miRTarBase - #MIRT626431 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CHDH   
Synonyms -
Description choline dehydrogenase
Transcript NM_018397   
Putative miRNA Targets on CHDH
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            ::||||| |   :|||||| 
Target 5' atGGCACCACT---GCACTCCa 3'
866 - 884 141.00 -18.40
            ::||: :| || |||| || 
770 - 790 123.00 -11.60
            :| ||:|| |  ||||||   
83 - 105 120.00 -9.82
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30101518 14 COSMIC
COSN19728387 17 COSMIC
COSN30100133 18 COSMIC
COSN30100151 21 COSMIC
COSN31574581 61 COSMIC
COSN31512375 85 COSMIC
COSN9721641 119 COSMIC
COSN30213323 188 COSMIC
COSN229055 299 COSMIC
COSN7763157 302 COSMIC
COSN16404822 303 COSMIC
COSN24371969 393 COSMIC
COSN22574638 967 COSMIC
COSN17037449 1194 COSMIC
COSN9554088 1651 COSMIC
COSN15162570 1703 COSMIC
COSN17215777 2496 COSMIC
COSN1952779 3177 COSMIC
COSN7763156 3187 COSMIC
COSN7763155 3364 COSMIC
COSN23870440 3673 COSMIC
COSN9721639 3729 COSMIC
COSN6770213 3904 COSMIC
COSN1952777 3987 COSMIC
COSN1952775 4311 COSMIC
COSN30271530 4363 COSMIC
COSN27319649 4439 COSMIC
COSN6770212 4456 COSMIC
COSN28552586 4645 COSMIC
COSN18891216 4742 COSMIC
COSN8312208 4880 COSMIC
COSN29111323 4946 COSMIC
COSN21657929 5119 COSMIC
COSN9721638 5221 COSMIC
COSN31962071 5328 COSMIC
COSN23690517 5431 COSMIC
COSN9554087 5439 COSMIC
rs145601829 299 GWAS
rs11130381 1799 GWAS
rs14165 4396 GWAS
rs893363 4742 GWAS
rs877483 5063 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs769815478 1 dbSNP
rs1055835048 2 dbSNP
rs759630876 3 dbSNP
rs111450925 4 dbSNP
rs1221599129 12 dbSNP
rs1369725714 23 dbSNP
rs1294049550 26 dbSNP
rs557223892 32 dbSNP
rs1342950842 37 dbSNP
rs201355737 38 dbSNP
rs746797465 45 dbSNP
rs568422934 47 dbSNP
rs888547015 51 dbSNP
rs1054224326 53 dbSNP
rs1047190029 55 dbSNP
rs764063975 55 dbSNP
rs930144488 59 dbSNP
rs1427290228 70 dbSNP
rs147713779 78 dbSNP
rs759548864 79 dbSNP
rs535087835 82 dbSNP
rs942961896 89 dbSNP
rs1340328235 91 dbSNP
rs1436689698 94 dbSNP
rs1276260285 100 dbSNP
rs1211073075 102 dbSNP
rs912808207 108 dbSNP
rs566179071 122 dbSNP
rs552358378 123 dbSNP
rs1355822329 127 dbSNP
rs1222658431 129 dbSNP
rs930155735 135 dbSNP
rs910857863 136 dbSNP
rs989122741 140 dbSNP
rs529254855 143 dbSNP
rs963147097 147 dbSNP
rs1248743504 148 dbSNP
rs1365955106 153 dbSNP
rs927315231 159 dbSNP
rs1381439993 163 dbSNP
rs567394748 167 dbSNP
rs1388372439 169 dbSNP
rs1360222835 171 dbSNP
rs1406323410 174 dbSNP
rs1325106010 182 dbSNP
rs977900259 183 dbSNP
rs1458156899 184 dbSNP
rs970966596 185 dbSNP
rs1351263006 186 dbSNP
rs1166266655 191 dbSNP
rs1024839952 192 dbSNP
rs1012158581 194 dbSNP
rs1237801864 199 dbSNP
rs1024658225 201 dbSNP
rs1390222906 236 dbSNP
rs1010050179 241 dbSNP
rs1191106698 245 dbSNP
rs762489699 246 dbSNP
rs955839313 247 dbSNP
rs1213338765 258 dbSNP
rs1238814770 259 dbSNP
rs1441638695 264 dbSNP
rs563519708 269 dbSNP
rs1267181834 279 dbSNP
rs181591871 284 dbSNP
rs1339961554 298 dbSNP
rs145601829 299 dbSNP
rs17053530 301 dbSNP
rs1272777052 304 dbSNP
rs1165409541 308 dbSNP
rs1047583222 313 dbSNP
rs1388088692 313 dbSNP
rs1460553769 314 dbSNP
rs1204647229 318 dbSNP
rs540693420 320 dbSNP
rs1038657673 321 dbSNP
rs1230599012 322 dbSNP
rs1246676895 324 dbSNP
rs1282172894 326 dbSNP
rs1355405840 337 dbSNP
rs901336149 341 dbSNP
rs1329272911 354 dbSNP
rs140389543 360 dbSNP
rs1459139890 363 dbSNP
rs571761850 365 dbSNP
rs911475226 366 dbSNP
rs1443535817 370 dbSNP
rs564649668 372 dbSNP
rs776799178 380 dbSNP
rs1190256940 382 dbSNP
rs1367028969 385 dbSNP
rs1475090115 386 dbSNP
rs930248970 387 dbSNP
rs897314640 389 dbSNP
rs1463588069 391 dbSNP
rs115082746 393 dbSNP
rs1402336166 394 dbSNP
rs936325005 398 dbSNP
rs923667403 403 dbSNP
rs552403370 404 dbSNP
rs550982256 405 dbSNP
rs941416916 409 dbSNP
rs1320329971 415 dbSNP
rs1216839463 425 dbSNP
rs927379984 427 dbSNP
rs768579589 428 dbSNP
rs1169931200 429 dbSNP
rs1202636109 434 dbSNP
rs1254777476 439 dbSNP
rs1485543466 441 dbSNP
rs978229335 441 dbSNP
rs1194910047 443 dbSNP
rs1264844515 447 dbSNP
rs1228643805 455 dbSNP
rs747556740 464 dbSNP
rs1377568426 466 dbSNP
rs1169335514 475 dbSNP
rs1177359866 483 dbSNP
rs917730564 489 dbSNP
rs990672186 491 dbSNP
rs1400355670 495 dbSNP
rs34378181 496 dbSNP
rs10626142 497 dbSNP
rs397731445 497 dbSNP
rs559280966 497 dbSNP
rs1250031795 498 dbSNP
rs1295136969 502 dbSNP
rs917279165 510 dbSNP
rs988714456 513 dbSNP
