Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT629286 [miRNA, hsa-miR-122-5p :: UNC13A, target gene]
miRTarBase - #MIRT629286 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UNC13A   
Synonyms Munc13-1
Description unc-13 homolog A
Transcript NM_001080421   
Putative miRNA Targets on UNC13A
3'UTR of UNC13A
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             |||| | |   :|||||| 
Target 5' atcACACAACT---GCACTCCa 3'
2177 - 2195 136.00 -13.40
            ::|| ||     |:||||| 
2199 - 2220 128.00 -13.60
             |:|:||| |   || |||| || 
720 - 745 127.00 -12.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN27001200 3 COSMIC
COSN30148339 10 COSMIC
COSN30564602 60 COSMIC
COSN28889701 68 COSMIC
COSN29432867 209 COSMIC
COSN20291663 267 COSMIC
COSN31521639 438 COSMIC
COSN18861926 504 COSMIC
COSN17598938 527 COSMIC
COSN16805010 610 COSMIC
COSN25569827 691 COSMIC
COSN7355509 772 COSMIC
COSN21481051 785 COSMIC
COSN26565826 846 COSMIC
COSN31566022 941 COSMIC
COSN8605198 1074 COSMIC
COSN21202694 1245 COSMIC
COSN21181006 1498 COSMIC
COSN32158980 1530 COSMIC
COSN6138863 2065 COSMIC
COSN29052210 2241 COSMIC
COSN1761626 2264 COSMIC
COSN32055912 2545 COSMIC
COSN20115506 2816 COSMIC
COSN23987328 2929 COSMIC
COSN16264699 3366 COSMIC
COSN31961516 3484 COSMIC
COSN28196205 3539 COSMIC
COSN30421912 3892 COSMIC
COSN31543247 3930 COSMIC
COSN31548945 3990 COSMIC
COSN26506827 4032 COSMIC
COSN23539035 4034 COSMIC
COSN25684932 4088 COSMIC
COSN31535568 4089 COSMIC
COSN31579200 4255 COSMIC
COSN5849794 4334 COSMIC
COSN27958928 4400 COSMIC
COSN16301331 4438 COSMIC
COSN25179962 4557 COSMIC
COSN16271651 4710 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779941342 1 dbSNP
rs755963373 2 dbSNP
rs1261875371 3 dbSNP
rs1218518616 4 dbSNP
rs1324824745 5 dbSNP
rs1457509603 6 dbSNP
rs747304890 6 dbSNP
rs777828629 8 dbSNP
rs758556863 10 dbSNP
rs757391788 11 dbSNP
rs959352988 11 dbSNP
rs752671390 12 dbSNP
rs565905132 13 dbSNP
rs1399008332 16 dbSNP
rs1461647663 17 dbSNP
rs765805519 19 dbSNP
rs1362363396 20 dbSNP
rs755411745 21 dbSNP
rs1387941097 26 dbSNP
rs1475031884 33 dbSNP
rs1451480098 34 dbSNP
rs754214589 35 dbSNP
rs1344106699 37 dbSNP
rs951890492 41 dbSNP
rs1026075064 42 dbSNP
rs1462555983 43 dbSNP
rs766787115 46 dbSNP
rs1047811841 48 dbSNP
rs1277335477 51 dbSNP
rs1158998934 56 dbSNP
rs552847488 57 dbSNP
rs897212567 58 dbSNP
rs1383362614 61 dbSNP
rs920796657 62 dbSNP
rs532653529 63 dbSNP
rs1182881771 64 dbSNP
rs1019639601 68 dbSNP
rs12974304 69 dbSNP
rs916182319 70 dbSNP
rs374274380 71 dbSNP
rs1456924915 86 dbSNP
rs890082144 93 dbSNP
rs1212969273 97 dbSNP
rs571325205 105 dbSNP
rs936871633 106 dbSNP
rs1398086562 107 dbSNP
rs959739434 107 dbSNP
rs1355851438 108 dbSNP
rs1234952954 109 dbSNP
rs1315083513 110 dbSNP
rs1400421573 115 dbSNP
rs904041977 119 dbSNP
rs1284497785 121 dbSNP
rs1042564578 122 dbSNP
rs1357699496 128 dbSNP
rs945137788 129 dbSNP
rs1261397048 136 dbSNP
rs1489342960 153 dbSNP
rs780691845 154 dbSNP
rs1263148757 158 dbSNP
rs1446043454 160 dbSNP
rs549506604 164 dbSNP
rs1183985140 176 dbSNP
rs1056173696 184 dbSNP
rs529855318 185 dbSNP
rs1021439830 187 dbSNP
rs937678282 190 dbSNP
rs1159123639 194 dbSNP
rs926275170 195 dbSNP
rs1385540357 200 dbSNP
rs1381614453 202 dbSNP
rs1417399497 203 dbSNP
rs756728476 204 dbSNP
rs1295498883 213 dbSNP
rs984686024 214 dbSNP
rs951939949 222 dbSNP
rs899648496 227 dbSNP
rs1449899708 229 dbSNP
rs1300900861 230 dbSNP
rs1377171822 231 dbSNP
rs1395653303 233 dbSNP
rs1308055926 236 dbSNP
rs1008524024 241 dbSNP
rs201314772 241 dbSNP
rs560948878 249 dbSNP
rs1048185459 250 dbSNP
rs929436088 252 dbSNP
rs971857991 259 dbSNP
rs1236100256 262 dbSNP
rs1483161448 263 dbSNP
rs1177423085 265 dbSNP
rs1239665611 266 dbSNP
rs1437256940 266 dbSNP
rs961516237 272 dbSNP
rs7254755 281 dbSNP
rs527499410 285 dbSNP
rs758033324 286 dbSNP
rs1358352929 287 dbSNP
rs1462339976 291 dbSNP
rs993095382 293 dbSNP
rs1425224378 298 dbSNP
rs1379422301 302 dbSNP
rs189794656 305 dbSNP
rs1184312235 309 dbSNP
rs1028306712 318 dbSNP
rs771122749 320 dbSNP
rs1221424778 321 dbSNP
rs1001143320 326 dbSNP
rs924332272 335 dbSNP
rs1194910843 338 dbSNP
rs1489698128 343 dbSNP
