miRTarBase - #MIRT627140 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HS3ST1   
Synonyms 3OST, 3OST1
Description heparan sulfate-glucosamine 3-sulfotransferase 1
Transcript NM_005114   
Putative miRNA Targets on HS3ST1
3'UTR of HS3ST1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
              ||: : | |:||| ||| 
396 - 417 122.00 -6.50
              ||| :|| | | ||:||| 
539 - 561 114.00 -8.23
            || | :| |||  ||::||:| 
651 - 674 108.00 -8.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30108513 19 COSMIC
COSN30533412 30 COSMIC
COSN30172780 45 COSMIC
COSN31498312 47 COSMIC
COSN14089787 59 COSMIC
COSN1980751 92 COSMIC
COSN30533184 141 COSMIC
COSN31538058 186 COSMIC
COSN29148114 231 COSMIC
COSN16308029 233 COSMIC
COSN27222988 263 COSMIC
COSN31544307 339 COSMIC
COSN31590372 341 COSMIC
COSN9585253 460 COSMIC
COSN9585252 524 COSMIC
COSN29838787 875 COSMIC
COSN19389329 966 COSMIC
COSN5807406 1003 COSMIC
COSN22079329 1308 COSMIC
COSN26718288 1607 COSMIC
COSN24860126 1613 COSMIC
COSN9585249 1640 COSMIC
COSN15678373 1650 COSMIC
COSN1285511 1808 COSMIC
COSN1980745 1897 COSMIC
COSN19300655 2177 COSMIC
COSN5549244 2290 COSMIC
COSN21676646 2441 COSMIC
COSN4824112 2474 COSMIC
COSN14948200 3008 COSMIC
COSN28201880 3027 COSMIC
COSN17663637 3076 COSMIC
COSN9899446 3152 COSMIC
COSN7771404 3271 COSMIC
COSN21486946 3471 COSMIC
COSN18753611 3587 COSMIC
COSN5549241 3806 COSMIC
COSN15805359 3865 COSMIC
COSN1980740 4044 COSMIC
COSN16501447 4190 COSMIC
COSN22890563 4350 COSMIC
COSN21946819 4395 COSMIC
COSN19002049 4430 COSMIC
COSN1980738 4444 COSMIC
COSN5007438 4517 COSMIC
COSN9585245 4621 COSMIC
COSN18019254 4703 COSMIC
COSN21735239 4794 COSMIC
COSN21998281 4914 COSMIC
COSN27131201 5108 COSMIC
COSN21845919 5246 COSMIC
COSN9585242 5323 COSMIC
COSN1980735 5364 COSMIC
COSN26389739 5399 COSMIC
COSN9585240 5460 COSMIC
COSN30012221 5504 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774394079 1 dbSNP
rs1229205684 4 dbSNP
rs766291519 6 dbSNP
rs572965853 12 dbSNP
rs757253292 19 dbSNP
rs1380521317 21 dbSNP
rs1305017682 23 dbSNP
rs772752327 25 dbSNP
rs1387504236 26 dbSNP
rs761514236 28 dbSNP
rs773985479 32 dbSNP
rs770083987 34 dbSNP
rs1379589148 35 dbSNP
rs1266374762 38 dbSNP
rs1163458303 49 dbSNP
rs746191390 50 dbSNP
rs372359750 57 dbSNP
rs1158482826 61 dbSNP
rs1378997684 62 dbSNP
rs1422103105 65 dbSNP
rs1355143778 66 dbSNP
rs1299368368 68 dbSNP
rs896827726 69 dbSNP
rs1384574185 73 dbSNP
rs1325052659 77 dbSNP
rs1331391344 81 dbSNP
rs1393547143 82 dbSNP
rs1404069241 86 dbSNP
rs564161133 89 dbSNP
rs150675188 93 dbSNP
rs941128038 97 dbSNP
rs11559237 111 dbSNP
rs16881384 112 dbSNP
rs116045382 134 dbSNP
rs535416542 136 dbSNP
rs1480691560 140 dbSNP
rs934247966 144 dbSNP
rs1290981983 145 dbSNP
rs1355644890 149 dbSNP
rs1208147308 151 dbSNP
rs1234066293 171 dbSNP
rs1269721120 175 dbSNP
rs929659743 195 dbSNP
rs1178377311 196 dbSNP
rs1219345766 199 dbSNP
rs917477854 200 dbSNP
rs1441966846 215 dbSNP
rs993067048 219 dbSNP
rs1368414230 227 dbSNP
rs141925494 233 dbSNP
rs1234920154 236 dbSNP
rs77935499 239 dbSNP
rs185978021 249 dbSNP
rs746145633 255 dbSNP
rs989539147 257 dbSNP
rs1223378723 261 dbSNP
rs1374205184 262 dbSNP
rs1299938891 263 dbSNP
rs1314216358 263 dbSNP
rs959465386 263 dbSNP
rs968794152 272 dbSNP
rs1020799528 273 dbSNP
rs1375511893 276 dbSNP
rs60081429 276 dbSNP
rs768059468 276 dbSNP
rs1256406502 280 dbSNP
rs1010216982 284 dbSNP
rs181365987 291 dbSNP
rs998133599 292 dbSNP
rs1463350462 295 dbSNP
rs563200126 297 dbSNP
rs1464675044 303 dbSNP
rs1168005256 304 dbSNP
rs1039498265 305 dbSNP
rs1302114082 305 dbSNP
rs1465934099 305 dbSNP
rs552527245 316 dbSNP
rs1397764954 320 dbSNP
rs1410165135 321 dbSNP
rs1157946514 326 dbSNP
rs1419281840 335 dbSNP
rs1218107291 338 dbSNP
rs1175050385 341 dbSNP
rs1276529669 342 dbSNP
rs1409607449 344 dbSNP
rs1005807790 346 dbSNP
rs1188935376 350 dbSNP
rs888175588 351 dbSNP
rs980376726 354 dbSNP
rs1453206476 356 dbSNP
rs553478979 367 dbSNP
rs1215438989 371 dbSNP
rs1190942969 372 dbSNP
rs570404256 375 dbSNP
rs916942494 377 dbSNP
rs538612870 380 dbSNP
rs994105543 388 dbSNP
rs1303301465 389 dbSNP
rs1296471658 391 dbSNP
rs1399475314 391 dbSNP
rs937634604 391 dbSNP
rs770420479 392 dbSNP
rs1016574043 393 dbSNP