rs1254750468 525 dbSNP
rs1483498986 527 dbSNP
rs1016197114 531 dbSNP
rs1218027044 545 dbSNP
rs62250930 559 dbSNP
rs952803246 560 dbSNP
rs147577429 561 dbSNP
rs1025671562 566 dbSNP
rs1434383205 574 dbSNP
rs1196190393 575 dbSNP
rs1394367297 581 dbSNP
rs371719937 583 dbSNP
rs772624553 594 dbSNP
rs979004465 601 dbSNP
rs1358324273 623 dbSNP
rs964457752 628 dbSNP
rs189477345 630 dbSNP
rs1288499090 633 dbSNP
rs1368639872 640 dbSNP
rs1388562540 649 dbSNP
rs994630812 652 dbSNP
rs901283843 659 dbSNP
rs1019699639 661 dbSNP
rs1309403812 670 dbSNP
rs537737347 680 dbSNP
rs145132052 696 dbSNP
rs1215592948 702 dbSNP
rs1265640238 712 dbSNP
rs1443780268 715 dbSNP
rs554900274 718 dbSNP
rs1007018568 720 dbSNP
rs1207729954 722 dbSNP
rs534714175 738 dbSNP
rs1008539513 739 dbSNP
rs1180431171 740 dbSNP
rs1400820074 742 dbSNP
rs1173710073 745 dbSNP
rs889985543 746 dbSNP
rs1054442379 751 dbSNP
rs936964937 752 dbSNP
rs902165421 760 dbSNP
rs1324154801 768 dbSNP
rs1393745490 772 dbSNP
rs1158890221 773 dbSNP
rs994369693 786 dbSNP
rs746202900 788 dbSNP
rs1371869948 792 dbSNP
rs1042070972 804 dbSNP
rs1223545344 817 dbSNP
rs949094153 819 dbSNP
rs574269765 820 dbSNP
rs990619613 838 dbSNP
rs1272151162 839 dbSNP
rs937820031 839 dbSNP
rs1185631880 844 dbSNP
rs1200039295 847 dbSNP
rs560464699 850 dbSNP
rs148394206 851 dbSNP
rs1441948037 864 dbSNP
rs909085663 875 dbSNP
rs985098683 887 dbSNP
rs771610223 890 dbSNP
rs539162367 894 dbSNP
rs1415622663 898 dbSNP
rs1421840376 901 dbSNP
rs1201022751 905 dbSNP
rs1163046682 910 dbSNP
rs1462593039 911 dbSNP
rs1266094789 912 dbSNP
rs1172956339 913 dbSNP
rs1227569079 913 dbSNP
rs1352864737 914 dbSNP
rs1442046454 914 dbSNP
rs1303945149 915 dbSNP
rs1329536616 916 dbSNP
rs1280956002 917 dbSNP
rs1242119598 918 dbSNP
rs1318207643 919 dbSNP
rs1220127098 922 dbSNP
rs941540976 925 dbSNP
rs1334236974 926 dbSNP
rs1306427296 927 dbSNP
rs1210650037 929 dbSNP
rs905926334 929 dbSNP
rs1044857540 930 dbSNP
rs1320402570 931 dbSNP
rs950675890 932 dbSNP
rs1026041634 933 dbSNP
rs1391240398 934 dbSNP
rs972760809 936 dbSNP
rs1177417901 937 dbSNP
rs1202163646 937 dbSNP
rs1210115755 937 dbSNP
rs1268052274 937 dbSNP
rs1341549922 937 dbSNP
rs1360656638 937 dbSNP
rs1361461238 937 dbSNP
rs1409455064 937 dbSNP
rs1417391624 937 dbSNP
rs1429734788 937 dbSNP
rs1433216285 937 dbSNP
rs3079411 937 dbSNP
rs1472583872 938 dbSNP
rs1286399717 941 dbSNP
rs1369195930 941 dbSNP
rs1489153896 942 dbSNP
rs1195511240 944 dbSNP
rs11714712 949 dbSNP
rs1019647176 953 dbSNP
rs1006967696 955 dbSNP
rs144461528 961 dbSNP
rs1361498625 967 dbSNP
rs1032541604 972 dbSNP
rs1001497491 973 dbSNP
rs1286056000 974 dbSNP
rs1315773659 981 dbSNP
rs1207762767 982 dbSNP
rs777451247 986 dbSNP
rs529972455 989 dbSNP
rs4563403 990 dbSNP
rs779938438 994 dbSNP
rs925867134 998 dbSNP
rs1284357338 1001 dbSNP
rs374540464 1020 dbSNP
rs1233394204 1022 dbSNP
rs964920875 1022 dbSNP
rs1355574450 1023 dbSNP
rs1362339134 1023 dbSNP
rs547329133 1024 dbSNP
rs558250205 1030 dbSNP
rs1328612133 1033 dbSNP
rs1222620500 1046 dbSNP
rs184612853 1047 dbSNP
rs1254908885 1050 dbSNP
rs1321981611 1056 dbSNP
rs896187788 1058 dbSNP
rs993134117 1067 dbSNP
rs1165168354 1073 dbSNP
rs544684173 1079 dbSNP
rs149740306 1080 dbSNP
rs1005827146 1093 dbSNP
rs1187900462 1097 dbSNP
rs1439606504 1116 dbSNP
rs530025974 1117 dbSNP
rs1379078527 1134 dbSNP
rs563875458 1146 dbSNP
rs1449995097 1150 dbSNP
rs1356808628 1156 dbSNP
rs984659273 1161 dbSNP
rs766298003 1170 dbSNP
rs1450767169 1172 dbSNP
rs929175113 1178 dbSNP
rs1213201052 1186 dbSNP
rs1239285594 1187 dbSNP
rs919187338 1200 dbSNP
rs1180313877 1209 dbSNP
rs895907879 1211 dbSNP
rs543655401 1212 dbSNP
rs1415283366 1222 dbSNP
rs1460443895 1225 dbSNP
rs1339504194 1231 dbSNP
rs1401876154 1232 dbSNP
rs74840452 1233 dbSNP
rs762986986 1242 dbSNP
rs1229869951 1244 dbSNP
rs912584298 1246 dbSNP
rs1364704459 1249 dbSNP
rs1450027427 1254 dbSNP
rs1295328569 1256 dbSNP
rs985499288 1258 dbSNP
rs554953502 1260 dbSNP
rs925836320 1261 dbSNP
rs954143350 1266 dbSNP
rs1341578232 1269 dbSNP
rs139666092 1272 dbSNP
rs754647663 1287 dbSNP
rs1190572768 1305 dbSNP
rs1255888500 1314 dbSNP
rs4234642 1329 dbSNP
rs910367740 1334 dbSNP
rs987359893 1334 dbSNP
rs192184790 1342 dbSNP
rs1370089299 1354 dbSNP
rs1402887179 1356 dbSNP
rs554131598 1377 dbSNP
rs919021402 1380 dbSNP
rs187834555 1387 dbSNP
rs1354604317 1390 dbSNP
rs1169300932 1392 dbSNP
rs971683181 1393 dbSNP
rs1013884952 1398 dbSNP
rs1421588771 1400 dbSNP
