miRTarBase - #MIRT626093 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MKLN1   
Synonyms TWA2
Description muskelin 1
Transcript NM_001145354   
Other Transcripts NM_013255   
Expression
Putative miRNA Targets on MKLN1
3'UTR of MKLN1
(miRNA target sites are highlighted)
>MKLN1|NM_001145354|3'UTR
   1 CTGAAGAGTCACTGGACACAGAAATGGAAAACAGGAGTCGATTTTCCGTCTTTTGGATTGCAGCTCCACTGACTGACAGT
  81 AAAGCTGCAGTGATTGAGGACTGCACCAGAGTTCTGAAGGGATCTTAACCATCACAAGTTTTTACCCTCTTCCTTCATGC
 161 CTGACCTCAACCCCGCTCTCCTCATCCTATTCCTAAATTAGGCTAATAAAGTGAAATTGGTATACTTTCCAGTTAAATAT
 241 ATATATATATATATTTTTTCTTACTTTATCTTTTAAGAATTAATGAGTATAAAAGAAAAATTAGGCAGTTTACCCTTTTC
 321 AGATTTTTATTTCTTTTTTTTTTAATTGGGGGAAATAAGCACTATTAACAGATTCAGCACTACAAGTATTTTGAATGTTG
 401 TTGCTGTTGGTCATTTGGCCTGCCTTTTCCCTTCCTATTTCACTTTGCCTCCCATCACACAACTGCGTGTAAATGGTGTC
 481 ACTTGTTCACCTCTTTACTTCATTCTTAACAAGTGTATAGTTCTCTAGGACAGTTGATGTATGTTAAGGTGATATCTGTG
 561 TCTGTATTGACTTGTCTTGTGTTACATTAAACAGTAGGCAGAACTGAGGTCTCAAGTTTGCACTCTTGGCCATAGAACTA
 641 AAAATGAAACCTGAGATTGACCCAAGCACCTATCTGAGATTGGTATATAATATTTCTATAATGATATATTTTATAGTAGA
 721 TATTACAATAGCATCTGACTTTGAGTCACAGAAACCTTAAACTGAGGAGACAATAGTTCAGAACCTTTTTAAGAGCCATT
 801 CTAAAAGTGACCAGCAGGAGGGATCTAGTAGTGAATAATATCTTAATAGCAATTTTAGGAGAAAATGACTCTTTCGTCCA
 881 GAAGAGCTCTGCAGAACCAGGGCTCCCGTTTATCTTGTGCTATCTCTGTAGTATTTTCATTTGAGAGAGGAGGCTGAGTT
 961 TCCAGAGCTTTGCTTTCATTTATTTTTATACACATTGTCTCTCTATATCTGCTTGTGGATATTGTTATTTTGAAGAGAAA
1041 TGGTTTGTGGTTGTCCAGTGGTATACAACTGACAGGCATTTCATTAAGCACATAGACCAGACTTTGTGAATGGTTCAGAT
1121 ATTTTTTCATTAAAAAACAAGGTATGGCAGATGGACTTTTCCATGGGTCAAATTTTTTGTGTGAGAGATAGAGGTACATG
1201 TCTTCTGATGATGTGCTGTGGAATGCAATGTGGGAAACCTACATCTGGCTAGTGCTTACATTTGCTCAAAAAGCATGTTG
1281 TATGAAGCTGACTGCCACCATGCTAAAGCAGATTCATATTAAGAAGTGTCGGTCGATCCAGTGGCTCTTAAGAGTGAATA
1361 GCTTTATGGAATCAAGTATGTCCCTGAGTAGCAAGATTAGGCCTCACCAAAGAAGAAATTAACCTGCACTTTCAAAAAGT
1441 ACCATGTATAGGAATGAAACATTGAGGTCCCACTTTATTCTGTCTTTAGTACATGGTTTTACTTATTTTGGGGATGGATA
1521 GAAATATATTTTTGCTAGTTCTAGGCTTGAATCATGGGCTCCTTGGCTTTCCTAGCATCCCAAAGCAGTCAACAGTGATT