rs1215338446 402 dbSNP
rs1300880595 403 dbSNP
rs1310738996 405 dbSNP
rs1217564304 409 dbSNP
rs1235900176 413 dbSNP
rs1257079805 415 dbSNP
rs1370256836 422 dbSNP
rs1488288002 423 dbSNP
rs1313413524 431 dbSNP
rs1213786265 434 dbSNP
rs1304852141 438 dbSNP
rs1488343814 441 dbSNP
rs978923054 441 dbSNP
rs969308913 448 dbSNP
rs1005240760 449 dbSNP
rs1443690254 452 dbSNP
rs1422639880 461 dbSNP
rs913297053 466 dbSNP
rs781127867 473 dbSNP
rs1454043753 474 dbSNP
rs1417843716 476 dbSNP
rs548909125 492 dbSNP
rs1299990019 493 dbSNP
rs1362498776 494 dbSNP
rs1431574207 500 dbSNP
rs1293099335 505 dbSNP
rs988922836 506 dbSNP
rs889561222 517 dbSNP
rs1304679610 518 dbSNP
rs528848932 519 dbSNP
rs1238546584 520 dbSNP
rs996180497 526 dbSNP
rs866031301 527 dbSNP
rs138605180 532 dbSNP
rs1244619570 535 dbSNP
rs1489281968 593 dbSNP
rs1018623432 597 dbSNP
rs1043000132 599 dbSNP
rs945627356 607 dbSNP
rs751603665 618 dbSNP
rs915225449 620 dbSNP
rs1348326567 621 dbSNP
rs1459683772 625 dbSNP
rs1326853219 632 dbSNP
rs1395105968 639 dbSNP
rs1046787870 640 dbSNP
rs1445047398 641 dbSNP
rs1447545417 642 dbSNP
rs1260857215 643 dbSNP
rs546659450 649 dbSNP
rs528202201 654 dbSNP
rs1227216887 655 dbSNP
rs1287193947 657 dbSNP
rs564301820 663 dbSNP
rs938066937 666 dbSNP
rs1257041550 668 dbSNP
rs188613278 670 dbSNP
rs895484550 671 dbSNP
rs926738624 672 dbSNP
rs1472447675 680 dbSNP
rs982220710 685 dbSNP
rs144632919 688 dbSNP
rs937012201 689 dbSNP
rs1165842371 694 dbSNP
rs1347272564 698 dbSNP
rs1464388314 701 dbSNP
rs140810768 706 dbSNP
rs1237198795 708 dbSNP
rs1363624005 713 dbSNP
rs185498516 727 dbSNP
rs1282978553 732 dbSNP
rs1380627322 733 dbSNP
rs947566627 735 dbSNP
rs961300231 738 dbSNP
rs180911291 746 dbSNP
rs1005211408 750 dbSNP
rs1200266479 751 dbSNP
rs1273507468 753 dbSNP
rs1441654346 761 dbSNP
rs553129730 767 dbSNP
rs953796271 768 dbSNP
rs1207884501 772 dbSNP
rs778875486 780 dbSNP
rs988889947 783 dbSNP
rs954735469 788 dbSNP
rs1028453391 790 dbSNP
rs1300734357 798 dbSNP
rs754885429 799 dbSNP
rs1375562088 800 dbSNP
rs997955411 811 dbSNP
rs1174967240 815 dbSNP
rs1297085585 818 dbSNP
rs753669930 827 dbSNP
rs1220037324 843 dbSNP
rs541496753 844 dbSNP
rs965092551 846 dbSNP
rs1018173249 851 dbSNP
rs1280646365 852 dbSNP
rs1042582545 854 dbSNP
rs1211661819 857 dbSNP
rs1262505768 859 dbSNP
rs1009807800 861 dbSNP
rs1487369109 865 dbSNP
rs189017138 866 dbSNP
rs952570562 874 dbSNP
rs1053785109 877 dbSNP
rs1485450265 878 dbSNP
rs757594973 884 dbSNP
rs937955606 889 dbSNP
rs926651443 898 dbSNP
rs1435935805 901 dbSNP
rs1158596516 904 dbSNP
rs1358025347 913 dbSNP
rs1401312470 915 dbSNP
rs1318503083 918 dbSNP
rs1258401628 921 dbSNP
rs1330221239 928 dbSNP
rs993966209 942 dbSNP
rs1276449588 945 dbSNP
rs765640824 946 dbSNP
rs115897937 954 dbSNP
rs1239291227 955 dbSNP
rs1283807417 960 dbSNP
rs949516299 972 dbSNP
rs1337454006 981 dbSNP
rs1207034112 984 dbSNP
rs1035420365 990 dbSNP
rs1259697255 997 dbSNP
rs1451287328 998 dbSNP
rs917052348 1006 dbSNP
rs1251273007 1011 dbSNP
rs1197169863 1014 dbSNP
rs1255227956 1022 dbSNP
rs1228731254 1027 dbSNP
rs972570421 1030 dbSNP
rs1178491437 1039 dbSNP
rs961269447 1045 dbSNP
rs1454882623 1046 dbSNP
rs905553301 1054 dbSNP
rs537602992 1058 dbSNP
rs1043304219 1060 dbSNP
rs755816949 1067 dbSNP
rs1325155109 1079 dbSNP
rs984008524 1081 dbSNP
rs1445794540 1082 dbSNP
rs1413855739 1085 dbSNP
rs947666782 1088 dbSNP
rs1241231655 1091 dbSNP
rs137904234 1094 dbSNP
rs1214592865 1097 dbSNP
rs951238456 1098 dbSNP
rs1025500570 1100 dbSNP
rs1355755153 1102 dbSNP
rs185754145 1115 dbSNP
rs1275285776 1138 dbSNP
rs933488064 1148 dbSNP
rs772987869 1154 dbSNP
rs1236853551 1167 dbSNP
rs1421449454 1169 dbSNP
rs975257257 1169 dbSNP
rs555273547 1178 dbSNP
rs909239195 1179 dbSNP
rs1166579218 1188 dbSNP
rs193049953 1189 dbSNP
rs1021530486 1190 dbSNP
rs764156994 1191 dbSNP
rs893981580 1192 dbSNP
rs1398512258 1199 dbSNP
rs952699797 1205 dbSNP
rs1054006137 1219 dbSNP
rs1339878937 1227 dbSNP
rs972512885 1241 dbSNP
rs1002469502 1243 dbSNP
rs763193169 1245 dbSNP
rs1295334478 1250 dbSNP
rs1335815121 1253 dbSNP
rs775700200 1255 dbSNP
rs1046417895 1258 dbSNP
rs959887169 1265 dbSNP
rs949486251 1275 dbSNP
rs189054265 1279 dbSNP
rs1418852105 1285 dbSNP
rs1440186295 1286 dbSNP
rs1036825594 1290 dbSNP