rs1320849814 1406 dbSNP
rs1328266667 1408 dbSNP
rs896136850 1415 dbSNP
rs1251220173 1422 dbSNP
rs1346371926 1432 dbSNP
rs1213673540 1444 dbSNP
rs1170694563 1446 dbSNP
rs1015960480 1460 dbSNP
rs1485554587 1465 dbSNP
rs1216885620 1480 dbSNP
rs1054807511 1481 dbSNP
rs534651912 1484 dbSNP
rs1006210350 1487 dbSNP
rs1001929710 1494 dbSNP
rs1310141284 1495 dbSNP
rs1171697776 1501 dbSNP
rs1201197732 1508 dbSNP
rs374232544 1524 dbSNP
rs970375936 1524 dbSNP
rs1049336541 1525 dbSNP
rs929145060 1532 dbSNP
rs114149895 1538 dbSNP
rs567510100 1544 dbSNP
rs1237059751 1551 dbSNP
rs764248477 1559 dbSNP
rs895873796 1562 dbSNP
rs1040247557 1563 dbSNP
rs1053212131 1564 dbSNP
rs4687744 1565 dbSNP
rs1308696489 1567 dbSNP
rs1484667344 1579 dbSNP
rs1277156766 1583 dbSNP
rs1219121347 1591 dbSNP
rs1469419762 1592 dbSNP
rs4687588 1594 dbSNP
rs12485510 1595 dbSNP
rs1226867144 1596 dbSNP
rs879457748 1596 dbSNP
rs374057050 1599 dbSNP
rs1395306381 1600 dbSNP
rs1443273304 1612 dbSNP
rs1308808097 1614 dbSNP
rs1444492203 1615 dbSNP
rs925400665 1615 dbSNP
rs1357462107 1623 dbSNP
rs1332159987 1626 dbSNP
rs1369294631 1627 dbSNP
rs1413820118 1628 dbSNP
rs370435714 1629 dbSNP
rs1056296802 1631 dbSNP
rs1248074712 1632 dbSNP
rs12485507 1632 dbSNP
rs1158641914 1633 dbSNP
rs1443486900 1634 dbSNP
rs1458760899 1634 dbSNP
rs1293504791 1635 dbSNP
rs570896488 1635 dbSNP
rs1459086574 1636 dbSNP
rs796907732 1636 dbSNP
rs1021158895 1637 dbSNP
rs1186095207 1637 dbSNP
rs1013834008 1638 dbSNP
rs1461769426 1638 dbSNP
rs1181613676 1639 dbSNP
rs1357780962 1639 dbSNP
rs1471623300 1640 dbSNP
rs910471572 1640 dbSNP
rs1052005493 1641 dbSNP
rs531280770 1641 dbSNP
rs933175202 1642 dbSNP
rs1182399205 1643 dbSNP
rs1174828620 1644 dbSNP
rs1428390466 1644 dbSNP
rs1433316475 1644 dbSNP
rs59971943 1644 dbSNP
rs377576647 1645 dbSNP
rs796609986 1645 dbSNP
rs1286564340 1646 dbSNP
rs1305618888 1646 dbSNP
rs1345450697 1646 dbSNP
rs202031062 1646 dbSNP
rs547477516 1646 dbSNP
rs67976825 1646 dbSNP
rs766390909 1646 dbSNP
rs1218238344 1647 dbSNP
rs1447758440 1647 dbSNP
rs1491558973 1647 dbSNP
rs200856406 1648 dbSNP
rs960965591 1649 dbSNP
rs142483411 1650 dbSNP
rs71617780 1650 dbSNP
rs1397483130 1651 dbSNP
rs1443491555 1652 dbSNP
rs1265475569 1654 dbSNP
rs1226961329 1656 dbSNP
rs1452928628 1659 dbSNP
rs1033305928 1676 dbSNP
rs192124229 1680 dbSNP
rs1315795077 1681 dbSNP
rs1344084804 1682 dbSNP
rs370260005 1683 dbSNP
rs1327809028 1684 dbSNP
rs908868403 1684 dbSNP
rs887472376 1692 dbSNP
rs1048798477 1693 dbSNP
rs980466368 1698 dbSNP
rs970683228 1704 dbSNP
rs187538003 1707 dbSNP
rs1225612082 1712 dbSNP
rs1282493349 1716 dbSNP
rs1328550194 1720 dbSNP
rs1214441926 1724 dbSNP
rs1447290907 1727 dbSNP
rs897643243 1730 dbSNP
rs1198799353 1732 dbSNP
rs530225982 1737 dbSNP
rs1040198377 1738 dbSNP
rs1233744883 1742 dbSNP
rs753626295 1745 dbSNP
rs992971570 1745 dbSNP
rs1410827151 1755 dbSNP
rs1461476122 1756 dbSNP
rs1031873328 1759 dbSNP
rs1406748470 1768 dbSNP
rs910474520 1772 dbSNP
rs183350848 1780 dbSNP
rs139620672 1781 dbSNP
rs191567030 1781 dbSNP
rs1455472106 1784 dbSNP
rs762150203 1789 dbSNP
rs1439818582 1790 dbSNP
rs764171787 1792 dbSNP
rs11130381 1799 dbSNP
rs1234160162 1800 dbSNP
rs945483175 1803 dbSNP
rs1420485865 1804 dbSNP
rs187855848 1812 dbSNP
rs1180774442 1814 dbSNP
rs1444655302 1817 dbSNP
rs1439894982 1819 dbSNP
rs1180151879 1821 dbSNP
rs373210184 1833 dbSNP
rs1207346550 1836 dbSNP
rs576442085 1837 dbSNP
rs1269138486 1838 dbSNP
rs1218285028 1842 dbSNP
rs1168406085 1849 dbSNP
rs1398600198 1860 dbSNP
rs746488435 1868 dbSNP
rs1408170190 1875 dbSNP
rs941746177 1876 dbSNP
rs1375854329 1884 dbSNP
rs981467450 1885 dbSNP
rs556374475 1890 dbSNP
rs1027761072 1893 dbSNP
rs182941898 1894 dbSNP
rs1385031854 1897 dbSNP
rs1271252447 1898 dbSNP
rs1342032992 1901 dbSNP
rs917596960 1906 dbSNP
rs758358616 1910 dbSNP
rs1432777515 1911 dbSNP
rs993066406 1919 dbSNP
rs1289223216 1922 dbSNP
rs1455088339 1927 dbSNP
rs1347774582 1940 dbSNP
rs567327739 1941 dbSNP
rs1018696651 1944 dbSNP
rs1031839081 1945 dbSNP
rs1187280936 1947 dbSNP
rs1193225830 1948 dbSNP
rs553587101 1955 dbSNP
rs765085555 1957 dbSNP
rs969172381 1958 dbSNP
rs756945737 1966 dbSNP
rs1314975010 1975 dbSNP
rs888985555 1976 dbSNP
rs533805131 1979 dbSNP
rs1400382262 1981 dbSNP
rs1050302878 1992 dbSNP
rs935940839 1996 dbSNP
rs1319002541 1997 dbSNP
rs903841230 2000 dbSNP
rs1265115224 2003 dbSNP
rs1297596524 2008 dbSNP
rs1008082485 2011 dbSNP
