATAGATATATATTTAAATCTTACTTGAGTAGAACTGATTACGACTTTTGGGTGTTGAGGGGTCTATA
2001 AGATCAAAACTTTTCCATGATAATACTAAGATGTTATCGACCATTTATCTGTCCTTCTCTCAAAAGTGTATGGTGGAATT
2081 TTCCAGAAGCTATGTGATACGTGATGATGTCATCACTCTGCTGTTAACATATAATAAATTTATTGCTATTGTTTATAAAA
2161 GAATAAATGATATTTTTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::||||| |   :|||||| 
Target 5' atGGCACCACT---GCACTCCa 3'
1264 - 1282 141.00 -18.40
2
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||| |    |||||||: 
Target 5' aatACACAACACACACACTCTa 3'
424 - 445 139.00 -15.90
3
miRNA  3' guUUGU---GGUA-ACA-GUGUGAGGu 5'
            ||||   :||| ||| ||| |||| 
Target 5' caAACAGACTCATCTGTGCACTCTCCc 3'
1847 - 1873 136.00 -17.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
880360 55 ClinVar
300248 70 ClinVar
300247 93 ClinVar
300246 103 ClinVar
300245 107 ClinVar
880359 183 ClinVar
880358 261 ClinVar
300244 412 ClinVar
300243 414 ClinVar
300242 444 ClinVar
879158 471 ClinVar
879157 513 ClinVar
879156 599 ClinVar
300241 672 ClinVar
300240 676 ClinVar
300239 677 ClinVar
879155 752 ClinVar
300238 767 ClinVar
300237 884 ClinVar
300236 888 ClinVar
300235 889 ClinVar
878565 895 ClinVar
878564 963 ClinVar
300234 969 ClinVar
300233 1008 ClinVar
878563 1024 ClinVar
300231 1026 ClinVar
300232 1026 ClinVar
300230 1041 ClinVar
877538 1042 ClinVar
877537 1044 ClinVar
300229 1061 ClinVar
877536 1084 ClinVar
300228 1159 ClinVar
300227 1186 ClinVar
300226 1267 ClinVar
880320 1426 ClinVar
880319 1443 ClinVar
300225 1454 ClinVar
300224 1461 ClinVar
880318 1500 ClinVar
300223 1539 ClinVar
300222 1549 ClinVar
300221 1574 ClinVar
300220 1575 ClinVar
879104 1619 ClinVar
879103 1643 ClinVar
300219 1650 ClinVar
300218 1672 ClinVar
300217 1702 ClinVar
879102 1766 ClinVar
300216 1772 ClinVar
300215 1880 ClinVar
300214 1974 ClinVar
300213 1994 ClinVar
300212 2055 ClinVar
300211 2108 ClinVar
878519 2131 ClinVar
878518 2144 ClinVar
300210 2178 ClinVar
COSN31547228 23 COSMIC
COSN30492974 49 COSMIC
COSN30465005 59 COSMIC
COSN31524140 64 COSMIC
COSN30131956 75 COSMIC
COSN19749042 84 COSMIC
COSN30167310 91 COSMIC
COSN30112916 93 COSMIC
COSN30491609 106 COSMIC
COSN13278696 123 COSMIC
COSN30187137 156 COSMIC
COSN29138399 209 COSMIC
COSN30137491 210 COSMIC
COSN30177292 214 COSMIC
COSN31527056 231 COSMIC
COSN8187552 497 COSMIC
COSN30288392 1254 COSMIC
COSN15381950 1409 COSMIC
COSN8715020 1643 COSMIC
COSN8715019 1741 COSMIC
COSN31778806 1755 COSMIC
COSN8715018 1862 COSMIC
COSN17182184 1961 COSMIC
COSN22430017 1992 COSMIC
rs12722605 1672 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs752490211 5 dbSNP
rs920592834 7 dbSNP
rs746347754 13 dbSNP
rs1311058776 23 dbSNP
rs769795224 29 dbSNP
rs372312640 36 dbSNP
rs747854116 37 dbSNP
rs1318477027 42 dbSNP
rs778662335 46 dbSNP
rs575663406 50 dbSNP
rs12722713 55 dbSNP
rs1302503374 58 dbSNP
rs1435269946 59 dbSNP
rs547047548 61 dbSNP
rs1311349488 67 dbSNP