rs1259538190 351 dbSNP
rs1456197575 352 dbSNP
rs977475744 353 dbSNP
rs545293000 354 dbSNP
rs1189364132 357 dbSNP
rs1021343551 361 dbSNP
rs1428843323 369 dbSNP
rs1042615708 371 dbSNP
rs576256584 375 dbSNP
rs963849395 380 dbSNP
rs1010147928 387 dbSNP
rs896614721 388 dbSNP
rs1056625205 390 dbSNP
rs1331001892 392 dbSNP
rs563744832 399 dbSNP
rs1214102304 404 dbSNP
rs1273561220 406 dbSNP
rs937746772 411 dbSNP
rs1340128337 422 dbSNP
rs543439682 425 dbSNP
rs531720336 436 dbSNP
rs926299899 437 dbSNP
rs1403368751 438 dbSNP
rs1280499431 439 dbSNP
rs1345042727 440 dbSNP
rs1302319174 441 dbSNP
rs1405311735 442 dbSNP
rs887012512 444 dbSNP
rs1026337013 445 dbSNP
rs547702547 446 dbSNP
rs777543164 446 dbSNP
rs1156737037 447 dbSNP
rs752297309 450 dbSNP
rs1168210641 456 dbSNP
rs899135292 456 dbSNP
rs1421189698 457 dbSNP
rs1048692715 459 dbSNP
rs1419653490 476 dbSNP
rs1170201172 480 dbSNP
rs1414861548 484 dbSNP
rs1407108133 496 dbSNP
rs574623524 498 dbSNP
rs1349746642 504 dbSNP
rs1479260344 505 dbSNP
rs1401163135 509 dbSNP
rs1267716806 511 dbSNP
rs948742628 514 dbSNP
rs919167121 521 dbSNP
rs1490933923 524 dbSNP
rs11550318 527 dbSNP
rs1358062877 528 dbSNP
rs1226051123 531 dbSNP
rs1288543196 539 dbSNP
rs1204465620 543 dbSNP
rs1218699428 546 dbSNP
rs1438856698 552 dbSNP
rs1275208786 553 dbSNP
rs1057481077 555 dbSNP
rs966273094 556 dbSNP
rs911692585 557 dbSNP
rs924877227 558 dbSNP
rs534758720 564 dbSNP
rs987301798 567 dbSNP
rs1284152451 568 dbSNP
rs1223947015 572 dbSNP
rs572313351 574 dbSNP
rs954139011 578 dbSNP
rs1420423804 579 dbSNP
rs1441399743 579 dbSNP
rs947064369 580 dbSNP
rs1359207066 581 dbSNP
rs1354981681 583 dbSNP
rs1399737015 586 dbSNP
rs1335277488 587 dbSNP
rs1341831813 591 dbSNP
rs111234568 598 dbSNP
rs1283305739 607 dbSNP
rs539365461 610 dbSNP
rs773467481 611 dbSNP
rs912426971 619 dbSNP
rs987020840 620 dbSNP
rs1280495251 621 dbSNP
rs1176679595 628 dbSNP
rs758957999 630 dbSNP
rs1242811878 632 dbSNP
rs951221761 634 dbSNP
rs185310592 638 dbSNP
rs148841202 640 dbSNP
rs759436151 640 dbSNP
rs1176914952 644 dbSNP
rs1419638135 646 dbSNP
rs1173732852 647 dbSNP
rs1009789432 651 dbSNP
rs963374480 657 dbSNP
rs896659872 663 dbSNP
rs1377212957 667 dbSNP
rs1448303082 668 dbSNP
rs1016268729 670 dbSNP
rs549783085 674 dbSNP
rs1056612040 692 dbSNP
rs776192318 694 dbSNP
rs1002385698 696 dbSNP
rs1276618748 698 dbSNP
rs1013037716 700 dbSNP
rs1235085022 702 dbSNP
rs894535498 705 dbSNP
rs1200541846 708 dbSNP
rs1236416822 710 dbSNP
rs904937982 713 dbSNP
rs1003467926 714 dbSNP
rs1379932203 714 dbSNP
rs1477217208 720 dbSNP
rs903319316 723 dbSNP
rs1466877081 725 dbSNP
rs536276325 726 dbSNP
rs1398920085 728 dbSNP
rs1386889172 730 dbSNP
rs1460913889 731 dbSNP
rs930307726 733 dbSNP
rs879359643 746 dbSNP
rs766271518 753 dbSNP
rs1303250205 757 dbSNP
rs1263784423 766 dbSNP
rs1329301270 766 dbSNP
rs546361243 769 dbSNP
rs760653705 772 dbSNP
rs1278621800 778 dbSNP
rs567237162 784 dbSNP
rs544582107 789 dbSNP
rs944609099 792 dbSNP
rs1205847798 797 dbSNP
rs527336506 798 dbSNP
rs575769611 799 dbSNP
rs1210524662 809 dbSNP
rs1270010802 810 dbSNP
rs1450423118 813 dbSNP
rs1304618304 815 dbSNP
rs914273635 831 dbSNP
rs1424755889 841 dbSNP
rs113687096 843 dbSNP
rs942476052 845 dbSNP
rs912318763 846 dbSNP
rs932764199 861 dbSNP
rs1294809445 865 dbSNP
rs1311329064 868 dbSNP
rs771880544 871 dbSNP
rs149340435 873 dbSNP
rs762934112 877 dbSNP
rs968049580 882 dbSNP
rs918385160 890 dbSNP
rs1404748203 891 dbSNP
rs1336769324 897 dbSNP
rs1467263299 899 dbSNP
rs1020938197 901 dbSNP
rs974023109 902 dbSNP
rs988817685 905 dbSNP
rs962610058 915 dbSNP
rs775581379 916 dbSNP
rs1267323682 917 dbSNP
rs1016299965 925 dbSNP
rs1222353423 926 dbSNP
rs1264610513 930 dbSNP
rs1489444992 931 dbSNP
rs563636762 937 dbSNP
rs75421007 948 dbSNP
rs1166535297 949 dbSNP
rs1158907878 950 dbSNP
rs1366171236 956 dbSNP
rs1035625844 957 dbSNP
rs1159167952 958 dbSNP
rs1362391403 967 dbSNP
rs958707463 970 dbSNP
rs1002367076 977 dbSNP
rs904990117 979 dbSNP
rs1420041974 987 dbSNP
rs1410846402 991 dbSNP
rs1027360747 996 dbSNP
rs994510942 999 dbSNP
rs371219623 1000 dbSNP
rs111618944 1005 dbSNP
rs78019026 1007 dbSNP
rs1287290244 1012 dbSNP
rs1356509773 1013 dbSNP