rs549187091 1293 dbSNP
rs1418089871 1297 dbSNP
rs1477316869 1298 dbSNP
rs546325728 1299 dbSNP
rs1462306576 1300 dbSNP
rs1302132200 1303 dbSNP
rs527363523 1307 dbSNP
rs765896311 1308 dbSNP
rs528179082 1309 dbSNP
rs1218207819 1310 dbSNP
rs1293710914 1328 dbSNP
rs1309575057 1330 dbSNP
rs933458518 1331 dbSNP
rs184290129 1332 dbSNP
rs920913847 1334 dbSNP
rs1271726104 1338 dbSNP
rs868666338 1353 dbSNP
rs560747028 1364 dbSNP
rs1039110616 1365 dbSNP
rs527526782 1369 dbSNP
rs551856135 1376 dbSNP
rs530588797 1378 dbSNP
rs560555409 1404 dbSNP
rs1376078811 1406 dbSNP
rs985163759 1408 dbSNP
rs929322971 1412 dbSNP
rs918484228 1418 dbSNP
rs79735574 1425 dbSNP
rs1301078072 1438 dbSNP
rs1346191406 1440 dbSNP
rs958162483 1442 dbSNP
rs1032529482 1464 dbSNP
rs747282064 1466 dbSNP
rs772981453 1478 dbSNP
rs1325060074 1498 dbSNP
rs1262117935 1511 dbSNP
rs771606919 1512 dbSNP
rs1190295790 1534 dbSNP
rs541708100 1539 dbSNP
rs1455426249 1555 dbSNP
rs1013627899 1564 dbSNP
rs1167434277 1567 dbSNP
rs1468764506 1569 dbSNP
rs1379680929 1573 dbSNP
rs897825454 1574 dbSNP
rs1157066991 1585 dbSNP
rs529975055 1593 dbSNP
rs1347165659 1596 dbSNP
rs1021387071 1602 dbSNP
rs1293188979 1607 dbSNP
rs1369145511 1617 dbSNP
rs1011634781 1619 dbSNP
rs1036373289 1627 dbSNP
rs955716084 1633 dbSNP
rs942134173 1637 dbSNP
rs1308577763 1641 dbSNP
rs191857314 1645 dbSNP
rs1420894650 1650 dbSNP
rs997802848 1653 dbSNP
rs1048243338 1655 dbSNP
rs1270898134 1656 dbSNP
rs932551213 1658 dbSNP
rs1214165175 1663 dbSNP
rs541109586 1667 dbSNP
rs1237458183 1668 dbSNP
rs977074881 1671 dbSNP
rs1178897317 1678 dbSNP
rs1469210426 1695 dbSNP
rs1039575524 1698 dbSNP
rs1007736141 1699 dbSNP
rs1392631396 1701 dbSNP
rs773758326 1703 dbSNP
rs1463342819 1706 dbSNP
rs1327042904 1711 dbSNP
rs1275416360 1713 dbSNP
rs943683761 1722 dbSNP
rs1373350419 1723 dbSNP
rs545139587 1723 dbSNP
rs987865346 1724 dbSNP
rs957796005 1739 dbSNP
rs1032499981 1740 dbSNP
rs143434706 1742 dbSNP
rs929293634 1747 dbSNP
rs1279688709 1748 dbSNP
rs1257133821 1764 dbSNP
rs919291810 1772 dbSNP
rs1233403375 1774 dbSNP
rs1480994656 1775 dbSNP
rs34441222 1775 dbSNP
rs1181425987 1781 dbSNP
rs186993820 1794 dbSNP
rs35191148 1795 dbSNP
rs970041807 1814 dbSNP
rs1025187351 1823 dbSNP
rs1528081 1824 dbSNP
rs1302609358 1826 dbSNP
rs148912004 1830 dbSNP
rs1441516775 1843 dbSNP
rs867400759 1848 dbSNP
rs1408585640 1857 dbSNP
rs1331441877 1859 dbSNP
rs1446609212 1861 dbSNP
rs1310593049 1862 dbSNP
rs1396457294 1872 dbSNP
rs60545804 1875 dbSNP
rs928577293 1881 dbSNP
rs536948262 1885 dbSNP
rs1337142546 1887 dbSNP
rs1216173061 1894 dbSNP
rs1273625859 1896 dbSNP
rs1311575171 1904 dbSNP
rs1210225603 1905 dbSNP
rs1315953159 1908 dbSNP
rs1014899410 1909 dbSNP
rs1486697297 1912 dbSNP
rs182773683 1920 dbSNP
rs554456408 1928 dbSNP
rs192724806 1935 dbSNP
rs1474627745 1936 dbSNP
rs187478912 1939 dbSNP
rs969934272 1940 dbSNP
rs1048209791 1941 dbSNP
rs1414348069 1943 dbSNP
rs1159300384 1956 dbSNP
rs1172345602 1959 dbSNP
rs1376676438 1962 dbSNP
rs551818971 1969 dbSNP
rs1297189516 1974 dbSNP
rs1455442517 1975 dbSNP
rs914287491 1981 dbSNP
rs1393297359 1987 dbSNP
rs370573608 1988 dbSNP
rs899672245 1990 dbSNP
rs1193617750 2013 dbSNP
rs1366675779 2014 dbSNP
rs1231942255 2020 dbSNP
rs1040938966 2021 dbSNP
rs1350127369 2040 dbSNP
rs34997792 2041 dbSNP
rs1211771903 2043 dbSNP
rs943969719 2044 dbSNP
rs1255360514 2045 dbSNP
rs1191471989 2053 dbSNP
rs1446727844 2054 dbSNP
rs1243013136 2056 dbSNP
rs1454107538 2058 dbSNP
rs569494990 2064 dbSNP
rs1192246058 2066 dbSNP
rs955683843 2071 dbSNP
rs913551084 2073 dbSNP
rs1031381410 2080 dbSNP
rs548030331 2087 dbSNP
rs1382300796 2091 dbSNP
rs1402035973 2093 dbSNP
rs1206475590 2104 dbSNP
rs936399033 2110 dbSNP
rs1318601151 2112 dbSNP
rs1349031844 2114 dbSNP
rs1438515382 2114 dbSNP
rs1345179837 2120 dbSNP
rs1305529178 2124 dbSNP
rs1371689340 2125 dbSNP
rs925063820 2128 dbSNP
rs1278953405 2133 dbSNP
rs779797351 2138 dbSNP
rs1235008696 2144 dbSNP
rs1278981597 2147 dbSNP
rs755941546 2149 dbSNP
rs145600022 2150 dbSNP
rs1429772897 2154 dbSNP
rs149725252 2159 dbSNP
rs142123164 2161 dbSNP
rs1455123965 2162 dbSNP
rs962294581 2162 dbSNP
rs1402058168 2164 dbSNP
rs1014868562 2167 dbSNP
rs1006215809 2168 dbSNP
rs1416802718 2170 dbSNP