rs889111918 2013 dbSNP
rs1030325888 2014 dbSNP
rs145996783 2015 dbSNP
rs142519847 2017 dbSNP
rs1263143777 2019 dbSNP
rs1444851308 2029 dbSNP
rs1187841867 2035 dbSNP
rs1036122058 2041 dbSNP
rs1455394048 2042 dbSNP
rs80065999 2042 dbSNP
rs531195762 2044 dbSNP
rs939495210 2048 dbSNP
rs1044801253 2051 dbSNP
rs947824115 2065 dbSNP
rs202170783 2068 dbSNP
rs1387225831 2081 dbSNP
rs926799841 2093 dbSNP
rs1341373141 2101 dbSNP
rs1320435643 2102 dbSNP
rs1372312571 2107 dbSNP
rs1443786236 2122 dbSNP
rs760885444 2126 dbSNP
rs917582966 2136 dbSNP
rs1296133193 2138 dbSNP
rs1239315920 2140 dbSNP
rs991861717 2146 dbSNP
rs981032199 2153 dbSNP
rs1365180155 2162 dbSNP
rs568879406 2167 dbSNP
rs775732833 2169 dbSNP
rs972145042 2170 dbSNP
rs968897064 2178 dbSNP
rs914756651 2185 dbSNP
rs1366960628 2205 dbSNP
rs986227310 2208 dbSNP
rs878953766 2211 dbSNP
rs190603176 2212 dbSNP
rs1428468381 2215 dbSNP
rs1455871893 2221 dbSNP
rs1030250587 2225 dbSNP
rs1395329697 2226 dbSNP
rs529017716 2231 dbSNP
rs1292363859 2232 dbSNP
rs1008641381 2248 dbSNP
rs1367332956 2255 dbSNP
rs1392389504 2256 dbSNP
rs1173111854 2260 dbSNP
rs888931555 2261 dbSNP
rs561289951 2262 dbSNP
rs1029272899 2263 dbSNP
rs1000090787 2268 dbSNP
rs904440768 2277 dbSNP
rs4687587 2294 dbSNP
rs1267081357 2299 dbSNP
rs945362084 2306 dbSNP
rs1264852315 2308 dbSNP
rs769087963 2310 dbSNP
rs1006573722 2314 dbSNP
rs887604792 2324 dbSNP
rs1045336828 2329 dbSNP
rs1204537499 2335 dbSNP
rs1418663170 2336 dbSNP
rs527942238 2337 dbSNP
rs1251852570 2339 dbSNP
rs1349852606 2344 dbSNP
rs896236987 2346 dbSNP
rs1369108146 2358 dbSNP
rs565587047 2360 dbSNP
rs1293599795 2362 dbSNP
rs1056541780 2365 dbSNP
rs1226166355 2368 dbSNP
rs1229482560 2377 dbSNP
rs939442843 2379 dbSNP
rs1307956549 2380 dbSNP
rs1310274709 2381 dbSNP
rs1056107471 2389 dbSNP
rs545756836 2390 dbSNP
rs1300317160 2395 dbSNP
rs1223816945 2396 dbSNP
rs926747512 2409 dbSNP
rs1347013286 2413 dbSNP
rs1045655754 2420 dbSNP
rs1482645648 2428 dbSNP
rs1204688335 2432 dbSNP
rs1258549191 2434 dbSNP
rs1305737115 2437 dbSNP
rs930872620 2443 dbSNP
rs1041962601 2445 dbSNP
rs1396549779 2447 dbSNP
rs1413189505 2452 dbSNP
rs1429564747 2455 dbSNP
rs1300470843 2456 dbSNP
rs914746452 2457 dbSNP
rs947663599 2457 dbSNP
rs986707589 2457 dbSNP
rs953454807 2466 dbSNP
rs1445398503 2470 dbSNP
rs923371911 2506 dbSNP
rs976032756 2507 dbSNP
rs1377482939 2521 dbSNP
rs7636327 2522 dbSNP
rs562930374 2523 dbSNP
rs972378874 2530 dbSNP
rs1006128317 2539 dbSNP
rs961688231 2548 dbSNP
rs542740898 2554 dbSNP
rs1444290187 2556 dbSNP
rs1023425815 2559 dbSNP
rs1486271645 2561 dbSNP
rs866539315 2562 dbSNP
rs1012499588 2564 dbSNP
rs138028126 2565 dbSNP
rs146324638 2566 dbSNP
rs1028803288 2569 dbSNP
rs1000443254 2579 dbSNP
rs1455716896 2584 dbSNP
rs1252734327 2600 dbSNP
rs374314522 2609 dbSNP
rs369974647 2612 dbSNP
rs1482234018 2616 dbSNP
rs1432347016 2617 dbSNP
rs141476127 2620 dbSNP
rs1204077522 2623 dbSNP
rs914818860 2625 dbSNP
rs533743770 2626 dbSNP
rs1010179137 2634 dbSNP
rs1050589750 2639 dbSNP
rs932171628 2641 dbSNP
rs1335892986 2649 dbSNP
rs562378958 2653 dbSNP
rs1464803244 2654 dbSNP
rs749608869 2656 dbSNP
rs1402132901 2657 dbSNP
rs940810558 2658 dbSNP
rs907865075 2659 dbSNP
rs186466501 2663 dbSNP
rs1386874044 2665 dbSNP
rs951962026 2667 dbSNP
rs1023986338 2672 dbSNP
rs1470629666 2674 dbSNP
rs544046281 2680 dbSNP
rs1387290466 2687 dbSNP
rs1461831979 2691 dbSNP
rs1327917898 2705 dbSNP
rs1329121579 2708 dbSNP
rs1435557767 2711 dbSNP
rs1274453707 2718 dbSNP
rs1374278273 2721 dbSNP
rs554572890 2727 dbSNP
rs1365676391 2730 dbSNP
rs1185513548 2737 dbSNP
rs1286461448 2739 dbSNP
rs1328661766 2741 dbSNP
rs1214850619 2744 dbSNP
rs1045203322 2757 dbSNP
rs1292704102 2758 dbSNP
rs1450207240 2761 dbSNP
rs776383450 2765 dbSNP
rs557624665 2768 dbSNP
rs148294702 2772 dbSNP
rs1184094846 2773 dbSNP
rs1475280364 2775 dbSNP
rs1037003255 2784 dbSNP
rs536455266 2792 dbSNP
rs940976107 2793 dbSNP
rs531977240 2796 dbSNP
rs987117053 2797 dbSNP
rs1411894013 2803 dbSNP
rs1286755450 2818 dbSNP
rs1349926620 2819 dbSNP
rs1021930632 2826 dbSNP
rs1350944403 2827 dbSNP
rs1286063158 2830 dbSNP
rs1354806827 2831 dbSNP
rs953097293 2832 dbSNP
rs568743046 2837 dbSNP
rs1242007572 2838 dbSNP
rs548977510 2848 dbSNP
rs1316404930 2853 dbSNP
rs1250674443 2858 dbSNP
rs1455035274 2859 dbSNP
rs968937600 2863 dbSNP
rs1051099095 2871 dbSNP
rs1188970426 2875 dbSNP
rs1366226743 2889 dbSNP
rs879876967 2903 dbSNP
rs1176859930 2905 dbSNP
