miRTarBase - #MIRT627420 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol THAP2   
Synonyms -
Description THAP domain containing 2
Transcript NM_031435   
Expression
Putative miRNA Targets on THAP2
3'UTR of THAP2
(miRNA target sites are highlighted)
>THAP2|NM_031435|3'UTR
   1 ATTTAGCTTGCACAGAGCTTGATGCCTATCCTTCATTCTTTTCAGAAGTAAAGATAATTATGGCACTTATGCCAAAATTC
  81 ATTATTTAATAAAGTTTTACTTGAAGTAACATTACTGAATTTGTGAAGACTTGATTACAAAAGAATAAAAAACTTCATAT
 161 GGAAATTTTATTTGAAAATGAGTGGAAGTGCCTTACATTAGAATTACGGACTTAAAAATTTTGCTAATAAATTGTGTGTT
 241 TGAAAGGTGTTTTTTGTTTTTGTCTTTTTAAACTACTGTTAAAAGAACAGCTTATGATAAGTAATATGTTTAACTTAGAG
 321 AAGAATTTTTTCCTGTACCAAAGTTGGCATATTGCATTCTAAATAAGATGCTAAATAAGAGTTAACCAACATTCAACATG
 401 ACCTTAAAACTGCTGGGTTTTGTATTAATTAAATTATAATTGGCACTGTGATTTGAAAAATTTATAGAAAAAAAGGTACA
 481 GGGCAAGTTTTTAAATTAAAACTTTCTATATTTTGTTTTACCAGTAAAAGTGAGCTTATCATGGCCTCTCTCATAAGAAT
 561 GATTTTAAAATAGGTTGTAAAATATTTTGAAAATATTTGAATGTGAAGTACCATTGAGTCATCCAAACTAGGTAAGGCCT
 641 CAAGTACTTTAAACTAGTAAAATCTAGTAGCTGATAATATTCACCTAAGTAAGTGTTGTAAAATAATTCAGAGTTCAGGA
 721 CCTAGCTTAGATAAATGTATACTACTCTTTTTCTCATAATAAAAATCTTACATTTCCAACTTCAAAATTGGTGCTTCCAT
 801 ATTTGTTGATAACCAAAACTCCTAAGGTTTTTTGTTTTCTTTTTAACTACTTTCCAAATGCATACTATACCTCAGAAATA
 881 GTGTATCAATATAGTGGGCTTTTTTTTTCCTCTTCATAAACCCACAGTAAAATTTAATCACAGGAAACTACTTATATCTT
 961 CACACTTTGTATTGATAACTTAAAATGGCATCAGTTTATCTTAGACATCAGCTTGCTTTTTATCTCCTTTTTTAGTGAGT
1041 GAAATAGAGCAACTAGCATGCCTGTGTTCCCAGCTACTTGGGAGGCTAAGGTGGGAAGATCAATTGAACCTAGGAGGTTG
1121 AGGCTATAGTGAGCTGTGATTGCACGACTGCACTCCAGCCTGGGCAATGGAGTGAGACTCCTGTCTCTAAAACAGCAACA
1201 ACAAAAATAAAGCAACCATAGTGCATAAGGGAAATTAAATGTTCCCTATAGAAATATGTGTATGTCTGTGATAGTGGTAT
1281 GCAAATGCTAATTATTTTATAAAATAAAAGTTCAGAACTATTCTTATCATTGCCACTTGAACAATTAAAGGGTTTGCTTT
1361 ATTTCACTAATGTTTAATAGGAACCCTTTGCTTCAAACAGCTTTGTTGAAATCATGTAAAAATTTGTTAATAGAGAATCA
1441 AGTTATTTAACTCAACTTATTTAATTCAAGCTTGTGATACTAACATACAAAGGTAGCATAAACCAAGTCATAAATTGCTG
1521 TAATCTTTCCTGTAAAGTAATAGCTACTTCATGATTTTTTTAAAAATTTCATTTTTTTGCTATTTAGGATTGCATTTGCT
1601 TGGCTCCTAGTAACAATTCTTTTACAGTATTAGCACTCTCTTTACTAAGGAATGCCTCCCAAGGAAATGCAAAGGTAGGA
1681 AAAGTCTCTTAGAATGCCCATGAGGTATTTAAAACAGATATTTATGAAAATCTTTTTGTGAATGTTATAAATCTTGCTAG
1761 TTATTTTATCTTTATCTTAAGTATTAGATGTAGTTCCTTGGAATTGTCATTACATATTTATTTTTTTCTAGTATGGTTTC
1841 AAATAACTTTTTGCCAACATATAATCATCATCAAACATTCACTGACCATATCTATTTTATAACTCAAAATAAGTTGGACA
1921 AATAATCATTTTAATAAAAACTATTTTTTCCAAGTATAACCACTGTCATGTGGTTCACCCTTCACCCCAGATACAAAACA