rs1327725040 2171 dbSNP
rs1459646232 2171 dbSNP
rs750181626 2172 dbSNP
rs1029042047 2176 dbSNP
rs996677501 2184 dbSNP
rs899640687 2201 dbSNP
rs1041298910 2209 dbSNP
rs993580020 2211 dbSNP
rs1008134972 2214 dbSNP
rs897913841 2215 dbSNP
rs1280357633 2216 dbSNP
rs1334493803 2217 dbSNP
rs1056356796 2221 dbSNP
rs376266368 2224 dbSNP
rs1243032047 2226 dbSNP
rs758673598 2227 dbSNP
rs532376022 2228 dbSNP
rs147696483 2237 dbSNP
rs79730152 2238 dbSNP
rs924951071 2242 dbSNP
rs1044794557 2255 dbSNP
rs1166682499 2264 dbSNP
rs1418216806 2274 dbSNP
rs1210992669 2276 dbSNP
rs1349328238 2278 dbSNP
rs1393185425 2280 dbSNP
rs1398636084 2280 dbSNP
rs576655940 2282 dbSNP
rs561457630 2285 dbSNP
rs759642481 2288 dbSNP
rs918075731 2291 dbSNP
rs1213873306 2293 dbSNP
rs1413122751 2298 dbSNP
rs992769232 2301 dbSNP
rs781416377 2303 dbSNP
rs757441606 2304 dbSNP
rs908092903 2307 dbSNP
rs1339893655 2312 dbSNP
rs934359722 2313 dbSNP
rs1342144276 2315 dbSNP
rs542812236 2316 dbSNP
rs1256142355 2325 dbSNP
rs985014011 2328 dbSNP
rs975720476 2335 dbSNP
rs965760950 2336 dbSNP
rs1257855034 2338 dbSNP
rs145493849 2339 dbSNP
rs1353787754 2344 dbSNP
rs1374705709 2347 dbSNP
rs986431967 2348 dbSNP
rs1312443904 2357 dbSNP
rs544605284 2362 dbSNP
rs1374859098 2367 dbSNP
rs1029426537 2368 dbSNP
rs1314998406 2371 dbSNP
rs1380218229 2374 dbSNP
rs1381986001 2383 dbSNP
rs1012671705 2391 dbSNP
rs1027737745 2394 dbSNP
rs996256480 2405 dbSNP
rs554140473 2406 dbSNP
rs966554750 2420 dbSNP
rs1280254388 2421 dbSNP
rs1019436378 2424 dbSNP
rs1008105524 2433 dbSNP
rs892306805 2435 dbSNP
rs1159008556 2440 dbSNP
rs1035084766 2444 dbSNP
rs1003480345 2447 dbSNP
rs139976517 2450 dbSNP
rs1409861437 2452 dbSNP
rs576412351 2463 dbSNP
rs948703902 2466 dbSNP
rs34521656 2467 dbSNP
rs1420746102 2468 dbSNP
rs893046898 2492 dbSNP
rs1359837141 2497 dbSNP
rs1453273111 2506 dbSNP
rs1455295816 2512 dbSNP
rs184127669 2515 dbSNP
rs1474396973 2519 dbSNP
rs934496428 2520 dbSNP
rs1436348693 2527 dbSNP
rs536748818 2530 dbSNP
rs569454707 2534 dbSNP
rs947818677 2542 dbSNP
rs1369485927 2543 dbSNP
rs1486380675 2551 dbSNP
rs1301302362 2554 dbSNP
rs1315848267 2559 dbSNP
rs1230657474 2566 dbSNP
rs1213133489 2567 dbSNP
rs116791539 2573 dbSNP
rs1486064762 2583 dbSNP
rs766732698 2584 dbSNP
rs1469724628 2590 dbSNP
rs536013572 2600 dbSNP
rs1425877572 2601 dbSNP
rs761155206 2603 dbSNP
rs1365829674 2606 dbSNP
rs1458069709 2610 dbSNP
rs1325715074 2613 dbSNP
rs984984075 2615 dbSNP
rs1392773596 2624 dbSNP
rs1443707994 2628 dbSNP
rs1333799544 2632 dbSNP
rs986201540 2638 dbSNP
rs377151277 2639 dbSNP
rs930920664 2641 dbSNP
rs565890207 2644 dbSNP
rs1308692992 2646 dbSNP
rs1329490740 2652 dbSNP
rs1232323386 2653 dbSNP
rs921941374 2653 dbSNP
rs1469653670 2655 dbSNP
rs147883611 2657 dbSNP
rs1232285920 2658 dbSNP
rs114933591 2659 dbSNP
rs1019409460 2660 dbSNP
rs962207728 2661 dbSNP
rs1473014792 2663 dbSNP
rs777756993 2666 dbSNP
rs1416063332 2668 dbSNP
rs1463358721 2672 dbSNP
rs1035053550 2673 dbSNP
rs1003665376 2675 dbSNP
rs1442190929 2677 dbSNP
rs1439357304 2684 dbSNP
rs905190380 2686 dbSNP
rs1023597252 2691 dbSNP
rs574243677 2697 dbSNP
rs773423012 2706 dbSNP
rs1011332786 2710 dbSNP
rs1291068214 2722 dbSNP
rs1336652980 2727 dbSNP
rs1333876124 2728 dbSNP
rs1228737323 2734 dbSNP
rs1460232359 2738 dbSNP
rs1394145935 2739 dbSNP
rs956499039 2742 dbSNP
rs190944046 2752 dbSNP
rs1000767380 2761 dbSNP
rs1054393959 2763 dbSNP
rs934464207 2766 dbSNP
rs903049850 2767 dbSNP
rs186227622 2769 dbSNP
rs1187421826 2771 dbSNP
rs1255746260 2777 dbSNP
rs903800281 2778 dbSNP
rs1176114832 2781 dbSNP
rs114368006 2784 dbSNP
rs1012284991 2791 dbSNP
rs896158789 2795 dbSNP
rs1408669782 2813 dbSNP
rs1239947394 2820 dbSNP
rs1173168508 2826 dbSNP
rs1211702764 2828 dbSNP
rs531745919 2830 dbSNP
rs1056110095 2831 dbSNP
rs771749617 2844 dbSNP
rs1310688667 2849 dbSNP
rs1357015001 2872 dbSNP
rs1448449882 2875 dbSNP
rs747826607 2883 dbSNP
rs910299058 2895 dbSNP
rs1050063358 2896 dbSNP
rs1049246391 2899 dbSNP
rs1210342657 2911 dbSNP
rs1214622202 2912 dbSNP
rs561317726 2915 dbSNP
rs1444396328 2936 dbSNP
rs1211123211 2948 dbSNP
rs1241821377 2952 dbSNP
rs1366484383 2954 dbSNP
rs1474638471 2962 dbSNP
rs1191038928 2963 dbSNP
rs1323712481 2964 dbSNP
rs1391392741 2965 dbSNP