rs1472392650 2917 dbSNP
rs1020143601 2921 dbSNP
rs1320301651 2927 dbSNP
rs1401581966 2928 dbSNP
rs879435178 2929 dbSNP
rs1010126921 2937 dbSNP
rs746618938 2938 dbSNP
rs564646995 2954 dbSNP
rs1457503022 2960 dbSNP
rs143251989 2961 dbSNP
rs759779148 2965 dbSNP
rs1336189442 2967 dbSNP
rs1338785235 2969 dbSNP
rs369250818 2972 dbSNP
rs1446366471 2973 dbSNP
rs1271340334 2984 dbSNP
rs547969863 3000 dbSNP
rs560520318 3001 dbSNP
rs1192215625 3008 dbSNP
rs565526302 3015 dbSNP
rs757841601 3020 dbSNP
rs1447311333 3026 dbSNP
rs1263443874 3027 dbSNP
rs1207669061 3031 dbSNP
rs1045556248 3032 dbSNP
rs745818578 3033 dbSNP
rs994956117 3046 dbSNP
rs149217569 3056 dbSNP
rs757143789 3061 dbSNP
rs1340666648 3071 dbSNP
rs940736962 3080 dbSNP
rs1270069201 3087 dbSNP
rs1431961309 3088 dbSNP
rs907958930 3093 dbSNP
rs1174597820 3094 dbSNP
rs1400135844 3096 dbSNP
rs1321769363 3097 dbSNP
rs1395571923 3097 dbSNP
rs1367920456 3098 dbSNP
rs1433554590 3102 dbSNP
rs1328527526 3106 dbSNP
rs199999260 3107 dbSNP
rs376591355 3107 dbSNP
rs553887396 3107 dbSNP
rs984778927 3107 dbSNP
rs1205165562 3108 dbSNP
rs1463445614 3110 dbSNP
rs957171146 3110 dbSNP
rs1187861595 3113 dbSNP
rs1253394684 3113 dbSNP
rs1321882436 3116 dbSNP
rs1201257405 3118 dbSNP
rs1434752981 3118 dbSNP
rs1376176911 3120 dbSNP
rs1465760828 3120 dbSNP
rs990729291 3122 dbSNP
rs1390944191 3123 dbSNP
rs562707568 3124 dbSNP
rs1032714712 3128 dbSNP
rs920252 3132 dbSNP
rs1391879987 3134 dbSNP
rs1366344287 3136 dbSNP
rs1388927148 3140 dbSNP
rs573872251 3145 dbSNP
rs1330097346 3146 dbSNP
rs1465138777 3147 dbSNP
rs1228636594 3152 dbSNP
rs1289605273 3169 dbSNP
rs749794981 3179 dbSNP
rs1208020532 3191 dbSNP
rs1052000622 3192 dbSNP
rs1388268995 3192 dbSNP
rs977930359 3193 dbSNP
rs966423948 3194 dbSNP
rs1022483444 3195 dbSNP
rs1183169682 3199 dbSNP
rs931646690 3200 dbSNP
rs1159034366 3205 dbSNP
rs889436221 3207 dbSNP
rs574006638 3214 dbSNP
rs1292088622 3215 dbSNP
rs1390468047 3220 dbSNP
rs1309528344 3221 dbSNP
rs1410047432 3221 dbSNP
rs1374563030 3222 dbSNP
rs1196380975 3227 dbSNP
rs771377247 3235 dbSNP
rs1490084240 3241 dbSNP
rs1269075870 3247 dbSNP
rs996379457 3248 dbSNP
rs115847979 3253 dbSNP
rs1481759105 3266 dbSNP
rs1272963877 3274 dbSNP
rs1254293363 3288 dbSNP
rs138583760 3297 dbSNP
rs1181486715 3300 dbSNP
rs777573487 3306 dbSNP
rs988644242 3317 dbSNP
rs959912618 3321 dbSNP
rs1035600244 3329 dbSNP
rs182055948 3331 dbSNP
rs1273437422 3332 dbSNP
rs12496647 3335 dbSNP
rs1023667771 3344 dbSNP
rs1346397400 3348 dbSNP
rs1305132282 3356 dbSNP
rs1206361873 3359 dbSNP
rs1302861637 3364 dbSNP
rs540637251 3364 dbSNP
rs916566266 3367 dbSNP
rs1394215066 3369 dbSNP
rs1311992629 3373 dbSNP
rs995304665 3376 dbSNP
rs1342569440 3389 dbSNP
rs899267841 3391 dbSNP
rs147115949 3392 dbSNP
rs575515793 3420 dbSNP
rs141700339 3424 dbSNP
rs569563721 3426 dbSNP
rs1484308952 3431 dbSNP
rs1410453633 3432 dbSNP
rs1356343643 3437 dbSNP
rs767719549 3452 dbSNP
rs1450674684 3456 dbSNP
rs1170823780 3462 dbSNP
rs377188766 3464 dbSNP
rs1479957383 3465 dbSNP
rs1429588193 3467 dbSNP
rs1201089572 3478 dbSNP
rs966928983 3489 dbSNP
rs1301787287 3497 dbSNP
rs1365776766 3498 dbSNP
rs1231800295 3502 dbSNP
rs932278037 3505 dbSNP
rs1364275335 3518 dbSNP
rs900138585 3519 dbSNP
rs1440059615 3520 dbSNP
rs1279660475 3522 dbSNP
rs191022940 3526 dbSNP
rs147935578 3535 dbSNP
rs947084959 3536 dbSNP
rs1191061574 3537 dbSNP
rs546715764 3539 dbSNP
rs912993439 3547 dbSNP
rs1027904589 3548 dbSNP
rs117104873 3564 dbSNP
rs1431116972 3565 dbSNP
rs966237981 3567 dbSNP
rs1388734916 3571 dbSNP
rs571855437 3575 dbSNP
rs1226770952 3576 dbSNP
rs551969227 3578 dbSNP
rs938493250 3579 dbSNP
rs531885104 3591 dbSNP
rs980003192 3600 dbSNP
rs1436976814 3601 dbSNP
rs772704308 3605 dbSNP
rs886592339 3609 dbSNP
rs1049270756 3612 dbSNP
rs1217706636 3615 dbSNP
rs1282653109 3615 dbSNP
rs552348023 3617 dbSNP
rs752172914 3618 dbSNP
rs970015887 3620 dbSNP
rs569539606 3622 dbSNP
rs1211113231 3626 dbSNP
rs1444384348 3634 dbSNP
rs1356221270 3643 dbSNP
rs1222709776 3646 dbSNP
rs1014481038 3662 dbSNP
rs995291795 3663 dbSNP
rs1248833914 3666 dbSNP
rs549069659 3672 dbSNP
rs529282849 3673 dbSNP
rs973433391 3682 dbSNP
rs766761416 3683 dbSNP
rs1055104595 3684 dbSNP
rs560139752 3690 dbSNP
rs963759928 3702 dbSNP
rs372334667 3703 dbSNP
rs1406507076 3704 dbSNP
rs1405909461 3705 dbSNP
rs1325217939 3707 dbSNP
rs540312343 3714 dbSNP
rs1434577415 3723 dbSNP
rs1178213155 3724 dbSNP
rs1004944250 3725 dbSNP