2001 CTTATTTGTGTAGCCCAGTTCCCATCTACAGTAATACCTTGAAACCTTAATAAATTTTAAAAATCATAAAAATAAAATAT
2081 TGTAAAATACAACAAATTTTGGACAAGGTTACTTCATCTTCATTCATTATTACCTGACAGTATTAAACTACTACTCAATA
2161 ATTTTAGAGTAAACTTTTCTGTGTTTTCTCCGTGATTTTCATTGTGCTGTCCTGACAACATGCTCCAAACTCTTTGCATC
2241 AAATTGTTTTATTAACATACATTTGTCTACCTTAAAACTAGCTTTATTCACAGAGAAAAACCTAAAAGGAGTCTATTAAA
2321 ATGCTGCTTTCAGTTTGATAGTTTTTTTTTTAATCACTCTGACCATAAACTAACTGAAATTATAATGGATTTTTTTTCCT
2401 CTCCCGGTCACAACACAGATCTTCTGTTCATTTGTTCTCTGTCTACTGGGCACCAACCTCTACAAAGAACCAGCCAAAGG
2481 CTAGGTACTTGATATAAAAAGGAATATTACATTATTTTCTGCCCTCAAGTTGCTCTATCTCCTGAAAGAAACAAGTAATA
2561 TTTATAATACAATATGATAAATGCTACAAAAGAAATAGCTGTAAAGTCCTTTGGTAAATGCTGTTGAATTGGAATTCAGT
2641 AAGAACTATAAACTGTAGACCTTTTTATAATCAAATGCTTTTGTCTTGAAACAAAACAGATTCCTCCTTATATTGACTTA
2721 GCAAAGGAGGTACAAGGACATTGGCATTTGACCTGAATTATGGTGTTTTATTGAATGAGCTATAAGACAACATTTTTACC
2801 CTTTAAAATGAACACTGAACAAATGTGTTAATGGTATCTTTGTTAAAAGGAAAACATAGCTATAAATAAAATACTACATC
2881 GAAATCCAGCACTGGAGTTCATTTGAAATTTGATATTTTGTGTAAAATAACAAACCTATTAACACAGATTTTTAAAATAA
2961 CTCAGAATCGTATAAAGCACTTTGGTACTTATTTGTTCTCTTTTCCCTTACATTCTGTGTGGTAGGTGGTATTATCTCTG
3041 ATTTACACATGAAGACATCCTTGTTAATGCAATTTATTTATTCATTCGGGCATTTACTGTGTGCCAACTTGCAAAAGGAA
3121 TAGAAATGTCTGTGATCTAGATAGTTCTAGATTGAACATAGATTTTCTGCCAACAAATCCTCTCTGCTGTTCACATTATC
3201 CTTTGTTTAACGTATGAACCAGGTTACTAAAATAGGATAAATCATGTGTCTTAAAATATGAAAATAGTAAAGTCTTTGAG
3281 GTCACTTGATCTTCTCTAAGTAGACTTTATAATATTGTGTTTTATCTCATTTCTCAATATTAGAATACGGGTAGATTTTA
3361 ATTTTGCTATAATATAGGAAATGGTTCATCTTTGTACCAAAATATTGCATTCTTCTGATATTTAGACAGTTGGAAACTTT
3441 CTAAAATTGAGGATTTTGTAGTGTATACTAAATAATTGCATATTCAAAAAAATGTATTCTGAGTATGGTGATATTAAACA
3521 TTTTTCCCCAAGGAAATTAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :||| | |   :|||||| 
Target 5' attGCACGACT---GCACTCCa 3'
1139 - 1157 132.00 -13.40
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||:|  | | |:|||:|:| 
Target 5' atAATAAAAATCTTACATTTCc 3'
756 - 777 128.00 -7.50
3
miRNA  3' guUUG-UG---GUAACAGUGUGAGGu 5'
            ||| ||   :||  |||||||:: 
Target 5' gaAACTACTTATATCTTCACACTTTg 3'
944 - 969 128.00 -12.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30479563 16 COSMIC
COSN31510565 57 COSMIC
COSN30145436 59 COSMIC
COSN31515736 144 COSMIC
COSN29468403 175 COSMIC
COSN31520017 233 COSMIC
COSN31481733 286 COSMIC
COSN31515600 324 COSMIC
COSN20109834 834 COSMIC
COSN17237437 897 COSMIC
COSN7379509 921 COSMIC
COSN19476599 967 COSMIC
COSN26555936 1242 COSMIC
COSN31540523 1331 COSMIC
COSN22510597 1353 COSMIC