rs193079290 1014 dbSNP
rs893372048 1019 dbSNP
rs1483807779 1023 dbSNP
rs1050727846 1025 dbSNP
rs1039909411 1026 dbSNP
rs1443419664 1026 dbSNP
rs745720569 1027 dbSNP
rs942373724 1029 dbSNP
rs1417809465 1041 dbSNP
rs1158355474 1043 dbSNP
rs560905010 1050 dbSNP
rs1467450150 1052 dbSNP
rs1051290219 1063 dbSNP
rs1404194613 1066 dbSNP
rs979525870 1067 dbSNP
rs929737377 1071 dbSNP
rs918454327 1077 dbSNP
rs946760953 1080 dbSNP
rs1238574924 1089 dbSNP
rs1306997084 1092 dbSNP
rs913916499 1094 dbSNP
rs1253815328 1098 dbSNP
rs1284551772 1098 dbSNP
rs988144634 1102 dbSNP
rs1381859712 1113 dbSNP
rs780332507 1124 dbSNP
rs1239441808 1125 dbSNP
rs1315153274 1128 dbSNP
rs564101269 1136 dbSNP
rs541128509 1139 dbSNP
rs981389205 1144 dbSNP
rs1425855202 1150 dbSNP
rs1287888888 1156 dbSNP
rs1453957009 1161 dbSNP
rs958962927 1162 dbSNP
rs552672327 1165 dbSNP
rs1469465284 1170 dbSNP
rs572203819 1174 dbSNP
rs751808620 1177 dbSNP
rs540968288 1179 dbSNP
rs1165623983 1180 dbSNP
rs774240242 1187 dbSNP
rs1261358931 1191 dbSNP
rs1368923367 1192 dbSNP
rs138757763 1193 dbSNP
rs756807363 1193 dbSNP
rs766888061 1193 dbSNP
rs967475998 1193 dbSNP
rs969533494 1193 dbSNP
rs559145532 1195 dbSNP
rs1259662852 1197 dbSNP
rs1456057336 1203 dbSNP
rs1203221748 1205 dbSNP
rs1486948978 1205 dbSNP
rs994563194 1212 dbSNP
rs1489438240 1213 dbSNP
rs1189455441 1214 dbSNP
rs1428303844 1215 dbSNP
rs1478065074 1216 dbSNP
rs1018488499 1217 dbSNP
rs575455896 1218 dbSNP
rs1169865567 1220 dbSNP
rs1350925822 1224 dbSNP
rs756906920 1224 dbSNP
rs868560190 1228 dbSNP
rs1358711219 1235 dbSNP
rs80208089 1236 dbSNP
rs1246393832 1238 dbSNP
rs1345265078 1238 dbSNP
rs1305230548 1239 dbSNP
rs1294189466 1242 dbSNP
rs1382445139 1246 dbSNP
rs1213429821 1249 dbSNP
rs1289949219 1253 dbSNP
rs1050774163 1255 dbSNP
rs1301748839 1256 dbSNP
rs1404717385 1263 dbSNP
rs1008564031 1266 dbSNP
rs1268167000 1277 dbSNP
rs1366780232 1283 dbSNP
rs1488462422 1287 dbSNP
rs576701403 1290 dbSNP
rs541091273 1297 dbSNP
rs1474561773 1299 dbSNP
rs996065724 1311 dbSNP
rs1171143424 1314 dbSNP
rs1038099663 1315 dbSNP
rs756643072 1323 dbSNP
rs1042894360 1325 dbSNP
rs941185357 1328 dbSNP
rs1365519146 1329 dbSNP
rs1420618556 1337 dbSNP
rs867908957 1338 dbSNP
rs1197094690 1344 dbSNP
rs1364426138 1351 dbSNP
rs1325105190 1352 dbSNP
rs556594554 1360 dbSNP
rs991186030 1363 dbSNP
rs536906258 1366 dbSNP
rs1380692607 1371 dbSNP
rs1243159147 1375 dbSNP
rs913979591 1376 dbSNP
rs1354364882 1378 dbSNP
rs567275665 1383 dbSNP
rs1218456248 1385 dbSNP
rs1211602123 1386 dbSNP
rs1281858957 1399 dbSNP
rs374000205 1413 dbSNP
rs1192739221 1416 dbSNP
rs1238323479 1416 dbSNP
rs1052903525 1422 dbSNP
rs1181827497 1424 dbSNP
rs981447269 1425 dbSNP
rs967328046 1426 dbSNP
rs939368922 1428 dbSNP
rs1227506179 1429 dbSNP
rs746411851 1431 dbSNP
rs1280940554 1437 dbSNP
rs547414829 1455 dbSNP
rs1346564592 1456 dbSNP
rs1242188242 1464 dbSNP
rs1277770944 1466 dbSNP
rs1349664660 1468 dbSNP
rs1325895425 1471 dbSNP
rs1200832603 1473 dbSNP
rs1279512345 1487 dbSNP
rs1018395200 1488 dbSNP
rs1862512 1492 dbSNP
rs1390172847 1496 dbSNP
rs981000440 1499 dbSNP
rs1298875606 1520 dbSNP
rs1242582106 1530 dbSNP
rs1467241120 1545 dbSNP
rs1404233123 1546 dbSNP
rs1362583886 1554 dbSNP
rs1469888154 1557 dbSNP
rs1173561470 1564 dbSNP
rs533917592 1574 dbSNP
rs1175942725 1576 dbSNP
rs1480856167 1580 dbSNP
rs781638161 1581 dbSNP
rs571241263 1588 dbSNP
rs1200665888 1593 dbSNP
rs891362452 1594 dbSNP
rs1249731990 1597 dbSNP
rs1198772579 1599 dbSNP
rs1326699888 1604 dbSNP
rs920784620 1610 dbSNP
rs973536163 1611 dbSNP
rs555833972 1614 dbSNP
rs896792775 1615 dbSNP
rs1262821951 1619 dbSNP
rs1014681216 1629 dbSNP
rs1005305291 1633 dbSNP
rs1202673747 1646 dbSNP
rs753453936 1649 dbSNP
rs1200259743 1654 dbSNP
rs555527775 1657 dbSNP
rs145161889 1660 dbSNP
rs113552231 1661 dbSNP
rs568996807 1662 dbSNP
rs1423911895 1663 dbSNP
rs927921609 1666 dbSNP
rs1335753167 1676 dbSNP
rs1308296799 1677 dbSNP
rs1359638049 1679 dbSNP
rs7250113 1680 dbSNP
rs1296289225 1681 dbSNP
rs1404025422 1684 dbSNP
rs1336091260 1689 dbSNP
rs996119907 1693 dbSNP
rs946058137 1694 dbSNP
rs904428710 1712 dbSNP
rs913194497 1716 dbSNP
rs1282813593 1717 dbSNP