rs533264346 3732 dbSNP
rs1230354780 3733 dbSNP
rs763422594 3733 dbSNP
rs1286555658 3741 dbSNP
rs945345530 3744 dbSNP
rs996808198 3746 dbSNP
rs1177285016 3748 dbSNP
rs1292464684 3751 dbSNP
rs563909848 3758 dbSNP
rs1221246758 3759 dbSNP
rs989328565 3762 dbSNP
rs1043080098 3767 dbSNP
rs921024873 3768 dbSNP
rs1179330404 3771 dbSNP
rs1011234264 3779 dbSNP
rs891507283 3783 dbSNP
rs1165002629 3793 dbSNP
rs78830183 3796 dbSNP
rs938441119 3802 dbSNP
rs1163138337 3807 dbSNP
rs769166299 3825 dbSNP
rs1411912329 3829 dbSNP
rs1265373287 3832 dbSNP
rs928425729 3837 dbSNP
rs1044257334 3842 dbSNP
rs948607116 3844 dbSNP
rs1354646437 3846 dbSNP
rs149901251 3849 dbSNP
rs186201943 3850 dbSNP
rs80208287 3851 dbSNP
rs1202596564 3857 dbSNP
rs1301816633 3865 dbSNP
rs895199972 3866 dbSNP
rs557522777 3867 dbSNP
rs1189508897 3873 dbSNP
rs907908398 3887 dbSNP
rs1188899639 3896 dbSNP
rs1437766445 3900 dbSNP
rs1391788183 3903 dbSNP
rs1431854334 3917 dbSNP
rs760328766 3918 dbSNP
rs1312889457 3920 dbSNP
rs181672831 3923 dbSNP
rs954811061 3925 dbSNP
rs1336275380 3926 dbSNP
rs377595703 3948 dbSNP
rs906526444 3953 dbSNP
rs1383337879 3954 dbSNP
rs140226644 3956 dbSNP
rs1367881239 3963 dbSNP
rs1225715251 3974 dbSNP
rs1250462601 3976 dbSNP
rs189903081 3982 dbSNP
rs1201631717 3987 dbSNP
rs996365857 3989 dbSNP
rs1460764592 3990 dbSNP
rs1209353788 3993 dbSNP
rs1344257455 3996 dbSNP
rs881883 3999 dbSNP
rs1053998560 4000 dbSNP
rs1382828148 4005 dbSNP
rs1380799150 4007 dbSNP
rs893362 4010 dbSNP
rs921119587 4015 dbSNP
rs1469736713 4019 dbSNP
rs1321877356 4021 dbSNP
rs1012266780 4026 dbSNP
rs1380927021 4038 dbSNP
rs976457497 4043 dbSNP
rs1331277968 4045 dbSNP
rs1445762433 4052 dbSNP
rs891454827 4054 dbSNP
rs1052783372 4055 dbSNP
rs1185158578 4061 dbSNP
rs1228906185 4065 dbSNP
rs573984427 4066 dbSNP
rs1269979792 4068 dbSNP
rs1485718683 4072 dbSNP
rs151143058 4073 dbSNP
rs528846763 4081 dbSNP
rs1267803781 4090 dbSNP
rs1452337380 4110 dbSNP
rs1201370922 4115 dbSNP
rs982477468 4117 dbSNP
rs906956992 4118 dbSNP
rs1414783122 4123 dbSNP
rs1027926410 4142 dbSNP
rs1320051208 4144 dbSNP
rs1288597403 4149 dbSNP
rs1291123862 4149 dbSNP
rs1388137113 4158 dbSNP
rs1246714946 4164 dbSNP
rs1044590872 4169 dbSNP
rs770793583 4170 dbSNP
rs1289698540 4175 dbSNP
rs974090244 4176 dbSNP
rs1238244361 4180 dbSNP
rs569394088 4182 dbSNP
rs567949370 4183 dbSNP
rs549627944 4184 dbSNP
rs1211840907 4187 dbSNP
rs1267087377 4188 dbSNP
rs1490256889 4188 dbSNP
rs1254089056 4195 dbSNP
rs550525086 4197 dbSNP
rs1417848532 4201 dbSNP
rs1038276308 4204 dbSNP
rs1360972909 4209 dbSNP
rs77814795 4214 dbSNP
rs779845030 4216 dbSNP
rs1459804989 4225 dbSNP
rs777431039 4232 dbSNP
rs1432441655 4241 dbSNP
rs906617908 4242 dbSNP
rs907854684 4246 dbSNP
rs1009581157 4253 dbSNP
rs893690111 4255 dbSNP
rs1313417368 4257 dbSNP
rs755910338 4272 dbSNP
rs1342014169 4275 dbSNP
rs564709471 4276 dbSNP
rs186232843 4298 dbSNP
rs1420646974 4304 dbSNP
rs975273118 4305 dbSNP
rs1188568262 4306 dbSNP
rs546594501 4307 dbSNP
rs1022239912 4311 dbSNP
rs533225561 4312 dbSNP
rs1268374939 4324 dbSNP
rs899667841 4325 dbSNP
rs564621555 4326 dbSNP
rs544414159 4332 dbSNP
rs755844318 4333 dbSNP
rs906903211 4334 dbSNP
rs1296020640 4337 dbSNP
rs1216041811 4342 dbSNP
rs1352240500 4343 dbSNP
rs1343273405 4347 dbSNP
rs142082910 4348 dbSNP
rs982832717 4353 dbSNP
rs1405063650 4360 dbSNP
rs561780984 4361 dbSNP
rs139818198 4365 dbSNP
rs1314025587 4370 dbSNP
rs1365732034 4373 dbSNP
rs1297017057 4384 dbSNP
rs1461911330 4387 dbSNP
rs930978758 4389 dbSNP
rs180902209 4390 dbSNP
rs1038626681 4393 dbSNP
rs14165 4396 dbSNP
rs751568172 4397 dbSNP
rs146016396 4399 dbSNP
rs1416903254 4400 dbSNP
rs1050997144 4404 dbSNP
rs982282797 4406 dbSNP
rs970770575 4410 dbSNP
rs1468165384 4421 dbSNP
rs576976489 4424 dbSNP
rs1336055658 4429 dbSNP
rs116720717 4433 dbSNP
rs1428890930 4436 dbSNP
rs1286922201 4443 dbSNP
rs1010089026 4447 dbSNP
rs923290898 4448 dbSNP
rs1325822581 4470 dbSNP
rs1222202529 4472 dbSNP
rs1032790385 4475 dbSNP
rs1465773499 4481 dbSNP
rs1240733017 4483 dbSNP
rs1248489929 4483 dbSNP
rs1485303913 4484 dbSNP
rs1191479507 4505 dbSNP
rs1426634334 4505 dbSNP
rs1479192397 4506 dbSNP
rs996715834 4527 dbSNP
rs1412559141 4538 dbSNP
rs1458760983 4545 dbSNP
rs1480271869 4546 dbSNP
rs974842884 4549 dbSNP
rs899769661 4562 dbSNP
rs536796196 4569 dbSNP
rs1347439041 4571 dbSNP
rs914723459 4583 dbSNP
rs187977748 4588 dbSNP
rs1008034497 4594 dbSNP
rs956244219 4595 dbSNP