COSN31588413 1415 COSMIC
COSN31568035 1425 COSMIC
COSN31542511 1434 COSMIC
COSN22557673 1918 COSMIC
COSN9084246 2109 COSMIC
COSN20092604 2323 COSMIC
COSN15285574 2382 COSMIC
COSN19011494 2398 COSMIC
COSN22750065 2465 COSMIC
COSN21330705 2627 COSMIC
COSN5718885 2868 COSMIC
COSN31486549 3261 COSMIC
COSN31572595 3382 COSMIC
rs10748180 158 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1451527208 5 dbSNP
rs749900034 16 dbSNP
rs1375569604 27 dbSNP
rs1158995703 29 dbSNP
rs1433769208 35 dbSNP
rs192494548 39 dbSNP
rs751299286 49 dbSNP
rs759526676 61 dbSNP
rs1433274964 62 dbSNP
rs116397798 71 dbSNP
rs1047328757 74 dbSNP
rs1487132994 75 dbSNP
rs1287234691 81 dbSNP
rs1210585849 86 dbSNP
rs752817837 92 dbSNP
rs758612221 94 dbSNP
rs1234150499 101 dbSNP
rs144531493 102 dbSNP
rs906958279 108 dbSNP
rs1023746877 120 dbSNP
rs573486322 128 dbSNP
rs1432971459 147 dbSNP
rs1001652717 148 dbSNP
rs1034099174 156 dbSNP
rs892842580 157 dbSNP
rs10748180 158 dbSNP
rs1020238029 161 dbSNP
rs982287519 167 dbSNP
rs1015066102 179 dbSNP
rs1264557025 183 dbSNP
rs1187808011 186 dbSNP
rs967679357 187 dbSNP
rs1170197080 192 dbSNP
rs1259977841 193 dbSNP
rs986665965 208 dbSNP
rs962321621 209 dbSNP
rs1249741651 219 dbSNP
rs1229736486 224 dbSNP
rs974101763 225 dbSNP
rs1333300968 226 dbSNP
rs1019834245 237 dbSNP
rs1414032457 255 dbSNP
rs1353387908 257 dbSNP
rs920849293 258 dbSNP
rs1365326508 263 dbSNP
rs1386138589 265 dbSNP
rs1335928191 268 dbSNP
rs114332591 273 dbSNP
rs573614661 274 dbSNP
rs532730118 277 dbSNP
rs550931968 278 dbSNP
rs975501224 281 dbSNP
rs1423639347 285 dbSNP
rs1162029595 292 dbSNP
rs919995000 298 dbSNP
rs1474510492 301 dbSNP
rs943763571 310 dbSNP
rs1040867281 313 dbSNP
rs1437561347 316 dbSNP
rs1224838591 322 dbSNP
rs902318169 345 dbSNP
rs982722667 348 dbSNP
rs879049880 350 dbSNP
rs908812240 353 dbSNP
rs1232666340 356 dbSNP
rs935178358 361 dbSNP
rs1054140945 364 dbSNP
rs949632366 392 dbSNP
rs1046560061 400 dbSNP
rs562789701 403 dbSNP
rs938186984 404 dbSNP
rs1400466411 410 dbSNP
rs542525342 423 dbSNP
rs1324598905 424 dbSNP
rs1012678203 430 dbSNP
rs781638219 435 dbSNP
rs1164300432 441 dbSNP
rs1192257841 452 dbSNP
rs1362361328 462 dbSNP
rs1180806400 473 dbSNP
rs1023609332 477 dbSNP
rs1269959743 479 dbSNP
rs906623154 488 dbSNP
rs530125130 489 dbSNP
rs572329013 498 dbSNP
rs1291979728 504 dbSNP
rs1210289824 509 dbSNP
rs1349707174 523 dbSNP
rs1258725770 535 dbSNP
rs1193248979 536 dbSNP
rs1015013515 541 dbSNP
rs561994833 545 dbSNP
rs962556260 548 dbSNP