rs990232426 1732 dbSNP
rs1042944559 1742 dbSNP
rs754697026 1744 dbSNP
rs1010069663 1745 dbSNP
rs1210953099 1748 dbSNP
rs1404605043 1749 dbSNP
rs1426425910 1753 dbSNP
rs957442399 1754 dbSNP
rs1263399414 1757 dbSNP
rs1451321068 1778 dbSNP
rs891583728 1781 dbSNP
rs1052537951 1782 dbSNP
rs939400979 1784 dbSNP
rs1371998862 1792 dbSNP
rs928003587 1793 dbSNP
rs187932980 1795 dbSNP
rs948343376 1800 dbSNP
rs985626160 1807 dbSNP
rs955701514 1810 dbSNP
rs1298606585 1811 dbSNP
rs1342198855 1826 dbSNP
rs1384106852 1830 dbSNP
rs552960262 1834 dbSNP
rs920844625 1838 dbSNP
rs1441426265 1844 dbSNP
rs1240731041 1853 dbSNP
rs1182380051 1855 dbSNP
rs1245627087 1857 dbSNP
rs1442699046 1858 dbSNP
rs1280289774 1866 dbSNP
rs1203793799 1873 dbSNP
rs994790419 1874 dbSNP
rs1222146033 1877 dbSNP
rs1287160926 1878 dbSNP
rs753320885 1882 dbSNP
rs1202994071 1883 dbSNP
rs1261628596 1884 dbSNP
rs73026313 1885 dbSNP
rs73026309 1886 dbSNP
rs1159222566 1887 dbSNP
rs200422915 1887 dbSNP
rs386807431 1887 dbSNP
rs1381155304 1888 dbSNP
rs55643948 1889 dbSNP
rs1055260038 1895 dbSNP
rs906324825 1897 dbSNP
rs1384531169 1900 dbSNP
rs1453472794 1917 dbSNP
rs1396635477 1921 dbSNP
rs1342534016 1927 dbSNP
rs987256920 1944 dbSNP
rs954595019 1945 dbSNP
rs1245839870 1946 dbSNP
rs1310708722 1948 dbSNP
rs1042309707 1950 dbSNP
rs1421526788 1955 dbSNP
rs1237346764 1958 dbSNP
rs1028692794 1968 dbSNP
rs1384013112 1980 dbSNP
rs1158956997 1986 dbSNP
rs1483386598 1987 dbSNP
rs62119938 1990 dbSNP
rs1383288516 1991 dbSNP
rs1460542767 2007 dbSNP
rs1162449274 2009 dbSNP
rs1179163931 2014 dbSNP
rs1410083209 2015 dbSNP
rs1417015837 2025 dbSNP
rs1472821182 2041 dbSNP
rs968660930 2042 dbSNP
rs527819143 2045 dbSNP
rs1363386371 2050 dbSNP
rs1470410600 2051 dbSNP
rs1338986974 2053 dbSNP
rs1403992457 2054 dbSNP
rs1452027941 2058 dbSNP
rs1299178665 2063 dbSNP
rs1376211061 2067 dbSNP
rs1222380297 2070 dbSNP
rs1021554190 2071 dbSNP
rs1306708829 2077 dbSNP
rs913268157 2084 dbSNP
rs1224963858 2087 dbSNP
rs1010122263 2091 dbSNP
rs760081818 2092 dbSNP
rs1198731515 2100 dbSNP
rs891637227 2105 dbSNP
rs1035905968 2108 dbSNP
rs1003653599 2119 dbSNP
rs1176596153 2125 dbSNP
rs1267746507 2126 dbSNP
rs142003261 2126 dbSNP
rs1264370065 2128 dbSNP
rs767284741 2129 dbSNP
rs1469323501 2130 dbSNP
rs565212878 2131 dbSNP
rs906596413 2140 dbSNP
rs1045085515 2142 dbSNP
rs1171255654 2147 dbSNP
rs1219235940 2150 dbSNP
rs1440607583 2163 dbSNP
rs1298175826 2173 dbSNP
rs117867466 2174 dbSNP
rs141459126 2175 dbSNP
rs114160020 2182 dbSNP
rs1214595469 2183 dbSNP
rs973016433 2185 dbSNP
rs1305293258 2192 dbSNP
rs940916557 2201 dbSNP
rs1203724287 2204 dbSNP
rs543389939 2208 dbSNP
rs908058358 2216 dbSNP
rs186741843 2218 dbSNP
rs1430284944 2220 dbSNP
rs1490761140 2225 dbSNP
rs926587994 2226 dbSNP
rs1266984724 2227 dbSNP
rs1480222217 2228 dbSNP
rs1327185442 2229 dbSNP
rs1488183289 2230 dbSNP
rs1187369871 2232 dbSNP
rs1016634143 2237 dbSNP
rs1005241525 2238 dbSNP
rs980814577 2239 dbSNP
rs1401613253 2240 dbSNP
rs1297879741 2241 dbSNP
rs1426901406 2242 dbSNP
rs959270312 2251 dbSNP
rs75669002 2254 dbSNP
rs10583159 2257 dbSNP
rs1359236047 2257 dbSNP
rs529676780 2257 dbSNP
rs771526601 2257 dbSNP
rs1302442067 2258 dbSNP
rs1213485027 2259 dbSNP
rs1315600945 2265 dbSNP
rs8100532 2277 dbSNP
rs1003664208 2283 dbSNP
rs1415367534 2289 dbSNP
rs1165583182 2292 dbSNP
rs1489061869 2297 dbSNP
rs146603005 2310 dbSNP
rs1216754155 2311 dbSNP
rs768741070 2314 dbSNP
rs1021198730 2320 dbSNP
rs1009465765 2321 dbSNP
rs1186035742 2323 dbSNP
rs568971797 2332 dbSNP
rs1423894283 2333 dbSNP
rs1386349288 2335 dbSNP
rs1265360121 2343 dbSNP
rs893704212 2344 dbSNP
rs1162263000 2345 dbSNP
rs557580271 2353 dbSNP
rs537903203 2356 dbSNP
rs1401706713 2368 dbSNP
rs968380911 2370 dbSNP
rs1343106608 2382 dbSNP
rs568958631 2383 dbSNP
rs936015564 2390 dbSNP
rs1384417896 2394 dbSNP
rs867547518 2396 dbSNP
rs1222988297 2397 dbSNP
rs988761175 2399 dbSNP
rs1243677784 2401 dbSNP
rs145762295 2409 dbSNP
rs1270990294 2422 dbSNP
rs1049879207 2429 dbSNP
rs866531535 2430 dbSNP
rs1318950010 2433 dbSNP
rs529189580 2438 dbSNP
rs1243786290 2447 dbSNP
rs1462762682 2452 dbSNP
rs934064048 2455 dbSNP
rs867404103 2460 dbSNP