rs1346913194 4599 dbSNP
rs1282594021 4600 dbSNP
rs1031922514 4602 dbSNP
rs1304228548 4603 dbSNP
rs1390250572 4607 dbSNP
rs1374719587 4612 dbSNP
rs1300371482 4616 dbSNP
rs1270541979 4619 dbSNP
rs1468603683 4622 dbSNP
rs981731238 4623 dbSNP
rs888567057 4624 dbSNP
rs1186444389 4625 dbSNP
rs1471115283 4625 dbSNP
rs879045469 4625 dbSNP
rs1471074930 4627 dbSNP
rs1362209449 4628 dbSNP
rs1023065216 4638 dbSNP
rs1419700714 4641 dbSNP
rs1302552549 4645 dbSNP
rs1422994970 4645 dbSNP
rs1047176843 4646 dbSNP
rs1491506832 4647 dbSNP
rs1179536746 4648 dbSNP
rs1221361191 4648 dbSNP
rs1229198968 4648 dbSNP
rs1274711581 4648 dbSNP
rs1278335408 4648 dbSNP
rs1288048769 4648 dbSNP
rs1294419068 4648 dbSNP
rs1356735755 4648 dbSNP
rs1443831574 4648 dbSNP
rs1473100394 4648 dbSNP
rs1491275452 4648 dbSNP
rs368919968 4648 dbSNP
rs59630779 4648 dbSNP
rs756982095 4648 dbSNP
rs767415704 4648 dbSNP
rs796553065 4648 dbSNP
rs1180400208 4650 dbSNP
rs74727948 4651 dbSNP
rs1262267062 4652 dbSNP
rs1012643407 4656 dbSNP
rs1326956618 4662 dbSNP
rs1354404439 4664 dbSNP
rs144162096 4664 dbSNP
rs1346694066 4690 dbSNP
rs1046800778 4699 dbSNP
rs1244758106 4700 dbSNP
rs1258530016 4702 dbSNP
rs1237737992 4703 dbSNP
rs1341080576 4705 dbSNP
rs1193526010 4706 dbSNP
rs1316950665 4713 dbSNP
rs535706253 4714 dbSNP
rs1016733632 4719 dbSNP
rs1442870093 4719 dbSNP
rs1003994391 4731 dbSNP
rs1241024670 4736 dbSNP
rs1443833496 4738 dbSNP
rs893363 4742 dbSNP
rs1055868805 4748 dbSNP
rs938208740 4751 dbSNP
rs1166164934 4752 dbSNP
rs1238482752 4759 dbSNP
rs1418973078 4761 dbSNP
rs1050951770 4766 dbSNP
rs1382586942 4776 dbSNP
rs933938637 4779 dbSNP
rs1339323557 4783 dbSNP
rs560604294 4785 dbSNP
rs183619965 4786 dbSNP
rs1321675006 4788 dbSNP
rs750876692 4790 dbSNP
rs13434145 4795 dbSNP
rs765599984 4813 dbSNP
rs1345184891 4814 dbSNP
rs970867060 4818 dbSNP
rs1454409747 4820 dbSNP
rs914085460 4821 dbSNP
rs988234399 4822 dbSNP
rs1263588909 4826 dbSNP
rs990269547 4827 dbSNP
rs879741458 4829 dbSNP
rs1241568334 4832 dbSNP
rs1160448274 4839 dbSNP
rs934815021 4843 dbSNP
rs924800587 4844 dbSNP
rs981660803 4856 dbSNP
rs386396663 4858 dbSNP
rs34802182 4860 dbSNP
rs397874861 4860 dbSNP
rs78659222 4860 dbSNP
rs1380157462 4862 dbSNP
rs1443887216 4863 dbSNP
rs963906124 4864 dbSNP
rs1406191500 4867 dbSNP
rs1019472583 4868 dbSNP
rs1322639331 4872 dbSNP
rs1008129508 4875 dbSNP
rs1262257488 4877 dbSNP
rs368045263 4878 dbSNP
rs877484 4880 dbSNP
rs1261248459 4882 dbSNP
rs991570209 4887 dbSNP
rs1490581879 4894 dbSNP
rs530947050 4896 dbSNP
rs1016636062 4905 dbSNP
rs1480394108 4905 dbSNP
rs1183245462 4910 dbSNP
rs775193385 4912 dbSNP
rs578115304 4916 dbSNP
rs1003941921 4924 dbSNP
rs1452140764 4929 dbSNP
rs1158386775 4932 dbSNP
rs752765298 4934 dbSNP
rs771684296 4935 dbSNP
rs561880513 4938 dbSNP
rs998034584 4942 dbSNP
rs899750953 4947 dbSNP
rs1316288769 4950 dbSNP
rs548405855 4951 dbSNP
rs1039003461 4958 dbSNP
rs528364500 4960 dbSNP
rs1007967791 4975 dbSNP
rs893177139 4976 dbSNP
rs1333938830 4977 dbSNP
rs765324786 4977 dbSNP
rs934743147 4981 dbSNP
rs924748235 4992 dbSNP
rs1360355723 5000 dbSNP
rs1045932346 5003 dbSNP
rs950293746 5010 dbSNP
rs988716745 5012 dbSNP
rs1490222354 5016 dbSNP
rs759137533 5023 dbSNP
rs1301381041 5037 dbSNP
rs1253241651 5039 dbSNP
rs1417878981 5042 dbSNP
rs991795021 5048 dbSNP
rs1278821177 5050 dbSNP
rs1386317355 5055 dbSNP
rs1446066460 5058 dbSNP
rs877483 5063 dbSNP
rs1164095115 5067 dbSNP
rs770403786 5068 dbSNP
rs909580009 5081 dbSNP
rs763424839 5087 dbSNP
rs1394180176 5101 dbSNP
rs982469395 5103 dbSNP
rs754058867 5104 dbSNP
rs1315467033 5107 dbSNP
rs951153495 5108 dbSNP
rs766857401 5109 dbSNP
rs761190822 5110 dbSNP
rs773700550 5111 dbSNP
rs964001514 5112 dbSNP
rs767960293 5113 dbSNP
rs762352043 5114 dbSNP
rs773766376 5115 dbSNP
rs768162397 5116 dbSNP
rs748906686 5117 dbSNP
rs775054398 5118 dbSNP
rs769431036 5119 dbSNP
rs745718093 5120 dbSNP
rs780940787 5121 dbSNP
rs757178663 5122 dbSNP
rs1019609624 5123 dbSNP
rs746921149 5124 dbSNP
rs778875978 5125 dbSNP
rs1479939785 5126 dbSNP
rs755022946 5127 dbSNP
rs753964430 5128 dbSNP
rs766768386 5129 dbSNP
rs756383399 5131 dbSNP
rs1195784151 5133 dbSNP
rs750859470 5134 dbSNP
rs767884144 5136 dbSNP
rs762249215 5137 dbSNP
rs1264808508 5138 dbSNP
rs1219647822 5139 dbSNP
rs774862565 5141 dbSNP
rs763515264 5142 dbSNP
rs762516099 5144 dbSNP
rs774964424 5145 dbSNP
rs769482478 5148 dbSNP
rs759153470 5149 dbSNP
rs776438391 5150 dbSNP
rs770705934 5151 dbSNP