rs12722600 70 dbSNP
rs1246565596 75 dbSNP
rs972136274 92 dbSNP
rs886047081 93 dbSNP
rs1172674351 96 dbSNP
rs753838977 99 dbSNP
rs886047080 103 dbSNP
rs749452297 104 dbSNP
rs12722714 107 dbSNP
rs1423198256 108 dbSNP
rs1012922758 117 dbSNP
rs1490952194 118 dbSNP
rs1269992429 121 dbSNP
rs1456561434 122 dbSNP
rs549892288 123 dbSNP
rs1390799538 144 dbSNP
rs531582979 149 dbSNP
rs1023976376 157 dbSNP
rs560898947 166 dbSNP
rs1053883274 178 dbSNP
rs1399476668 180 dbSNP
rs1013475322 181 dbSNP
rs542942584 183 dbSNP
rs1397200896 186 dbSNP
rs572213760 202 dbSNP
rs1349486650 204 dbSNP
rs367718232 205 dbSNP
rs1330180795 206 dbSNP
rs535911457 209 dbSNP
rs999339677 210 dbSNP
rs903627253 215 dbSNP
rs866767255 225 dbSNP
rs1201094583 227 dbSNP
rs1040799650 235 dbSNP
rs943884205 236 dbSNP
rs1043477456 238 dbSNP
rs559720581 239 dbSNP
rs1419412833 241 dbSNP
rs931239603 259 dbSNP
rs1467188803 273 dbSNP
rs185829590 274 dbSNP
rs1302918155 286 dbSNP
rs919824754 287 dbSNP
rs1407633829 288 dbSNP
rs1309423645 289 dbSNP
rs756213567 305 dbSNP
rs751588150 314 dbSNP
rs973840090 321 dbSNP
rs1299888790 322 dbSNP
rs12722715 323 dbSNP
rs1282450726 328 dbSNP
rs910851011 330 dbSNP
rs1398630638 332 dbSNP
rs1482080927 333 dbSNP
rs1050646874 335 dbSNP
rs1462566584 336 dbSNP
rs1252758688 337 dbSNP
rs1399590711 339 dbSNP
rs1480847709 342 dbSNP
rs933546058 355 dbSNP
rs866534259 363 dbSNP
rs1190386036 375 dbSNP
rs982154177 383 dbSNP
rs34686279 386 dbSNP
rs1434827393 387 dbSNP
rs923460298 393 dbSNP
rs574873827 395 dbSNP
rs1389020679 399 dbSNP
rs970752915 408 dbSNP
rs886047079 412 dbSNP
rs886047078 414 dbSNP
rs1168828216 420 dbSNP
rs1481571402 421 dbSNP
rs1024227901 426 dbSNP
rs972229492 429 dbSNP
rs990982402 436 dbSNP
rs958546994 440 dbSNP
rs12722601 444 dbSNP
rs1297424486 445 dbSNP
rs1340171302 449 dbSNP
rs768574986 453 dbSNP
rs1275677603 458 dbSNP
rs181357994 461 dbSNP
rs909326184 462 dbSNP
rs1220636834 464 dbSNP
rs1244782119 465 dbSNP
rs984852514 470 dbSNP
rs553112485 471 dbSNP
rs1196816714 477 dbSNP
rs188613092 478 dbSNP
rs1447190806 482 dbSNP
rs1023612429 483 dbSNP
rs1419872892 487 dbSNP
rs576607759 488 dbSNP
rs1255544053 489 dbSNP
rs1351988394 499 dbSNP
rs1204990101 503 dbSNP
rs1323861297 510 dbSNP
rs960634389 511 dbSNP
rs1230867431 512 dbSNP
rs554828895 516 dbSNP
rs1050038084 517 dbSNP
rs931147337 521 dbSNP
rs898429956 533 dbSNP
rs1267471412 543 dbSNP
rs1463487202 551 dbSNP
rs1190009557 552 dbSNP
rs1242207203 554 dbSNP
rs1472139069 555 dbSNP
rs1179785584 560 dbSNP
rs1415445782 573 dbSNP
rs1475765686 575 dbSNP
rs56206280 582 dbSNP
rs1445897036 583 dbSNP
rs1374546219 597 dbSNP
rs541601070 599 dbSNP
rs1387174069 604 dbSNP
rs536972453 605 dbSNP
rs903683997 606 dbSNP
rs764877940 609 dbSNP
rs1006609925 612 dbSNP
rs1445854762 623 dbSNP
rs1286226144 630 dbSNP
rs1407195307 633 dbSNP
rs907888953 634 dbSNP
rs1326744916 636 dbSNP
rs982040171 658 dbSNP
rs949490384 659 dbSNP