rs113176849 549 dbSNP
rs1438116032 551 dbSNP
rs1332252331 553 dbSNP
rs138854853 561 dbSNP
rs748289470 564 dbSNP
rs1162966231 568 dbSNP
rs184416129 574 dbSNP
rs566286438 575 dbSNP
rs1160797453 581 dbSNP
rs1420598884 603 dbSNP
rs1028346979 604 dbSNP
rs775707587 610 dbSNP
rs1307508945 611 dbSNP
rs1479052303 612 dbSNP
rs1368727078 615 dbSNP
rs368328370 621 dbSNP
rs772390109 623 dbSNP
rs1392658092 625 dbSNP
rs1397845622 638 dbSNP
rs1283680422 660 dbSNP
rs1277186055 669 dbSNP
rs79610518 685 dbSNP
rs1340814843 688 dbSNP
rs1218548571 689 dbSNP
rs1220070773 694 dbSNP
rs975196319 695 dbSNP
rs985105881 697 dbSNP
rs1346577391 698 dbSNP
rs910856220 702 dbSNP
rs1274918959 704 dbSNP
rs1430688690 726 dbSNP
rs1222982620 727 dbSNP
rs965104963 739 dbSNP
rs1401027718 753 dbSNP
rs976511858 772 dbSNP
rs148038228 780 dbSNP
rs552151013 786 dbSNP
rs1264346827 787 dbSNP
rs1426044880 796 dbSNP
rs1167384550 800 dbSNP
rs935183105 803 dbSNP
rs1053600124 806 dbSNP
rs915154292 815 dbSNP
rs1260979111 822 dbSNP
rs1195669230 825 dbSNP
rs1339695725 828 dbSNP
rs138646379 828 dbSNP
rs397771827 828 dbSNP
rs1256520760 835 dbSNP
rs970750063 839 dbSNP
rs1186051315 840 dbSNP
rs947960511 847 dbSNP
rs1443754574 850 dbSNP
rs982806615 855 dbSNP
rs570707698 863 dbSNP
rs938184674 866 dbSNP
rs906572063 869 dbSNP
rs1219724842 870 dbSNP
rs1165411922 879 dbSNP
rs1003537028 880 dbSNP
rs565117350 884 dbSNP
rs1041408189 885 dbSNP
rs1328388688 889 dbSNP
rs1408280539 898 dbSNP
rs1478102891 900 dbSNP
rs902879886 900 dbSNP
rs1416943073 901 dbSNP
rs897892124 909 dbSNP
rs1297414824 910 dbSNP
rs1360900111 911 dbSNP
rs1401503125 913 dbSNP
rs1300670048 916 dbSNP
rs1377833857 917 dbSNP
rs1203301889 926 dbSNP
rs995432561 938 dbSNP
rs1228339111 944 dbSNP
rs1199900190 945 dbSNP
rs1315446541 951 dbSNP
rs1352244727 955 dbSNP
rs1311144491 969 dbSNP
rs1230417922 973 dbSNP
rs772699468 978 dbSNP
rs1027794098 991 dbSNP
rs1287252119 992 dbSNP
rs1440270912 1001 dbSNP
rs1271913679 1010 dbSNP
rs1007878834 1017 dbSNP
rs953768773 1023 dbSNP
rs1041381737 1034 dbSNP
rs1277314980 1053 dbSNP
rs1489457608 1065 dbSNP
rs1393676169 1081 dbSNP
rs1209037361 1110 dbSNP
rs1162555885 1111 dbSNP
rs189709914 1123 dbSNP
rs1019154775 1126 dbSNP
rs965050571 1129 dbSNP
rs1437430787 1133 dbSNP
rs1026740691 1137 dbSNP
rs1248491491 1142 dbSNP
rs181350145 1145 dbSNP
rs1157939092 1146 dbSNP
rs923702449 1147 dbSNP
rs1224347872 1154 dbSNP
rs1380713405 1156 dbSNP
rs113418360 1161 dbSNP
rs533462712 1164 dbSNP
rs1238294417 1175 dbSNP