rs922826274 2463 dbSNP
rs182382903 2471 dbSNP
rs769998467 2474 dbSNP
rs910149910 2477 dbSNP
rs1399729946 2478 dbSNP
rs746323593 2481 dbSNP
rs1337061480 2484 dbSNP
rs1012259206 2485 dbSNP
rs899190302 2488 dbSNP
rs191459813 2495 dbSNP
rs547415692 2497 dbSNP
rs940982986 2504 dbSNP
rs527707358 2510 dbSNP
rs557200021 2514 dbSNP
rs970869949 2519 dbSNP
rs781762077 2522 dbSNP
rs933486791 2526 dbSNP
rs565242714 2532 dbSNP
rs974503045 2535 dbSNP
rs1264048075 2537 dbSNP
rs947093714 2541 dbSNP
rs1351538580 2552 dbSNP
rs1256014572 2554 dbSNP
rs1438880925 2555 dbSNP
rs1326361646 2564 dbSNP
rs914261929 2566 dbSNP
rs988868421 2568 dbSNP
rs529435457 2571 dbSNP
rs1469999219 2577 dbSNP
rs771537981 2577 dbSNP
rs1400643069 2582 dbSNP
rs1176633823 2587 dbSNP
rs1172404323 2588 dbSNP
rs1430982497 2591 dbSNP
rs1009370871 2592 dbSNP
rs186715514 2597 dbSNP
rs1175113433 2602 dbSNP
rs1036021526 2604 dbSNP
rs1032224544 2605 dbSNP
rs981348634 2610 dbSNP
rs1192081672 2612 dbSNP
rs969880859 2614 dbSNP
rs1007430713 2615 dbSNP
rs889830559 2617 dbSNP
rs1405340037 2628 dbSNP
rs866998558 2631 dbSNP
rs1347647905 2633 dbSNP
rs183852948 2634 dbSNP
rs1012309756 2640 dbSNP
rs1221970885 2651 dbSNP
rs865938925 2652 dbSNP
rs563117369 2660 dbSNP
rs1340234263 2664 dbSNP
rs778246882 2664 dbSNP
rs1271522376 2667 dbSNP
rs1458250494 2668 dbSNP
rs1005290990 2669 dbSNP
rs1200644294 2675 dbSNP
rs1270529523 2677 dbSNP
rs1202038365 2686 dbSNP
rs1197771835 2693 dbSNP
rs1323014862 2694 dbSNP
rs1300343774 2699 dbSNP
rs867528130 2705 dbSNP
rs754534606 2706 dbSNP
rs867333008 2707 dbSNP
rs145398602 2714 dbSNP
rs560750798 2717 dbSNP
rs753516958 2718 dbSNP
rs535710097 2722 dbSNP
rs1363529481 2725 dbSNP
rs1403333098 2726 dbSNP
rs1445898705 2727 dbSNP
rs779472316 2733 dbSNP
rs1327043823 2738 dbSNP
rs1037091456 2742 dbSNP
rs1268894664 2743 dbSNP
rs1332716342 2745 dbSNP
rs900689350 2749 dbSNP
rs755634077 2750 dbSNP
rs1294358276 2754 dbSNP
rs191898574 2763 dbSNP
rs369234326 2765 dbSNP
rs1404885973 2770 dbSNP
rs536091473 2778 dbSNP
rs914315743 2785 dbSNP
rs984410686 2789 dbSNP
rs1052835575 2793 dbSNP
rs1389070532 2795 dbSNP
rs1445136808 2797 dbSNP
rs1165468612 2804 dbSNP
rs934330344 2807 dbSNP
rs938255248 2810 dbSNP
rs1457233288 2816 dbSNP
rs926337368 2817 dbSNP
rs1416487572 2822 dbSNP
rs71924715 2825 dbSNP
rs970393845 2825 dbSNP
rs928294312 2831 dbSNP
rs66528645 2834 dbSNP
rs1364592879 2835 dbSNP
rs546959519 2835 dbSNP
rs56713202 2835 dbSNP
rs752233829 2835 dbSNP
rs1177154638 2837 dbSNP
rs1309161509 2837 dbSNP
rs1260905020 2839 dbSNP
rs1440801326 2846 dbSNP
rs1020672606 2850 dbSNP
rs1461424757 2859 dbSNP
rs1185284978 2860 dbSNP
rs1241208455 2862 dbSNP
rs1422990874 2866 dbSNP
rs1159595056 2868 dbSNP
rs1240105371 2872 dbSNP
rs574416162 2873 dbSNP
rs1157296565 2876 dbSNP
rs1387974839 2878 dbSNP
rs11668867 2879 dbSNP
rs957907388 2882 dbSNP
rs1381262710 2884 dbSNP
rs1032129249 2901 dbSNP
rs1308122093 2905 dbSNP
rs969930130 2908 dbSNP
rs915775033 2910 dbSNP
rs140562190 2912 dbSNP
rs1256781439 2915 dbSNP
rs963471361 2916 dbSNP
rs73922143 2929 dbSNP
rs865982934 2936 dbSNP
rs1323543833 2940 dbSNP
rs761861959 2942 dbSNP
rs1205054044 2943 dbSNP
rs151157348 2946 dbSNP
rs950788988 2948 dbSNP
rs1239343529 2949 dbSNP
rs1354258955 2955 dbSNP
rs901141853 2958 dbSNP
rs1252396055 2961 dbSNP
rs1310890949 2965 dbSNP
rs1449827690 2973 dbSNP
rs1037121147 2974 dbSNP
rs1470321313 2975 dbSNP
rs1030308987 2979 dbSNP
rs997788340 2980 dbSNP
rs1357547410 2981 dbSNP
rs78222456 2983 dbSNP
rs1449703529 2987 dbSNP
rs1039250837 2998 dbSNP
rs142118631 2999 dbSNP
rs1408392440 3001 dbSNP
rs1355748916 3007 dbSNP
rs1420850123 3009 dbSNP
rs1287284236 3011 dbSNP
rs1345780579 3021 dbSNP
rs1048580073 3024 dbSNP
rs1382684869 3028 dbSNP
rs76108971 3033 dbSNP
rs1205117386 3034 dbSNP
rs535250925 3039 dbSNP
rs1479497482 3042 dbSNP
rs1204215601 3044 dbSNP
rs934406214 3045 dbSNP
rs1046611982 3048 dbSNP
rs775873613 3055 dbSNP
rs928315875 3064 dbSNP
rs1045390006 3065 dbSNP
rs1201950453 3071 dbSNP
rs948673269 3074 dbSNP
rs1423138868 3081 dbSNP
rs1183852842 3083 dbSNP
rs1484978144 3086 dbSNP
rs1171652851 3091 dbSNP
rs915827341 3094 dbSNP
rs1240157356 3095 dbSNP