rs916642780 660 dbSNP
rs1464859479 661 dbSNP
rs1485790362 663 dbSNP
rs1181979489 664 dbSNP
rs991426557 668 dbSNP
rs886047077 672 dbSNP
rs566194606 676 dbSNP
rs12719919 677 dbSNP
rs1050695706 679 dbSNP
rs1412881006 681 dbSNP
rs1336243109 692 dbSNP
rs1376357524 693 dbSNP
rs933640701 698 dbSNP
rs1306338051 702 dbSNP
rs76471890 706 dbSNP
rs75779793 707 dbSNP
rs1348434286 708 dbSNP
rs76242406 709 dbSNP
rs1240857306 711 dbSNP
rs1439672181 715 dbSNP
rs1280113847 716 dbSNP
rs1344175058 722 dbSNP
rs1217033352 726 dbSNP
rs1280105926 727 dbSNP
rs1347893105 736 dbSNP
rs1336272043 746 dbSNP
rs41290329 752 dbSNP
rs1036569161 756 dbSNP
rs143416542 767 dbSNP
rs909348135 768 dbSNP
rs985292993 773 dbSNP
rs948136085 776 dbSNP
rs549930913 786 dbSNP
rs1174770067 791 dbSNP
rs1277484044 792 dbSNP
rs1395772529 802 dbSNP
rs1429139963 815 dbSNP
rs1198332255 816 dbSNP
rs1352602578 824 dbSNP
rs531419003 838 dbSNP
rs1239124450 840 dbSNP
rs1019307368 856 dbSNP
rs1351508542 871 dbSNP
rs1317063851 875 dbSNP
rs916647121 877 dbSNP
rs1454665255 883 dbSNP
rs886047076 884 dbSNP
rs760142892 885 dbSNP
rs12722716 888 dbSNP
rs147669116 889 dbSNP
rs1227002858 890 dbSNP
rs1272091677 903 dbSNP
rs1159669307 917 dbSNP
rs1196803612 924 dbSNP
rs1289633280 927 dbSNP
rs968296462 928 dbSNP
rs775924333 929 dbSNP
rs1201685861 931 dbSNP
rs1254120377 938 dbSNP
rs1448990704 940 dbSNP
rs1186717922 942 dbSNP
rs1392326768 944 dbSNP
rs12722717 953 dbSNP
rs1462674086 961 dbSNP
rs527589024 963 dbSNP
rs1389751446 965 dbSNP
rs939943430 965 dbSNP
rs759899126 966 dbSNP
rs12722602 969 dbSNP
rs1433807020 970 dbSNP
rs1046396172 977 dbSNP
rs1294753025 978 dbSNP
rs1184754937 984 dbSNP
rs544896196 986 dbSNP
rs1448414072 992 dbSNP
rs997842886 996 dbSNP
rs1227709205 998 dbSNP
rs949376143 1007 dbSNP
rs34164172 1008 dbSNP
rs1215706035 1012 dbSNP
rs1215916391 1014 dbSNP
rs1055214907 1015 dbSNP
rs936715109 1016 dbSNP
rs12722718 1024 dbSNP
rs28360484 1026 dbSNP
rs912803984 1034 dbSNP
rs1366914842 1038 dbSNP
rs141524746 1041 dbSNP
rs1471713662 1041 dbSNP
rs542812308 1042 dbSNP
rs572589682 1044 dbSNP
rs781076912 1047 dbSNP
rs1382248207 1055 dbSNP
rs55885853 1061 dbSNP
rs1338303184 1068 dbSNP
rs149796519 1069 dbSNP
rs962737707 1071 dbSNP
rs571299400 1075 dbSNP
rs1003974783 1076 dbSNP
rs1305512354 1084 dbSNP
rs374118462 1085 dbSNP
rs1262970870 1087 dbSNP
rs537968636 1100 dbSNP
rs1014045828 1118 dbSNP
rs1199914727 1119 dbSNP
rs745755601 1120 dbSNP
rs895143394 1130 dbSNP
rs1486770995 1134 dbSNP
rs1413667780 1158 dbSNP
rs543983290 1159 dbSNP
rs1418315161 1164 dbSNP
rs1472119288 1165 dbSNP
rs936785292 1174 dbSNP
rs567205124 1176 dbSNP
rs1453903761 1183 dbSNP
rs925329636 1184 dbSNP
rs923906350 1185 dbSNP
rs12722603 1186 dbSNP
rs1313034744 1192 dbSNP
rs1350284230 1193 dbSNP
rs967967407 1207 dbSNP
rs1408333317 1210 dbSNP
rs1022617157 1214 dbSNP
rs945508248 1216 dbSNP
rs1318048444 1223 dbSNP