rs1379363770 1179 dbSNP
rs1310194309 1182 dbSNP
rs1440307518 1185 dbSNP
rs547146324 1188 dbSNP
rs1015672147 1211 dbSNP
rs574525788 1231 dbSNP
rs1350323698 1232 dbSNP
rs1358150993 1234 dbSNP
rs1448300097 1237 dbSNP
rs947865110 1247 dbSNP
rs926887276 1256 dbSNP
rs535501549 1258 dbSNP
rs1373987390 1276 dbSNP
rs1264634137 1278 dbSNP
rs370791571 1282 dbSNP
rs959585153 1299 dbSNP
rs868578152 1301 dbSNP
rs1241943003 1305 dbSNP
rs1299291 1307 dbSNP
rs1446748952 1311 dbSNP
rs1214932083 1325 dbSNP
rs1045036091 1328 dbSNP
rs1356252203 1329 dbSNP
rs1310582374 1333 dbSNP
rs770570472 1341 dbSNP
rs1356322914 1342 dbSNP
rs1233774786 1345 dbSNP
rs1217765426 1347 dbSNP
rs939357831 1352 dbSNP
rs1278354761 1354 dbSNP
rs945526446 1360 dbSNP
rs1388490522 1362 dbSNP
rs141752372 1367 dbSNP
rs573446045 1373 dbSNP
rs771365244 1377 dbSNP
rs777131590 1378 dbSNP
rs760089718 1381 dbSNP
rs1457338207 1384 dbSNP
rs765889695 1386 dbSNP
rs1177956660 1410 dbSNP
rs1375464382 1427 dbSNP
rs924363535 1429 dbSNP
rs1433209330 1431 dbSNP
rs1238649721 1432 dbSNP
rs1419459548 1432 dbSNP
rs994897594 1433 dbSNP
rs1049700499 1434 dbSNP
rs1210523126 1451 dbSNP
rs889331329 1462 dbSNP
rs1189323299 1474 dbSNP
rs1482382340 1505 dbSNP
rs1007676152 1508 dbSNP
rs899754308 1509 dbSNP
rs1342776707 1516 dbSNP
rs776487519 1517 dbSNP
rs966241325 1527 dbSNP
rs1397540766 1529 dbSNP
rs997818496 1533 dbSNP
rs1216706810 1539 dbSNP
rs866044735 1542 dbSNP
rs1030629775 1552 dbSNP
rs147429104 1562 dbSNP
rs80035412 1562 dbSNP
rs989284196 1563 dbSNP
rs74104111 1582 dbSNP
rs1466111271 1593 dbSNP
rs1016116967 1595 dbSNP
rs1169239825 1602 dbSNP
rs189109992 1604 dbSNP
rs1424838417 1607 dbSNP
rs1187653659 1610 dbSNP
rs980581542 1615 dbSNP
rs770136689 1618 dbSNP
rs939221878 1621 dbSNP
rs1033652853 1626 dbSNP
rs1480382021 1629 dbSNP
rs1256230407 1636 dbSNP
rs1196714270 1637 dbSNP
rs959615965 1638 dbSNP
rs1278707382 1639 dbSNP
rs1243829699 1641 dbSNP
rs1338410825 1646 dbSNP
rs1221183099 1651 dbSNP
rs1314454267 1656 dbSNP
rs989772612 1671 dbSNP
rs1399005175 1676 dbSNP
rs1022538997 1685 dbSNP
rs1467689745 1691 dbSNP
rs1256337475 1715 dbSNP
rs1401690524 1718 dbSNP
rs1317385879 1719 dbSNP
rs972482976 1733 dbSNP
rs1163147060 1739 dbSNP
rs1456725645 1751 dbSNP
rs1370549421 1753 dbSNP
rs1188587926 1763 dbSNP
rs966889172 1765 dbSNP
rs1199276088 1767 dbSNP
rs1236483205 1772 dbSNP
rs978259947 1775 dbSNP
rs1458235528 1778 dbSNP
rs1258634696 1784 dbSNP
rs919228230 1794 dbSNP
rs1260074230 1795 dbSNP