rs773943170 2966 dbSNP
rs920826836 2974 dbSNP
rs1223297066 2975 dbSNP
rs115523183 2976 dbSNP
rs1312124517 2977 dbSNP
rs975026252 2979 dbSNP
rs562092186 2992 dbSNP
rs1298237939 2993 dbSNP
rs1370210407 2995 dbSNP
rs1233632032 2996 dbSNP
rs944670211 3000 dbSNP
rs962176581 3002 dbSNP
rs911911617 3004 dbSNP
rs1370774500 3008 dbSNP
rs982692299 3011 dbSNP
rs183002443 3012 dbSNP
rs1445628908 3017 dbSNP
rs549100766 3025 dbSNP
rs956134548 3028 dbSNP
rs1024154486 3029 dbSNP
rs142847645 3031 dbSNP
rs1468388879 3039 dbSNP
rs560769234 3045 dbSNP
rs1157834229 3054 dbSNP
rs1378798336 3059 dbSNP
rs142263419 3064 dbSNP
rs979295394 3069 dbSNP
rs1157623439 3070 dbSNP
rs1381600035 3079 dbSNP
rs1405427315 3082 dbSNP
rs77804215 3084 dbSNP
rs1321038708 3087 dbSNP
rs998809957 3088 dbSNP
rs903102479 3096 dbSNP
rs1253451823 3097 dbSNP
rs1327857497 3106 dbSNP
rs1332893037 3107 dbSNP
rs1192719435 3109 dbSNP
rs1023937461 3116 dbSNP
rs1279152910 3131 dbSNP
rs1348868021 3132 dbSNP
rs1230484094 3140 dbSNP
rs1269123872 3142 dbSNP
rs1012176188 3151 dbSNP
rs1212305526 3152 dbSNP
rs1270175204 3155 dbSNP
rs148801024 3165 dbSNP
rs1180521652 3184 dbSNP
rs896115007 3187 dbSNP
rs144374440 3188 dbSNP
rs536611156 3191 dbSNP
rs1004576019 3193 dbSNP
rs190455091 3194 dbSNP
rs372807203 3201 dbSNP
rs575637849 3202 dbSNP
rs1387399230 3211 dbSNP
rs1049216677 3217 dbSNP
rs1288215882 3218 dbSNP
rs765375305 3229 dbSNP
rs13127396 3234 dbSNP
rs1036570906 3237 dbSNP
rs879150362 3240 dbSNP
rs530482115 3242 dbSNP
rs755991551 3249 dbSNP
rs1446458352 3251 dbSNP
rs1388895188 3256 dbSNP
rs879223774 3259 dbSNP
rs368227196 3261 dbSNP
rs944997202 3262 dbSNP
rs1287949470 3275 dbSNP
rs754021331 3288 dbSNP
rs1483756885 3289 dbSNP
rs969981221 3304 dbSNP
rs911879698 3310 dbSNP
rs1256448751 3311 dbSNP
rs1053141855 3313 dbSNP
rs745727266 3315 dbSNP
rs1368851470 3320 dbSNP
rs916654139 3321 dbSNP
rs1395617701 3326 dbSNP
rs112478638 3327 dbSNP
rs1308864170 3331 dbSNP
rs1375111658 3336 dbSNP
rs958018476 3347 dbSNP
rs1426540689 3352 dbSNP
rs978874166 3357 dbSNP
rs1227263502 3364 dbSNP
rs968256263 3366 dbSNP
rs181156658 3367 dbSNP
rs991125578 3370 dbSNP
rs754170790 3371 dbSNP
rs1343675236 3375 dbSNP
rs960684242 3378 dbSNP
rs967256796 3382 dbSNP
rs1186190654 3385 dbSNP
rs1201852432 3389 dbSNP
rs571526772 3398 dbSNP
rs1265503673 3399 dbSNP
rs1392025310 3402 dbSNP
rs1451379904 3407 dbSNP
rs1169360965 3412 dbSNP
rs1374951257 3422 dbSNP
rs1208836976 3426 dbSNP
rs1004543464 3430 dbSNP
rs1050173728 3444 dbSNP
rs950391195 3445 dbSNP
rs4697886 3447 dbSNP
rs994610498 3455 dbSNP
rs900645725 3456 dbSNP
rs371910416 3460 dbSNP
rs1229811792 3462 dbSNP
rs1302010526 3483 dbSNP
rs1306162407 3485 dbSNP
rs1009551258 3487 dbSNP
rs1295297182 3490 dbSNP
rs940374239 3499 dbSNP
rs1214852100 3500 dbSNP
rs1256287676 3520 dbSNP
rs1485421189 3523 dbSNP
rs906763618 3530 dbSNP
rs1342000372 3533 dbSNP
rs1192966264 3534 dbSNP
rs537886503 3535 dbSNP
rs1310625739 3536 dbSNP
rs531709185 3541 dbSNP
rs567677986 3545 dbSNP
rs1378467015 3559 dbSNP
rs1413662718 3564 dbSNP
rs549192131 3565 dbSNP
rs1453469505 3568 dbSNP
rs1375467761 3570 dbSNP
rs1157329366 3573 dbSNP
rs1304561174 3578 dbSNP
rs368040963 3580 dbSNP
rs1372357888 3583 dbSNP
rs1388079193 3584 dbSNP
rs1170864961 3585 dbSNP
rs1478647702 3586 dbSNP
rs1426060055 3587 dbSNP
rs1226214169 3588 dbSNP
rs1186032141 3589 dbSNP
rs1212930667 3590 dbSNP
rs1329611079 3590 dbSNP
rs1485400119 3595 dbSNP
rs1256931383 3599 dbSNP
rs1487528248 3602 dbSNP
rs1202772308 3605 dbSNP
rs1193039015 3608 dbSNP
rs1491562245 3608 dbSNP
rs1157219887 3609 dbSNP
rs1164830274 3609 dbSNP
rs1268174265 3609 dbSNP
rs1293558033 3609 dbSNP
rs1348688930 3609 dbSNP
rs1418678951 3609 dbSNP
rs1491507443 3609 dbSNP
rs34905764 3609 dbSNP
rs761736361 3609 dbSNP
rs762625783 3609 dbSNP
rs1251183966 3610 dbSNP
rs1372026036 3611 dbSNP
rs1199663631 3612 dbSNP
rs1350878440 3612 dbSNP
rs1407546437 3612 dbSNP
rs1320399852 3615 dbSNP
rs1291081827 3623 dbSNP
rs934612399 3627 dbSNP
rs1232494389 3630 dbSNP
rs1287611851 3631 dbSNP
rs948234276 3631 dbSNP
rs1222256446 3641 dbSNP
rs925954005 3647 dbSNP
rs1355586460 3657 dbSNP
rs1180269409 3664 dbSNP
rs1043510257 3665 dbSNP
rs948852687 3673 dbSNP
rs1314246884 3674 dbSNP
rs1412106347 3675 dbSNP
rs1426036912 3676 dbSNP