rs1356827612 3100 dbSNP
rs973922491 3101 dbSNP
rs1215613321 3103 dbSNP
rs1428168838 3107 dbSNP
rs1307787971 3108 dbSNP
rs112722743 3109 dbSNP
rs1406385776 3111 dbSNP
rs987885699 3117 dbSNP
rs1366214382 3119 dbSNP
rs770203615 3122 dbSNP
rs1214646772 3127 dbSNP
rs1297585034 3128 dbSNP
rs573758566 3129 dbSNP
rs1204407060 3130 dbSNP
rs1292189054 3132 dbSNP
rs1490796466 3141 dbSNP
rs1224938319 3143 dbSNP
rs957773225 3144 dbSNP
rs983959917 3148 dbSNP
rs34108223 3155 dbSNP
rs865855686 3155 dbSNP
rs950811492 3169 dbSNP
rs745792857 3170 dbSNP
rs1243202277 3173 dbSNP
rs1421807023 3177 dbSNP
rs1320617081 3181 dbSNP
rs186537053 3183 dbSNP
rs1229676762 3185 dbSNP
rs1359354092 3191 dbSNP
rs986388443 3192 dbSNP
rs114030413 3196 dbSNP
rs976070925 3197 dbSNP
rs551741917 3200 dbSNP
rs1017879597 3201 dbSNP
rs1362451345 3202 dbSNP
rs1227559253 3207 dbSNP
rs1315665246 3215 dbSNP
rs1011808854 3222 dbSNP
rs148609292 3224 dbSNP
rs1287936490 3231 dbSNP
rs1321330907 3232 dbSNP
rs562947074 3234 dbSNP
rs999039576 3244 dbSNP
rs549468146 3249 dbSNP
rs906943643 3250 dbSNP
rs1004329000 3251 dbSNP
rs1045413166 3263 dbSNP
rs529523441 3265 dbSNP
rs771318589 3266 dbSNP
rs560631720 3267 dbSNP
rs1446779116 3268 dbSNP
rs1002795281 3271 dbSNP
rs961910186 3276 dbSNP
rs1047087029 3277 dbSNP
rs540575705 3277 dbSNP
rs1170991580 3285 dbSNP
rs578196504 3288 dbSNP
rs949632575 3299 dbSNP
rs181965798 3300 dbSNP
rs913600540 3303 dbSNP
rs908395099 3311 dbSNP
rs76688145 3319 dbSNP
rs1445801404 3326 dbSNP
rs145283916 3327 dbSNP
rs1488076601 3346 dbSNP
rs1351219331 3347 dbSNP
rs16981892 3348 dbSNP
rs1270262636 3355 dbSNP
rs1327081637 3355 dbSNP
rs1208216243 3362 dbSNP
rs535144497 3366 dbSNP
rs139801420 3367 dbSNP
rs1277159916 3369 dbSNP
rs552744821 3373 dbSNP
rs953338171 3381 dbSNP
rs923128421 3383 dbSNP
rs112903206 3385 dbSNP
rs1178510367 3385 dbSNP
rs1456203600 3391 dbSNP
rs964721591 3395 dbSNP
rs1281705631 3396 dbSNP
rs1412686127 3398 dbSNP
rs1333498058 3401 dbSNP
rs1336064292 3403 dbSNP
rs1444111837 3409 dbSNP
rs1386719302 3413 dbSNP
rs1348883935 3415 dbSNP
rs1392066709 3433 dbSNP
rs1228066075 3436 dbSNP
rs572936456 3441 dbSNP
rs1283969696 3443 dbSNP
rs1347297428 3444 dbSNP
rs1199231619 3446 dbSNP
rs7256497 3460 dbSNP
rs1438714292 3462 dbSNP
rs1015627011 3468 dbSNP
rs990426738 3471 dbSNP
rs1472044789 3472 dbSNP
rs755830234 3477 dbSNP
rs1199786274 3480 dbSNP
rs147434920 3484 dbSNP
rs1171680066 3490 dbSNP
rs530304037 3495 dbSNP
rs1425512540 3496 dbSNP
rs999031845 3497 dbSNP
rs1196405619 3498 dbSNP
rs1305925367 3499 dbSNP
rs1432576570 3510 dbSNP
rs907326147 3512 dbSNP
rs1002252478 3515 dbSNP
rs1267964006 3519 dbSNP
rs569238245 3528 dbSNP
rs1024017204 3534 dbSNP
rs745348804 3539 dbSNP
rs1231203463 3540 dbSNP
rs905396543 3547 dbSNP
rs1012590735 3551 dbSNP
rs894163138 3552 dbSNP
rs1231314316 3559 dbSNP
rs1272933902 3560 dbSNP
rs114763163 3561 dbSNP
rs529362714 3563 dbSNP
rs1261725170 3565 dbSNP
rs1269022562 3569 dbSNP
rs1449333071 3570 dbSNP
rs887020441 3576 dbSNP
rs1047375883 3577 dbSNP
rs1451219507 3578 dbSNP
rs933840689 3584 dbSNP
rs1389304680 3593 dbSNP
rs1232982398 3597 dbSNP
rs922394104 3601 dbSNP
rs976185529 3602 dbSNP
rs943417915 3609 dbSNP
rs936349221 3610 dbSNP
rs1385360533 3613 dbSNP
rs889054685 3614 dbSNP
rs1322940213 3615 dbSNP
rs1327172252 3616 dbSNP
rs1050493180 3620 dbSNP
rs1050640506 3627 dbSNP
rs1296067989 3628 dbSNP
rs1341820058 3629 dbSNP
rs997196371 3629 dbSNP
rs1266790753 3631 dbSNP
rs560717155 3634 dbSNP
rs1353790240 3639 dbSNP
rs990142356 3640 dbSNP
rs1304021945 3642 dbSNP
rs1465907559 3644 dbSNP
rs1186532432 3651 dbSNP
rs1247377609 3657 dbSNP
rs957897956 3659 dbSNP
rs924891552 3662 dbSNP
rs1434116222 3665 dbSNP
rs1366542952 3667 dbSNP
rs541402882 3672 dbSNP
rs971601531 3673 dbSNP
rs1389402238 3675 dbSNP
rs1024403581 3683 dbSNP
rs1376293400 3684 dbSNP
rs1319080067 3692 dbSNP
rs1012643202 3695 dbSNP
rs1467389047 3696 dbSNP
rs1404161896 3701 dbSNP
rs975922588 3702 dbSNP
rs1243594538 3703 dbSNP
rs1170662007 3710 dbSNP
rs1330520682 3711 dbSNP
rs370187049 3712 dbSNP
rs188172335 3716 dbSNP
rs1016586995 3717 dbSNP
rs564779882 3718 dbSNP
rs886734383 3722 dbSNP
rs139575379 3725 dbSNP
rs1187028225 3727 dbSNP