rs985341613 1229 dbSNP
rs953874339 1233 dbSNP
rs370765858 1234 dbSNP
rs1211906588 1236 dbSNP
rs1270711095 1244 dbSNP
rs527536271 1250 dbSNP
rs1482634040 1253 dbSNP
rs987042934 1260 dbSNP
rs115247277 1261 dbSNP
rs1419585371 1262 dbSNP
rs1451004232 1266 dbSNP
rs1570538 1267 dbSNP
rs896837610 1270 dbSNP
rs1435993039 1272 dbSNP
rs1173898853 1275 dbSNP
rs533020456 1277 dbSNP
rs1369525813 1280 dbSNP
rs1408459730 1295 dbSNP
rs1300254663 1302 dbSNP
rs1015233762 1303 dbSNP
rs1005611743 1305 dbSNP
rs1299770374 1312 dbSNP
rs1279083301 1313 dbSNP
rs529774081 1315 dbSNP
rs1373318134 1318 dbSNP
rs1235088665 1324 dbSNP
rs151183621 1324 dbSNP
rs1340295157 1330 dbSNP
rs763727948 1332 dbSNP
rs1202254013 1337 dbSNP
rs12722719 1343 dbSNP
rs1012459364 1349 dbSNP
rs1190575849 1354 dbSNP
rs1437627148 1359 dbSNP
rs1349871726 1365 dbSNP
rs1004027145 1370 dbSNP
rs755674960 1373 dbSNP
rs555259758 1378 dbSNP
rs1455229690 1380 dbSNP
rs1441763562 1386 dbSNP
rs1056570859 1387 dbSNP
rs1407877288 1390 dbSNP
rs774337279 1390 dbSNP
rs939388737 1393 dbSNP
rs1355513026 1398 dbSNP
rs1169542368 1409 dbSNP
rs1397287800 1410 dbSNP
rs923957065 1415 dbSNP
rs1441821624 1420 dbSNP
rs143496123 1428 dbSNP
rs946697468 1443 dbSNP
rs1216550929 1445 dbSNP
rs1296510516 1446 dbSNP
rs886047075 1454 dbSNP
rs1307879011 1457 dbSNP
rs752262905 1459 dbSNP
rs12244380 1461 dbSNP
rs1244925382 1471 dbSNP
rs953887284 1487 dbSNP
rs1012835968 1492 dbSNP
rs1469757461 1496 dbSNP
rs894358573 1500 dbSNP
rs1439655817 1501 dbSNP
rs1474118992 1503 dbSNP
rs1187925682 1504 dbSNP
rs1258852375 1525 dbSNP
rs760118576 1528 dbSNP
rs1316362802 1533 dbSNP
rs1163217859 1534 dbSNP
rs1055143949 1535 dbSNP
rs148885460 1539 dbSNP
rs71390108 1539 dbSNP
rs886047074 1539 dbSNP
rs1320390425 1547 dbSNP
rs12722604 1549 dbSNP
rs961133114 1551 dbSNP
rs945560714 1552 dbSNP
rs1273607911 1557 dbSNP
rs891307572 1558 dbSNP
rs886047073 1574 dbSNP
rs886047072 1575 dbSNP
rs952479194 1579 dbSNP
rs1233860700 1583 dbSNP
rs932937510 1583 dbSNP
rs1267374011 1584 dbSNP
rs1444829596 1586 dbSNP
rs1217273569 1588 dbSNP
rs766898254 1589 dbSNP
rs763406166 1599 dbSNP
rs1444937808 1605 dbSNP
rs1482716118 1606 dbSNP
rs1185271445 1609 dbSNP
rs1012472415 1610 dbSNP
rs1475714754 1611 dbSNP
rs895330376 1618 dbSNP
rs773626989 1619 dbSNP
rs1159097022 1628 dbSNP
rs921487054 1638 dbSNP
rs770156563 1640 dbSNP
rs184686521 1649 dbSNP
rs886047071 1650 dbSNP
rs1003697602 1652 dbSNP
rs867792991 1656 dbSNP
rs1042859315 1662 dbSNP
rs1314960236 1665 dbSNP
rs1357160334 1670 dbSNP
rs1415147168 1671 dbSNP
rs12722605 1672 dbSNP
rs915191823 1676 dbSNP
rs1225026057 1681 dbSNP
rs1413705111 1684 dbSNP
rs908341102 1689 dbSNP
rs1422752905 1690 dbSNP
rs879214554 1691 dbSNP
rs1208319152 1697 dbSNP
rs1259114643 1701 dbSNP
rs12722606 1702 dbSNP
rs971089935 1703 dbSNP
rs1231739213 1704 dbSNP
rs1440281298 1711 dbSNP
rs1471451264 1723 dbSNP
rs932544897 1725 dbSNP