rs566718198 1798 dbSNP
rs1354070035 1801 dbSNP
rs930638802 1807 dbSNP
rs1245122940 1809 dbSNP
rs528517572 1811 dbSNP
rs1306569111 1815 dbSNP
rs1219257969 1820 dbSNP
rs1376910787 1832 dbSNP
rs1323546616 1834 dbSNP
rs1245952721 1835 dbSNP
rs1478210447 1836 dbSNP
rs943767707 1840 dbSNP
rs1393380422 1853 dbSNP
rs1192593243 1859 dbSNP
rs1419425786 1865 dbSNP
rs529309925 1872 dbSNP
rs889187684 1883 dbSNP
rs1160608637 1887 dbSNP
rs1440409182 1889 dbSNP
rs150582923 1909 dbSNP
rs1198162329 1910 dbSNP
rs1449767998 1917 dbSNP
rs1269265446 1924 dbSNP
rs1040489509 1926 dbSNP
rs1048328119 1941 dbSNP
rs902108622 1950 dbSNP
rs1283447916 1975 dbSNP
rs999021749 1977 dbSNP
rs1401814648 1988 dbSNP
rs1404137163 1995 dbSNP
rs562505151 1995 dbSNP
rs1241850235 2014 dbSNP
rs1353878913 2017 dbSNP
rs1032337202 2018 dbSNP
rs892165495 2019 dbSNP
rs1435008498 2022 dbSNP
rs1333351013 2023 dbSNP
rs1324734873 2026 dbSNP
rs775960692 2029 dbSNP
rs1438977230 2030 dbSNP
rs1300349495 2038 dbSNP
rs1420537458 2042 dbSNP
rs1424605179 2054 dbSNP
rs906620808 2055 dbSNP
rs1479021587 2066 dbSNP
rs530042695 2067 dbSNP
rs1219465785 2069 dbSNP
rs1199979547 2081 dbSNP
rs541895837 2082 dbSNP
rs1034179874 2091 dbSNP
rs895184804 2092 dbSNP
rs116228456 2104 dbSNP
rs527814573 2109 dbSNP
rs1216996339 2110 dbSNP
rs1288997651 2113 dbSNP
rs1451983630 2119 dbSNP
rs1218544710 2123 dbSNP
rs1022569604 2127 dbSNP
rs1271875650 2132 dbSNP
rs552324269 2133 dbSNP
rs966921797 2141 dbSNP
rs1224354890 2145 dbSNP
rs978670982 2153 dbSNP
rs1358830089 2157 dbSNP
rs34772673 2162 dbSNP
rs1260745954 2171 dbSNP
rs1487784926 2175 dbSNP
rs1332391021 2177 dbSNP
rs1019072643 2178 dbSNP
rs1193895279 2179 dbSNP
rs1177147067 2180 dbSNP
rs966607297 2181 dbSNP
rs549363985 2186 dbSNP
rs976562606 2190 dbSNP
rs1374327720 2192 dbSNP
rs1471493671 2193 dbSNP
rs1163198845 2197 dbSNP
rs570600215 2203 dbSNP
rs1407567414 2209 dbSNP
rs1443695910 2214 dbSNP
rs531622384 2223 dbSNP
rs1296802594 2233 dbSNP
rs1360267358 2236 dbSNP
rs1400887253 2237 dbSNP
rs1219666620 2239 dbSNP
rs1300232764 2242 dbSNP
rs932343624 2245 dbSNP
rs1338798861 2250 dbSNP
rs1282659742 2256 dbSNP
rs1450449847 2260 dbSNP
rs1341186053 2261 dbSNP
rs1330734527 2263 dbSNP
rs1244084304 2266 dbSNP
rs1034817793 2267 dbSNP
rs983728870 2271 dbSNP
rs960616355 2272 dbSNP
rs1283533610 2274 dbSNP
rs909817272 2281 dbSNP
rs972048085 2300 dbSNP
rs1357036405 2303 dbSNP
rs1412779527 2305 dbSNP
rs939919869 2310 dbSNP
rs375357238 2323 dbSNP
rs1037277099 2324 dbSNP