rs1166120608 3685 dbSNP
rs1353358420 3686 dbSNP
rs112188632 3693 dbSNP
rs34140175 3694 dbSNP
rs555785535 3701 dbSNP
rs1413808592 3704 dbSNP
rs990701151 3710 dbSNP
rs989665414 3715 dbSNP
rs567561454 3723 dbSNP
rs1228755905 3726 dbSNP
rs1467023012 3742 dbSNP
rs927845536 3744 dbSNP
rs1277011617 3757 dbSNP
rs978061280 3759 dbSNP
rs983340990 3760 dbSNP
rs1236024577 3765 dbSNP
rs1272914945 3787 dbSNP
rs1018850057 3790 dbSNP
rs1419472315 3806 dbSNP
rs950358606 3808 dbSNP
rs1027297030 3813 dbSNP
rs1169882430 3814 dbSNP
rs1369184225 3817 dbSNP
rs191124360 3818 dbSNP
rs1331806592 3821 dbSNP
rs1448566132 3829 dbSNP
rs1288187225 3832 dbSNP
rs146361835 3841 dbSNP
rs1250475585 3847 dbSNP
rs1230550885 3850 dbSNP
rs549323791 3858 dbSNP
rs752993601 3861 dbSNP
rs185875800 3864 dbSNP
rs1276848741 3869 dbSNP
rs4697688 3870 dbSNP
rs370151680 3874 dbSNP
rs1247818643 3877 dbSNP
rs1463900607 3879 dbSNP
rs1356599403 3881 dbSNP
rs1009108600 3886 dbSNP
rs755116582 3893 dbSNP
rs890634153 3895 dbSNP
rs1477442294 3897 dbSNP
rs562796672 3898 dbSNP
rs906223242 3899 dbSNP
rs544526704 3900 dbSNP
rs1158042457 3902 dbSNP
rs13127432 3903 dbSNP
rs753844814 3904 dbSNP
rs1386223530 3907 dbSNP
rs1337434977 3909 dbSNP
rs575598901 3912 dbSNP
rs554585287 3913 dbSNP
rs1324953672 3916 dbSNP
rs904503740 3917 dbSNP
rs1391724536 3922 dbSNP
rs1273275226 3925 dbSNP
rs542337473 3926 dbSNP
rs948806193 3930 dbSNP
rs1165175891 3938 dbSNP
rs894598768 3944 dbSNP
rs13107815 3946 dbSNP
rs13125811 3949 dbSNP
rs75708147 3957 dbSNP
rs939155055 3962 dbSNP
rs1211110422 3968 dbSNP
rs553594236 3987 dbSNP
rs1450503989 3988 dbSNP
rs763750948 3988 dbSNP
rs944011771 3989 dbSNP
rs983308617 3993 dbSNP
rs566646730 3995 dbSNP
rs1409421298 4000 dbSNP
rs912591681 4002 dbSNP
rs1159811767 4003 dbSNP
rs1393698813 4006 dbSNP
rs929249338 4012 dbSNP
rs1193422547 4014 dbSNP
rs1332908160 4015 dbSNP
rs1437379625 4018 dbSNP
rs774385157 4028 dbSNP
rs868744450 4030 dbSNP
rs1202955849 4031 dbSNP
rs973128850 4038 dbSNP
rs766954011 4043 dbSNP
rs761053250 4051 dbSNP
rs1028924025 4063 dbSNP
rs762545699 4067 dbSNP
rs1451693464 4070 dbSNP
rs762974806 4070 dbSNP
rs762850723 4073 dbSNP
rs1473434467 4076 dbSNP
rs1182568128 4081 dbSNP
rs1014615502 4090 dbSNP
rs1471729250 4092 dbSNP
rs374323541 4095 dbSNP
rs1392953598 4098 dbSNP
rs181997814 4109 dbSNP
rs906198180 4112 dbSNP
rs1031866762 4113 dbSNP
rs1332556896 4115 dbSNP
rs556460925 4117 dbSNP
rs1411925504 4121 dbSNP
rs767889465 4125 dbSNP
rs1022040465 4128 dbSNP
rs1380711919 4137 dbSNP
rs1360051240 4138 dbSNP
rs1243181802 4147 dbSNP
rs895362465 4163 dbSNP
rs1054061869 4164 dbSNP
rs1159316703 4167 dbSNP
rs142503936 4168 dbSNP
rs1356438037 4172 dbSNP
rs1227087064 4181 dbSNP
rs1012880089 4183 dbSNP
rs1272018383 4186 dbSNP
rs137928441 4189 dbSNP
rs377016623 4197 dbSNP
rs1205431331 4200 dbSNP
rs762105532 4204 dbSNP
rs1173520077 4210 dbSNP
rs938786533 4221 dbSNP
rs1478575974 4227 dbSNP
rs775120356 4228 dbSNP
rs906358122 4228 dbSNP
rs1440541097 4237 dbSNP
rs1189528737 4239 dbSNP
rs527776678 4240 dbSNP
rs1042492538 4243 dbSNP
rs1445287669 4247 dbSNP
rs944080802 4253 dbSNP
rs551558144 4260 dbSNP
rs1379714835 4268 dbSNP
rs1298976449 4269 dbSNP
rs1401933900 4290 dbSNP
rs929219667 4297 dbSNP
rs376679435 4309 dbSNP
rs150301332 4315 dbSNP
rs973732274 4323 dbSNP
rs1050162787 4331 dbSNP
rs932688583 4345 dbSNP
rs1263377745 4346 dbSNP
rs1255121699 4348 dbSNP
rs943019449 4350 dbSNP
rs921835171 4351 dbSNP
rs1342573958 4354 dbSNP
rs6827485 4358 dbSNP
rs1256620760 4359 dbSNP
rs866068285 4364 dbSNP
rs954471731 4366 dbSNP
rs1246205666 4370 dbSNP
rs1451471892 4376 dbSNP
rs1171396324 4378 dbSNP
rs907755775 4380 dbSNP
rs533324857 4381 dbSNP
rs6828761 4388 dbSNP
rs141136396 4389 dbSNP
rs969294125 4395 dbSNP
rs1225592769 4397 dbSNP
rs529573119 4401 dbSNP
rs1021843887 4405 dbSNP
rs1340140139 4412 dbSNP
rs1013599357 4416 dbSNP
rs768292209 4419 dbSNP
rs1401958502 4420 dbSNP
rs148274045 4421 dbSNP
rs563298259 4423 dbSNP
rs970853427 4430 dbSNP
rs1024742845 4432 dbSNP
rs1373659859 4435 dbSNP
rs1328242193 4445 dbSNP
rs762583185 4446 dbSNP
rs1012306135 4458 dbSNP
rs1035678404 4461 dbSNP
rs1466288094 4465 dbSNP
rs1334146262 4472 dbSNP
rs959097153 4477 dbSNP
rs1318475145 4479 dbSNP
rs1431586413 4482 dbSNP