rs1424593976 1729 dbSNP
rs1432894145 1745 dbSNP
rs1175815474 1754 dbSNP
rs922502446 1756 dbSNP
rs976583673 1757 dbSNP
rs961187614 1766 dbSNP
rs74973937 1772 dbSNP
rs1333708219 1776 dbSNP
rs542143897 1777 dbSNP
rs952421681 1785 dbSNP
rs1280027166 1795 dbSNP
rs556200257 1804 dbSNP
rs958677529 1810 dbSNP
rs1231405270 1814 dbSNP
rs537404393 1816 dbSNP
rs1023025956 1823 dbSNP
rs1348145432 1824 dbSNP
rs546491159 1827 dbSNP
rs1271333004 1843 dbSNP
rs1439883088 1849 dbSNP
rs1183198482 1853 dbSNP
rs1452703721 1855 dbSNP
rs1195578323 1859 dbSNP
rs1395983259 1863 dbSNP
rs1449103231 1873 dbSNP
rs1000912499 1877 dbSNP
rs12722607 1880 dbSNP
rs1411401032 1881 dbSNP
rs1225803394 1884 dbSNP
rs1020933054 1885 dbSNP
rs1393595443 1885 dbSNP
rs1009658185 1889 dbSNP
rs1309155854 1890 dbSNP
rs891193033 1898 dbSNP
rs1267999448 1904 dbSNP
rs1341975056 1907 dbSNP
rs1443955522 1917 dbSNP
rs1384280810 1927 dbSNP
rs1051285618 1963 dbSNP
rs932800261 1968 dbSNP
rs12722720 1974 dbSNP
rs555221196 1975 dbSNP
rs1039025708 1976 dbSNP
rs1003749869 1980 dbSNP
rs902680302 1984 dbSNP
rs12722608 1994 dbSNP
rs1161104131 2000 dbSNP
rs192145132 2002 dbSNP
rs1011378465 2004 dbSNP
rs1168274480 2011 dbSNP
rs949814842 2013 dbSNP
rs1459815382 2016 dbSNP
rs1327796959 2017 dbSNP
rs1394615047 2018 dbSNP
rs761805503 2033 dbSNP
rs551131164 2038 dbSNP
rs539350013 2039 dbSNP
rs1228689679 2044 dbSNP
rs573034970 2051 dbSNP
rs561032746 2055 dbSNP
rs550450134 2065 dbSNP
rs1040937753 2089 dbSNP
rs1333060071 2096 dbSNP
rs531654198 2100 dbSNP
rs908337333 2101 dbSNP
rs74895246 2108 dbSNP
rs1411691490 2109 dbSNP
rs1203429064 2112 dbSNP
rs1483072826 2121 dbSNP
rs549245031 2131 dbSNP
rs915644843 2132 dbSNP
rs991184251 2134 dbSNP
rs1256583917 2139 dbSNP
rs757107768 2144 dbSNP
rs1488789988 2149 dbSNP
rs979094426 2151 dbSNP
rs959689042 2152 dbSNP
rs1418451254 2154 dbSNP
rs1035313038 2161 dbSNP
rs1156292584 2166 dbSNP
rs1386419949 2172 dbSNP
rs982323438 2177 dbSNP
rs886047070 2178 dbSNP
rs1020985543 2179 dbSNP
rs1311856151 2179 dbSNP
rs1416985406 2183 dbSNP
rs749065694 2184 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084041. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep1 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084041
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep1
Location of target site ENST00000379959.3 | 3UTR | UGAUGGCACCACUGCACUCCAGCCUGGGCAACAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000379959.3 | 3UTR | AUGAUGGCACCACUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000379959.3 | 3UTR | UGAUGGCACCACUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000379959.3 | 3UTR | UGAUGGCACCACUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000379959.3 | 3UTR | UGAUGGCACCACUGCACUCCAGCCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000379959.3 | 3UTR | UGAUGGCACCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*