rs930691400 2327 dbSNP
rs1177495816 2335 dbSNP
rs1456042235 2337 dbSNP
rs569543574 2338 dbSNP
rs906408022 2341 dbSNP
rs895206213 2342 dbSNP
rs939175439 2342 dbSNP
rs1360464560 2343 dbSNP
rs910646898 2347 dbSNP
rs1043711256 2351 dbSNP
rs1379128765 2360 dbSNP
rs751683742 2366 dbSNP
rs1442827706 2381 dbSNP
rs1349132574 2387 dbSNP
rs1162408289 2388 dbSNP
rs1216908138 2389 dbSNP
rs1263325944 2390 dbSNP
rs1157606740 2391 dbSNP
rs1437293818 2395 dbSNP
rs74341781 2398 dbSNP
rs1440196585 2402 dbSNP
rs1186305730 2406 dbSNP
rs568012291 2407 dbSNP
rs538185514 2420 dbSNP
rs1040520108 2422 dbSNP
rs902057567 2431 dbSNP
rs1420639741 2435 dbSNP
rs1285590323 2438 dbSNP
rs763828421 2440 dbSNP
rs934816841 2441 dbSNP
rs1238225717 2446 dbSNP
rs535464502 2457 dbSNP
rs996731253 2458 dbSNP
rs181445783 2459 dbSNP
rs893359519 2461 dbSNP
rs544961545 2464 dbSNP
rs1010588514 2485 dbSNP
rs1417480466 2495 dbSNP
rs1381670559 2518 dbSNP
rs1200705704 2520 dbSNP
rs983760034 2527 dbSNP
rs1432051192 2531 dbSNP
rs867022089 2538 dbSNP
rs904951379 2544 dbSNP
rs1193366813 2549 dbSNP
rs4558253 2558 dbSNP
rs1490631262 2572 dbSNP
rs1400256412 2579 dbSNP
rs1001915141 2589 dbSNP
rs1214768086 2593 dbSNP
rs1334987021 2602 dbSNP
rs1034767893 2625 dbSNP
rs1209550667 2627 dbSNP
rs1310452364 2630 dbSNP
rs960566117 2644 dbSNP
rs139995450 2651 dbSNP
rs539205814 2661 dbSNP
rs1375889856 2664 dbSNP
rs1240515964 2665 dbSNP
rs1262263186 2667 dbSNP
rs927860561 2678 dbSNP
rs750991935 2681 dbSNP
rs1386722217 2683 dbSNP
rs1342508225 2693 dbSNP
rs1465120516 2695 dbSNP
rs878995010 2697 dbSNP
rs1356913624 2724 dbSNP
rs1178948680 2726 dbSNP
rs1026256578 2737 dbSNP
rs1423412551 2739 dbSNP
rs757515483 2746 dbSNP
rs952025302 2754 dbSNP
rs369538490 2764 dbSNP
rs115385478 2783 dbSNP
rs1177338958 2800 dbSNP
rs1200034077 2805 dbSNP
rs1238043091 2809 dbSNP
rs1440705255 2814 dbSNP
rs1205529597 2816 dbSNP
rs1043829959 2844 dbSNP
rs1184508642 2859 dbSNP
rs1216570253 2872 dbSNP
rs1376257988 2881 dbSNP
rs186587512 2882 dbSNP
rs4418904 2890 dbSNP
rs1295916167 2893 dbSNP
rs902545688 2900 dbSNP
rs999921168 2910 dbSNP
rs964677388 2914 dbSNP
rs1469825021 2932 dbSNP
rs781347436 2937 dbSNP
rs1169086918 2948 dbSNP
rs761412089 2954 dbSNP
rs1373981525 2959 dbSNP
rs1463869419 2959 dbSNP
rs1464074061 2970 dbSNP
rs1187188022 2971 dbSNP
rs923344293 2975 dbSNP
rs1329228378 2984 dbSNP
rs750796989 2986 dbSNP
rs1258415423 3001 dbSNP
rs934868352 3008 dbSNP
rs1447406358 3009 dbSNP
rs1457320649 3014 dbSNP