rs746928441 5152 dbSNP
rs963948643 5158 dbSNP
rs1384166413 5159 dbSNP
rs1428758852 5160 dbSNP
rs1018607225 5169 dbSNP
rs377287341 5174 dbSNP
rs199663282 5176 dbSNP
rs1337928287 5182 dbSNP
rs1461409776 5183 dbSNP
rs1407995703 5187 dbSNP
rs3079421 5187 dbSNP
rs71728367 5187 dbSNP
rs72190867 5187 dbSNP
rs200204039 5188 dbSNP
rs1010849948 5189 dbSNP
rs546151451 5191 dbSNP
rs1025439321 5192 dbSNP
rs1269978871 5194 dbSNP
rs1378647529 5203 dbSNP
rs1228530672 5206 dbSNP
rs1215444550 5208 dbSNP
rs1342629427 5212 dbSNP
rs1305883067 5216 dbSNP
rs398062333 5216 dbSNP
rs75548468 5216 dbSNP
rs898217795 5216 dbSNP
rs1034079713 5217 dbSNP
rs1001313477 5218 dbSNP
rs1404451423 5219 dbSNP
rs1237272293 5227 dbSNP
rs777749080 5234 dbSNP
rs1485988836 5237 dbSNP
rs1187958855 5251 dbSNP
rs1259030947 5254 dbSNP
rs1366244126 5254 dbSNP
rs1427453525 5254 dbSNP
rs749429668 5258 dbSNP
rs1176567714 5267 dbSNP
rs893111387 5271 dbSNP
rs377619326 5273 dbSNP
rs1345626924 5288 dbSNP
rs1431721941 5293 dbSNP
rs1290890968 5297 dbSNP
rs1360173900 5301 dbSNP
rs576883178 5305 dbSNP
rs1045462197 5308 dbSNP
rs949622627 5309 dbSNP
rs4364157 5311 dbSNP
rs780252622 5318 dbSNP
rs1222297590 5325 dbSNP
rs1167119512 5327 dbSNP
rs563180194 5327 dbSNP
rs1217456790 5329 dbSNP
rs936816567 5331 dbSNP
rs577538100 5332 dbSNP
rs1425370466 5333 dbSNP
rs903273878 5334 dbSNP
rs1479406271 5340 dbSNP
rs1198661919 5346 dbSNP
rs975463351 5347 dbSNP
rs942830060 5348 dbSNP
rs1156694997 5353 dbSNP
rs4261872 5358 dbSNP
rs747919708 5363 dbSNP
rs912525385 5366 dbSNP
rs1268962640 5368 dbSNP
rs1045882939 5373 dbSNP
rs986773364 5382 dbSNP
rs1436588373 5387 dbSNP
rs1374742410 5388 dbSNP
rs1225786391 5393 dbSNP
rs1305328777 5393 dbSNP
rs1352445306 5394 dbSNP
rs139267150 5402 dbSNP
rs1293292855 5409 dbSNP
rs1489658843 5416 dbSNP
rs951299553 5417 dbSNP
rs1233337239 5418 dbSNP
rs1471127063 5429 dbSNP
rs781612090 5435 dbSNP
rs192628351 5443 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
            ::||||| |   :|||||| 
Target 5' auGGCACCACU---GCACUCCa 3'
3 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084068
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000315251.6 | 3UTR | UGAUGGCACCACUGCACUCCAGCCUGGGUGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084078
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000315251.6 | 3UTR | UGAUGGCACCACUGCACUCCAGCCUGGGUGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.783 3.0e-6 0.812 7.3e-7 24 Click to see details
GSE28260 Renal cortex and medulla -0.516 3.6e-2 -0.396 9.0e-2 13 Click to see details
GSE19350 CNS germ cell tumors 0.537 3.6e-2 0.385 1.1e-1 12 Click to see details
GSE32688 Pancreatic cancer 0.284 5.8e-2 0.333 3.1e-2 32 Click to see details
GSE38226 Liver fibrosis 0.288 1.0e-1 0.392 3.9e-2 21 Click to see details
GSE42095 Differentiated embryonic stem cells 0.222 1.5e-1 0.467 1.2e-2 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.215 1.8e-1 0.304 9.6e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.161 2.2e-1 -0.122 2.8e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.079 2.3e-1 -0.045 3.4e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.179 2.5e-1 0.218 2.1e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.139 2.5e-1 -0.059 3.9e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.27 3.0e-1 0.371 2.3e-1 6 Click to see details
GSE26953 Aortic valvular endothelial cells 0.097 3.3e-1 0.058 3.9e-1 24 Click to see details
GSE21849 B cell lymphoma -0.068 3.6e-1 0.070 3.6e-1 29 Click to see details
GSE21687 Ependynoma primary tumors -0.022 4.3e-1 -0.099 2.2e-1 64 Click to see details
GSE17306 Multiple myeloma 0.009 4.8e-1 -0.001 5.0e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.354 0.01 0.211 0.07 49 Click to see details
STAD 0.567 0.07 0.524 0.09 8 Click to see details
ESCA 0.726 0.08 0.700 0.09 5 Click to see details
KICH 0.47 0.12 0.381 0.18 8 Click to see details
KIRP 0.42 0.13 0.650 0.03 9 Click to see details
KIRC -0.197 0.15 -0.135 0.24 29 Click to see details
CHOL 0.264 0.25 0.350 0.18 9 Click to see details
HNSC 0.63 0.28 0.500 0.33 3 Click to see details
THCA 0.272 0.33 0.200 0.37 5 Click to see details
THCA 0.272 0.33 0.200 0.37 5 Click to see details
THCA 0.272 0.33 0.200 0.37 5 Click to see details
THCA 0.272 0.33 0.200 0.37 5 Click to see details
THCA 0.272 0.33 0.200 0.37 5 Click to see details
THCA 0.272 0.33 0.200 0.37 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14