rs1413019387 3729 dbSNP
rs1208557211 3730 dbSNP
rs1458840141 3731 dbSNP
rs539348168 3735 dbSNP
rs901032258 3736 dbSNP
rs1466997921 3737 dbSNP
rs1305169939 3739 dbSNP
rs1026982476 3742 dbSNP
rs1395813347 3742 dbSNP
rs1307204778 3748 dbSNP
rs1039545472 3752 dbSNP
rs1351926506 3753 dbSNP
rs1226234391 3755 dbSNP
rs1287155915 3767 dbSNP
rs1237050441 3768 dbSNP
rs1212082393 3769 dbSNP
rs981295167 3775 dbSNP
rs1482784928 3777 dbSNP
rs1481671133 3786 dbSNP
rs1196179658 3792 dbSNP
rs1253763287 3795 dbSNP
rs1473676175 3799 dbSNP
rs1178700643 3800 dbSNP
rs969482327 3801 dbSNP
rs73922142 3802 dbSNP
rs73922141 3807 dbSNP
rs185323574 3808 dbSNP
rs1346175289 3811 dbSNP
rs945546427 3813 dbSNP
rs1054910818 3817 dbSNP
rs892601510 3818 dbSNP
rs936025327 3820 dbSNP
rs572593484 3824 dbSNP
rs914096116 3825 dbSNP
rs1407603080 3826 dbSNP
rs1310146447 3828 dbSNP
rs1449079100 3830 dbSNP
rs977718719 3836 dbSNP
rs1380904535 3852 dbSNP
rs537800196 3855 dbSNP
rs971601258 3857 dbSNP
rs1299047710 3858 dbSNP
rs1396787302 3858 dbSNP
rs1402653528 3859 dbSNP
rs552925372 3861 dbSNP
rs917441899 3865 dbSNP
rs1417848365 3868 dbSNP
rs758259071 3870 dbSNP
rs958488121 3871 dbSNP
rs1203213556 3878 dbSNP
rs1379611692 3880 dbSNP
rs1316232657 3882 dbSNP
rs1016641118 3883 dbSNP
rs903551879 3884 dbSNP
rs1005678813 3888 dbSNP
rs73922140 3889 dbSNP
rs1193012981 3894 dbSNP
rs1423202241 3896 dbSNP
rs1433111794 3907 dbSNP
rs765528204 3908 dbSNP
rs901610476 3913 dbSNP
rs1428229687 3919 dbSNP
rs1167531694 3920 dbSNP
rs1350136604 3922 dbSNP
rs1186436517 3925 dbSNP
rs1291255214 3925 dbSNP
rs73922285 3927 dbSNP
rs1435703459 3929 dbSNP
rs1299747984 3935 dbSNP
rs1339725594 3936 dbSNP
rs1227433217 3937 dbSNP
rs181117570 3943 dbSNP
rs1322523918 3948 dbSNP
rs1224143911 3949 dbSNP
rs1245043802 3954 dbSNP
rs537299040 3955 dbSNP
rs569280513 3956 dbSNP
rs1189701659 3959 dbSNP
rs1250480183 3968 dbSNP
rs1214883529 3975 dbSNP
rs752068647 3982 dbSNP
rs1188306499 3983 dbSNP
rs907667313 3986 dbSNP
rs1039600150 3988 dbSNP
rs1162325899 4004 dbSNP
rs1348731541 4005 dbSNP
rs1457313392 4006 dbSNP
rs1006733481 4010 dbSNP
rs893612154 4011 dbSNP
rs980816337 4020 dbSNP
rs189996040 4023 dbSNP
rs566930298 4024 dbSNP
rs936058848 4034 dbSNP
rs1288002914 4044 dbSNP
rs1334206040 4045 dbSNP
rs1209470431 4047 dbSNP
rs1270152673 4050 dbSNP
rs1245820168 4052 dbSNP
rs766508324 4052 dbSNP
rs1463908275 4053 dbSNP
rs761016684 4061 dbSNP
rs1188556023 4068 dbSNP
rs1473984995 4069 dbSNP
rs950335621 4077 dbSNP
rs115506902 4086 dbSNP
rs992165576 4092 dbSNP
rs1336010505 4093 dbSNP
rs991662477 4094 dbSNP
rs937518323 4095 dbSNP
rs910011764 4101 dbSNP
rs926896905 4103 dbSNP
rs535996985 4104 dbSNP
rs566956626 4109 dbSNP
rs1355039046 4112 dbSNP
rs772625189 4117 dbSNP
rs1229289992 4122 dbSNP
rs1162065071 4131 dbSNP
rs1025342730 4138 dbSNP
rs976822055 4139 dbSNP
rs1369829312 4140 dbSNP
rs968309935 4141 dbSNP
rs1279956693 4143 dbSNP
rs1029634423 4148 dbSNP
rs546908214 4151 dbSNP
rs3746199 4152 dbSNP
rs1006785717 4153 dbSNP
rs1219441648 4156 dbSNP
rs1183972054 4159 dbSNP
rs1450335246 4160 dbSNP
rs1409055641 4161 dbSNP
rs1004629771 4164 dbSNP
rs1289321862 4181 dbSNP
rs769390125 4183 dbSNP
rs893663176 4187 dbSNP
rs1412741136 4208 dbSNP
rs1032570155 4210 dbSNP
rs3833288 4212 dbSNP
rs763352520 4213 dbSNP
rs1348636596 4224 dbSNP
rs1238458067 4230 dbSNP
rs1275908833 4231 dbSNP
rs533656354 4232 dbSNP
rs1000311931 4237 dbSNP
rs930450622 4240 dbSNP
rs903256101 4244 dbSNP
rs1206777742 4250 dbSNP
rs570923411 4253 dbSNP
rs1278525495 4256 dbSNP
rs1436677779 4258 dbSNP
rs1198929969 4264 dbSNP
rs750681749 4265 dbSNP
rs1348031215 4268 dbSNP
rs1322380619 4269 dbSNP
rs1405412587 4278 dbSNP
rs745567829 4279 dbSNP
rs1391087821 4281 dbSNP
rs1324248840 4284 dbSNP
rs948082880 4290 dbSNP
rs950056872 4291 dbSNP
rs765625423 4293 dbSNP
rs762116451 4294 dbSNP
rs1272998451 4295 dbSNP
rs780502434 4295 dbSNP
rs910081745 4297 dbSNP
rs1210138784 4303 dbSNP
rs984688433 4314 dbSNP
rs571115174 4321 dbSNP
rs1449387701 4323 dbSNP
rs776626520 4334 dbSNP
rs918336767 4335 dbSNP
rs1029254655 4354 dbSNP
rs535675907 4358 dbSNP
rs1196284733 4368 dbSNP
rs1372329620 4369 dbSNP
rs1461667607 4371 dbSNP