rs1201295147 4490 dbSNP
rs542568032 4510 dbSNP
rs1002901030 4511 dbSNP
rs887228250 4520 dbSNP
rs1001156205 4524 dbSNP
rs1391531308 4529 dbSNP
rs1415519620 4535 dbSNP
rs902769812 4536 dbSNP
rs1166506502 4540 dbSNP
rs1013274 4548 dbSNP
rs553802714 4549 dbSNP
rs1423929978 4551 dbSNP
rs1195329339 4555 dbSNP
rs993254506 4556 dbSNP
rs1013275 4557 dbSNP
rs189299043 4558 dbSNP
rs1037598294 4561 dbSNP
rs1210813236 4563 dbSNP
rs1444051379 4570 dbSNP
rs943302779 4573 dbSNP
rs1487578172 4574 dbSNP
rs1211851561 4578 dbSNP
rs1270728707 4594 dbSNP
rs1195017249 4596 dbSNP
rs910205011 4601 dbSNP
rs1051460028 4604 dbSNP
rs1180406008 4604 dbSNP
rs1414694304 4607 dbSNP
rs1279106019 4608 dbSNP
rs1049862180 4609 dbSNP
rs932631694 4614 dbSNP
rs184490120 4616 dbSNP
rs1283674755 4621 dbSNP
rs369644500 4623 dbSNP
rs977177114 4626 dbSNP
rs1369617434 4630 dbSNP
rs1407640566 4633 dbSNP
rs771155653 4633 dbSNP
rs1361406780 4635 dbSNP
rs941914979 4637 dbSNP
rs1227656024 4639 dbSNP
rs968885419 4641 dbSNP
rs143164510 4643 dbSNP
rs983663897 4645 dbSNP
rs970609658 4657 dbSNP
rs917644128 4659 dbSNP
rs1203286949 4660 dbSNP
rs990617820 4663 dbSNP
rs1481198048 4666 dbSNP
rs1401449183 4668 dbSNP
rs914743781 4669 dbSNP
rs1425022774 4670 dbSNP
rs991738248 4672 dbSNP
rs1163618200 4679 dbSNP
rs1389050830 4681 dbSNP
rs1459543852 4687 dbSNP
rs1427352012 4693 dbSNP
rs1031971423 4699 dbSNP
rs1447063068 4701 dbSNP
rs1000540560 4705 dbSNP
rs959243579 4707 dbSNP
rs78021049 4714 dbSNP
rs1315737497 4716 dbSNP
rs1021235780 4722 dbSNP
rs1002870034 4736 dbSNP
rs1008795523 4738 dbSNP
rs891323295 4749 dbSNP
rs555386276 4754 dbSNP
rs781230129 4763 dbSNP
rs1236111574 4771 dbSNP
rs1463017750 4776 dbSNP
rs770865949 4779 dbSNP
rs142266998 4780 dbSNP
rs898590971 4781 dbSNP
rs1170061158 4786 dbSNP
rs1180940244 4788 dbSNP
rs566777419 4791 dbSNP
rs35945701 4801 dbSNP
rs1458085612 4803 dbSNP
rs1413575504 4805 dbSNP
rs996012705 4808 dbSNP
rs551428198 4810 dbSNP
rs1259719619 4817 dbSNP
rs746738633 4818 dbSNP
rs373102912 4819 dbSNP
rs539579263 4822 dbSNP
rs1319875024 4825 dbSNP
rs889069902 4830 dbSNP
rs1272123883 4836 dbSNP
rs529277970 4839 dbSNP
rs949231972 4842 dbSNP
rs917797219 4843 dbSNP
rs1276870580 4851 dbSNP
rs1326125031 4862 dbSNP
rs1204856772 4868 dbSNP
rs1289357349 4895 dbSNP
rs1228990801 4898 dbSNP
rs796112057 4900 dbSNP
rs1194632492 4902 dbSNP
rs569088096 4903 dbSNP
rs1477452111 4906 dbSNP
rs1278342644 4907 dbSNP
rs556197024 4912 dbSNP
rs1446658054 4917 dbSNP
rs12644896 4918 dbSNP
rs1041464272 4919 dbSNP
rs181555880 4934 dbSNP
rs1458774867 4936 dbSNP
rs1320327818 4942 dbSNP
rs562358663 4945 dbSNP
rs779349036 4946 dbSNP
rs914733624 4948 dbSNP
rs1273360087 4949 dbSNP
rs992101714 4949 dbSNP
rs937607501 4950 dbSNP
rs115842010 4952 dbSNP
rs1288138124 4971 dbSNP
rs981670190 4972 dbSNP
rs1405135500 4983 dbSNP
rs1158018465 4988 dbSNP
rs951357244 4989 dbSNP
rs1450597467 4995 dbSNP
rs1025621457 5001 dbSNP
rs80065957 5004 dbSNP
rs1480629168 5020 dbSNP
rs1239845231 5026 dbSNP
rs34606081 5034 dbSNP
rs559925499 5042 dbSNP
rs368609954 5043 dbSNP
rs577857749 5044 dbSNP
rs562661167 5053 dbSNP
rs1007764987 5054 dbSNP
rs888959039 5063 dbSNP
rs74406451 5065 dbSNP
rs1030224696 5066 dbSNP
rs1048102011 5069 dbSNP
rs1222552964 5073 dbSNP
rs997453111 5074 dbSNP
rs1367626725 5082 dbSNP
rs544383140 5095 dbSNP
rs902833451 5100 dbSNP
rs13114517 5102 dbSNP
rs756167151 5110 dbSNP
rs748235824 5112 dbSNP
rs1055552707 5113 dbSNP
rs937473831 5117 dbSNP
rs750906032 5132 dbSNP
rs981639202 5139 dbSNP
rs945017110 5147 dbSNP
rs1204010228 5149 dbSNP
rs1249279186 5152 dbSNP
rs1439406585 5162 dbSNP
rs540491124 5167 dbSNP
rs767944435 5168 dbSNP
rs918577692 5169 dbSNP
rs1471780781 5170 dbSNP
rs974518560 5173 dbSNP
rs962744598 5176 dbSNP
rs1425471804 5177 dbSNP
rs762231929 5178 dbSNP
rs1293805568 5183 dbSNP
rs1394778923 5199 dbSNP
rs1393542106 5201 dbSNP
rs955619753 5204 dbSNP
rs1340343462 5207 dbSNP
rs555609957 5211 dbSNP
rs188771790 5215 dbSNP
rs1316451619 5229 dbSNP
rs985575453 5233 dbSNP
rs953168377 5234 dbSNP
rs1030193757 5236 dbSNP
rs1297030336 5244 dbSNP
rs779338027 5248 dbSNP
rs1341177276 5251 dbSNP
rs962876581 5258 dbSNP
rs184939469 5272 dbSNP
rs192604336 5273 dbSNP
rs1382104227 5278 dbSNP
rs1004292464 5286 dbSNP