rs1053672061 3027 dbSNP
rs1196659173 3037 dbSNP
rs1341289790 3039 dbSNP
rs1308946086 3044 dbSNP
rs1251639219 3047 dbSNP
rs1243672238 3051 dbSNP
rs1319573828 3056 dbSNP
rs1329110630 3069 dbSNP
rs1452739475 3070 dbSNP
rs1375447904 3078 dbSNP
rs1329992226 3085 dbSNP
rs551554037 3089 dbSNP
rs571532617 3092 dbSNP
rs1275030349 3095 dbSNP
rs539213835 3096 dbSNP
rs1456669807 3098 dbSNP
rs1387315985 3099 dbSNP
rs1325089627 3101 dbSNP
rs1439226298 3105 dbSNP
rs192248836 3109 dbSNP
rs1236428337 3114 dbSNP
rs1176744110 3124 dbSNP
rs996313926 3128 dbSNP
rs1251091635 3134 dbSNP
rs1438254670 3136 dbSNP
rs947594060 3138 dbSNP
rs1487345865 3148 dbSNP
rs1196138393 3152 dbSNP
rs1256864846 3153 dbSNP
rs1043415208 3155 dbSNP
rs904899099 3164 dbSNP
rs1198038341 3172 dbSNP
rs1001864391 3182 dbSNP
rs767194450 3185 dbSNP
rs574459901 3189 dbSNP
rs1265744668 3195 dbSNP
rs376458374 3212 dbSNP
rs541804082 3213 dbSNP
rs143156747 3214 dbSNP
rs993364593 3220 dbSNP
rs1026530907 3224 dbSNP
rs1199867625 3236 dbSNP
rs1185862417 3237 dbSNP
rs533625103 3246 dbSNP
rs1476959921 3252 dbSNP
rs1170130903 3266 dbSNP
rs1401092039 3269 dbSNP
rs1198011773 3282 dbSNP
rs961102297 3283 dbSNP
rs1270771792 3289 dbSNP
rs182703948 3304 dbSNP
rs1017464985 3309 dbSNP
rs1283382665 3311 dbSNP
rs1388341717 3315 dbSNP
rs564265267 3321 dbSNP
rs990652600 3326 dbSNP
rs1323814806 3336 dbSNP
rs1347821982 3338 dbSNP
rs1284300390 3342 dbSNP
rs549897804 3349 dbSNP
rs1358897527 3350 dbSNP
rs1250218767 3352 dbSNP
rs1320461384 3353 dbSNP
rs976036179 3362 dbSNP
rs1401374405 3368 dbSNP
rs1401569231 3369 dbSNP
rs749825654 3376 dbSNP
rs956289802 3377 dbSNP
rs531407945 3378 dbSNP
rs1216403351 3385 dbSNP
rs946523366 3390 dbSNP
rs778070640 3410 dbSNP
rs1317947921 3416 dbSNP
rs550071378 3422 dbSNP
rs1240015197 3424 dbSNP
rs1194855692 3441 dbSNP
rs1447139560 3450 dbSNP
rs185988903 3467 dbSNP
rs935365042 3471 dbSNP
rs1264143561 3477 dbSNP
rs529233575 3478 dbSNP
rs750382926 3481 dbSNP
rs1264256310 3486 dbSNP
rs1218412650 3496 dbSNP
rs1488359601 3504 dbSNP
rs1210878062 3508 dbSNP
rs1272207810 3512 dbSNP
rs1431749170 3513 dbSNP
rs1044704901 3520 dbSNP
rs1470970927 3521 dbSNP
rs1408254982 3530 dbSNP
rs1176989169 3533 dbSNP
rs1464958308 3537 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              ||| | |   :|||||| 
Target 5' ----CACGACU---GCACUCCa 3'
1 - 15
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000308086.2 | 3UTR | CACGACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*