rs976466527 4374 dbSNP
rs1403705394 4381 dbSNP
rs1018613127 4386 dbSNP
rs1246609758 4399 dbSNP
rs756805661 4400 dbSNP
rs1437948196 4401 dbSNP
rs1295849600 4404 dbSNP
rs1004662371 4407 dbSNP
rs1285603253 4415 dbSNP
rs1353600139 4419 dbSNP
rs551266239 4420 dbSNP
rs368634759 4425 dbSNP
rs1268268852 4426 dbSNP
rs1453426349 4428 dbSNP
rs768746914 4438 dbSNP
rs115219027 4439 dbSNP
rs1198252287 4447 dbSNP
rs958179902 4450 dbSNP
rs551320193 4451 dbSNP
rs999760959 4453 dbSNP
rs150849207 4454 dbSNP
rs770721653 4456 dbSNP
rs749014715 4462 dbSNP
rs185147333 4464 dbSNP
rs528199683 4468 dbSNP
rs777765488 4471 dbSNP
rs1274155633 4482 dbSNP
rs3746200 4489 dbSNP
rs769492348 4490 dbSNP
rs182081351 4496 dbSNP
rs895838729 4497 dbSNP
rs1056371479 4503 dbSNP
rs765143448 4503 dbSNP
rs1400570201 4504 dbSNP
rs1001776730 4505 dbSNP
rs1232344215 4508 dbSNP
rs935309186 4520 dbSNP
rs1330675936 4521 dbSNP
rs888693627 4522 dbSNP
rs1260105130 4525 dbSNP
rs1173331946 4529 dbSNP
rs1253862636 4530 dbSNP
rs1413102949 4531 dbSNP
rs1048602253 4532 dbSNP
rs979891161 4535 dbSNP
rs1412719319 4541 dbSNP
rs1424843948 4543 dbSNP
rs139474206 4547 dbSNP
rs375836885 4547 dbSNP
rs755208393 4554 dbSNP
rs576975074 4555 dbSNP
rs922089010 4568 dbSNP
rs975055445 4569 dbSNP
rs1304930886 4594 dbSNP
rs918737087 4599 dbSNP
rs1413774761 4600 dbSNP
rs1178081612 4602 dbSNP
rs1351755969 4606 dbSNP
rs1458432452 4607 dbSNP
rs1407479041 4622 dbSNP
rs1305729674 4626 dbSNP
rs1019186619 4633 dbSNP
rs983130851 4635 dbSNP
rs1254009308 4641 dbSNP
rs1346894189 4646 dbSNP
rs1040836970 4647 dbSNP
rs1262005609 4656 dbSNP
rs950331886 4659 dbSNP
rs1277603066 4660 dbSNP
rs754090658 4662 dbSNP
rs910917627 4667 dbSNP
rs1349949146 4670 dbSNP
rs556828995 4679 dbSNP
rs1249961758 4684 dbSNP
rs985114694 4705 dbSNP
rs189005553 4711 dbSNP
rs1377249833 4719 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084076. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guuugugguaacaGUGUGAGGu 5'
Target 5' ----------aacUGCACUCCa 3'
1 - 12
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084076
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SigmaAb
Location of target site ENST00000519716.2 | 3UTR | AACUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.541 3.8e-3 -0.569 2.3e-3 23 Click to see details
GSE28544 Breast cancer -0.494 7.1e-3 -0.528 4.0e-3 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.415 2.0e-2 0.332 5.2e-2 25 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.37 3.4e-2 0.339 4.9e-2 25 Click to see details
GSE32688 Pancreatic cancer 0.274 6.5e-2 0.196 1.4e-1 32 Click to see details
GSE38226 Liver fibrosis -0.327 7.4e-2 -0.012 4.8e-1 21 Click to see details
GSE17498 Multiple myeloma 0.217 8.9e-2 0.428 2.9e-3 40 Click to see details
GSE21687 Ependynoma primary tumors 0.163 9.9e-2 0.014 4.6e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.219 1.5e-1 -0.162 2.2e-1 24 Click to see details
GSE17306 Multiple myeloma 0.139 1.7e-1 0.192 9.3e-2 49 Click to see details
GSE19350 CNS germ cell tumors -0.195 2.7e-1 -0.028 4.7e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.138 2.8e-1 0.395 4.2e-2 20 Click to see details
GSE14794 Lymphoblastoid cells -0.05 3.2e-1 -0.059 2.9e-1 90 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.107 4.2e-1 0.486 1.6e-1 6 Click to see details
GSE28260 Renal cortex and medulla 0.032 4.6e-1 0.275 1.8e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.34 0.01 -0.415 0 49 Click to see details
ESCA 0.825 0.04 0.900 0.02 5 Click to see details
KIRC -0.223 0.12 -0.288 0.06 29 Click to see details
STAD -0.321 0.22 -0.452 0.13 8 Click to see details
CHOL 0.279 0.23 0.300 0.22 9 Click to see details
HNSC 0.673 0.27 1.000 0.5 3 Click to see details
KICH 0.262 0.27 0.524 0.09 8 Click to see details
THCA -0.364 0.27 0.400 0.25 5 Click to see details
KIRP -0.17 0.33 -0.300 0.22 9 Click to see details
KIRP -0.17 0.33 -0.300 0.22 9 Click to see details
KIRP -0.17 0.33 -0.300 0.22 9 Click to see details
KIRP -0.17 0.33 -0.300 0.22 9 Click to see details
KIRP -0.17 0.33 -0.300 0.22 9 Click to see details
KIRP -0.17 0.33 -0.300 0.22 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D