rs1185357728 5290 dbSNP
rs1432428360 5292 dbSNP
rs751909261 5293 dbSNP
rs1188132096 5302 dbSNP
rs1371605404 5305 dbSNP
rs951547989 5307 dbSNP
rs1168813660 5310 dbSNP
rs1401953194 5316 dbSNP
rs1425566885 5320 dbSNP
rs1468648885 5322 dbSNP
rs573222735 5324 dbSNP
rs1014683278 5330 dbSNP
rs1433771751 5334 dbSNP
rs762483992 5342 dbSNP
rs1489579778 5344 dbSNP
rs1327786421 5347 dbSNP
rs569051580 5349 dbSNP
rs1255136517 5351 dbSNP
rs896379661 5352 dbSNP
rs892812433 5354 dbSNP
rs1002024828 5362 dbSNP
rs550663237 5364 dbSNP
rs371256563 5365 dbSNP
rs903722916 5367 dbSNP
rs1055924453 5368 dbSNP
rs1043494704 5369 dbSNP
rs1194187901 5371 dbSNP
rs1377414615 5375 dbSNP
rs775171063 5379 dbSNP
rs1479701598 5384 dbSNP
rs945070516 5397 dbSNP
rs769213237 5398 dbSNP
rs1457203439 5399 dbSNP
rs913650202 5399 dbSNP
rs1302410941 5403 dbSNP
rs907366346 5403 dbSNP
rs1045909900 5411 dbSNP
rs933672901 5412 dbSNP
rs536018120 5428 dbSNP
rs930224330 5434 dbSNP
rs1328341212 5438 dbSNP
rs77620994 5455 dbSNP
rs975669165 5456 dbSNP
rs962846998 5461 dbSNP
rs1038623637 5462 dbSNP
rs941329772 5467 dbSNP
rs1359450574 5470 dbSNP
rs910012909 5472 dbSNP
rs1489956809 5480 dbSNP
rs1201987270 5482 dbSNP
rs1430430222 5488 dbSNP
rs982920613 5489 dbSNP
rs1157627102 5493 dbSNP
rs1365023574 5497 dbSNP
rs373450683 5498 dbSNP
rs187976060 5500 dbSNP
rs1024828230 5501 dbSNP
rs1406424651 5501 dbSNP
rs1303462959 5505 dbSNP
rs1349668184 5509 dbSNP
rs1221994121 5515 dbSNP
rs1014238512 5518 dbSNP
rs1318782018 5523 dbSNP
rs1239926413 5524 dbSNP
rs528808682 5531 dbSNP
rs546385857 5535 dbSNP
rs1311033845 5541 dbSNP
rs1357506382 5548 dbSNP
rs368132763 5549 dbSNP
rs76320854 5551 dbSNP
rs942378410 5565 dbSNP
rs141679922 5571 dbSNP
rs975953056 5573 dbSNP
rs1175985564 5577 dbSNP
rs532964470 5577 dbSNP
rs1420219642 5584 dbSNP
rs967207811 5587 dbSNP
rs1426449043 5588 dbSNP
rs151189903 5591 dbSNP
rs372396790 5591 dbSNP
rs562523662 5595 dbSNP
rs1299795927 5598 dbSNP
rs1011507088 5603 dbSNP
rs145742207 5611 dbSNP
rs149777301 5617 dbSNP
rs561768815 5621 dbSNP
rs112007310 5623 dbSNP
rs722213 5625 dbSNP
rs1212694719 5630 dbSNP
rs722212 5631 dbSNP
rs941580676 5633 dbSNP
rs910147346 5635 dbSNP
rs1481222746 5643 dbSNP
rs1181811777 5644 dbSNP
rs1240699030 5649 dbSNP
rs1218824436 5655 dbSNP
rs1445967833 5660 dbSNP
rs1183813508 5662 dbSNP
rs994260351 5668 dbSNP
rs982889552 5671 dbSNP
rs545743961 5672 dbSNP
rs897333520 5674 dbSNP
rs1354921958 5675 dbSNP
rs1290887265 5676 dbSNP
rs1039002703 5681 dbSNP
rs951654434 5683 dbSNP
rs941645160 5693 dbSNP
rs917327101 5695 dbSNP
rs1315838651 5696 dbSNP
rs993356688 5705 dbSNP
rs1213060101 5706 dbSNP
rs911200267 5715 dbSNP
rs1308495580 5717 dbSNP
rs1034313416 5728 dbSNP
rs1261883485 5732 dbSNP
rs1462258002 5736 dbSNP
rs1049792137 5748 dbSNP
rs1203677618 5755 dbSNP
rs1460296257 5759 dbSNP
rs746845107 5760 dbSNP
rs934061537 5762 dbSNP
rs1474196899 5765 dbSNP
rs575255886 5766 dbSNP
rs978766647 5780 dbSNP
rs1419930649 5781 dbSNP
rs1432452693 5787 dbSNP
rs922643078 5788 dbSNP
rs1408135075 5793 dbSNP
rs1470260005 5796 dbSNP
rs777676259 5797 dbSNP
rs1344707769 5798 dbSNP
rs1428862919 5801 dbSNP
rs1272185391 5802 dbSNP
rs1363084397 5810 dbSNP
rs1223338320 5819 dbSNP
rs1281782172 5820 dbSNP
rs1466335893 5831 dbSNP
rs1425948011 5833 dbSNP
rs1224690862 5845 dbSNP
rs1282919157 5855 dbSNP
rs1185531156 5859 dbSNP
rs1217494751 5863 dbSNP
rs967930089 5873 dbSNP
rs1423255584 5882 dbSNP
rs1196936296 5888 dbSNP
rs967176753 5890 dbSNP
rs771857032 5895 dbSNP
rs1157975411 5909 dbSNP
rs1407306738 5911 dbSNP
rs1399096539 5915 dbSNP
rs1345948850 5917 dbSNP
rs1431926046 5919 dbSNP
rs1404570015 5924 dbSNP
rs557001166 5927 dbSNP
rs1009387777 5929 dbSNP
rs892326598 5932 dbSNP
rs112995161 5933 dbSNP
rs1406060982 5933 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084068
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000002596.5 | 3UTR | AGAUGAUGCCACUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084073
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000002596.5 | 3UTR | AGAUGAUGCCACUGCACUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084078
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000002596.5 | 3UTR | AGAUGAUGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1