1601 TCTTAAGCAATTTGATCTGTACCTTTACTTGTGAAAGGTATGCTATATAATTCAGCAAGTACCAACTTGTGTAGCTGCAG
1681 AATAACCAAGTGGCTATCCAGTCAAGTAAATACAGTTTGCTTACATACTTCAACAGTTTCATAAAACGATTCCCCTGAGT
1761 GACACAAGAACATAAAATGTTAATATCACTAATATAGCCTGTTAAATCTTTTGTGGAGACAGGTGCAAATCAGAAGATTG
1841 ACAAGGAAGAACTTGAGCTTGCTAAATAAGACTTCCTAAATTTAAAAGCTCTAGTTTTGCTTAGTGTGAATTCTGGCACT
1921 TTAAAAAGATTAAGCAAGTGAAATTCTGCTGCCCTCCACCATTTATTTTTACAGTGCTTTGTAATTTTTTTCATCAGTTC
2001 CTTAAATGTTATTTGGAGGAAACTAAGTTCTTGACCTCAGTAATTTTATTTTTGTTTTTCCCTAAATGTTTCCCTACTAG
2081 TCTTTTTGGAAAACATGTTTGTTTTAATTTCATCTTCCCTCACTTTATTTAGGTAGAATTTTTCCCCCTTCATTTCTGAA
2161 ATTTTTTGCTCACCGCCATGTTTAAATGGGGTTGAATCATAGCGAGCCATTTGCTCTTGCCAAAGTGAGATAGATGTACT
2241 GAGGAGATAATTGAAAAGTCAGACTCTGTACTGTGGGGCTTTAATCGGAGCACTGCTGGAAATGATTGCAGAGAATGTAG
2321 TGCTTCATATATCCATGACCAAGATTGACATGTTGCTCACAACATGTCACAATTTAGTGAGGAGCTACATGTATTTCCAA
2401 GAATTCCAGCATAGATTATAATTTAAATAATCGAATTTGGTATTTAGGTACATTGTTTATATAGCCAAGTGTATATGCTT
2481 TACTACCTAACAATTATTCTAGCCTAGGTGAATCCCTAATTGAAACACCTGGCTAACACTTTAGACACATAAATTAAGTG
2561 GGATACAGTTTTCTCATTTGTATTATCTCCAGCTTCAACCTCATTTATCCTTTTTCCTAGTATAATACATTGTTTTCAAC
2641 CAGAAATTAAAGTAGATATCCAACATTATTTTCAGTGCTTGTACTTCATGAGAAATAATCTGATTTTCAAGACACCTCTT
2721 AAGTGCATTTGCATTTTATTTTGGTAATGGCAGAGACCTCATGTGGCCAGTTTGATTGATTGAAGAATGTATCACTCTTA
2801 TTCAAGCAAAGGAATTCAGACTTAAATGCCTACCTCTGTGCTGAAGCTGACAGACAGTATTAACTCTTATCAAGGCCATC
2881 TTTTAGACCTGATTTTCATTTATATGAAAACAGACCTGTCCATGTCTAATAAGTAAAAACTGATAGAATACATTAAAAAG
2961 TCACTGGTTTATCATAGAAAAGTTTGATGGGTTTAGAGCTCAGTGATTTAAGCTTGTAAAACTGCATTCTTGGGCAAAAT
3041 ATTTATATTGTATATAAATGGTTGGCAGCTTATTCCAGTTGATCTCTTCACATCTGCCTTAAAAGTGCTATGTAGAGATA
3121 CATTAACAGAGTTATAATAAAACAGTGTTTTAAAATCTAGCCTATAAACAAAAACTAGTTTGAGGCACCCAAGCATTTAG
3201 TGAGAGATTGAGAATGATGCTTAATGGATCAAAAAAGCAATTAGGAGTATGTTCCTGATTTTATTCTCTAAATTATACTC
3281 AATTTCATGGTAATTACATGAAGAAGTTACCTGCAATTATTCTTAACACTACATGGAATTCACTGGGTAATTGTGGGTCA
3361 TTTATTTCCTGAAAGTCACGTGAAATCCTTAGCTGGTTGAATGTTGCACAGTATTTGAGAATTACGGTTTGAAGTGATTT
3441 CTGTGGGAGGGAATCATTGCAATGTATATTCTAAATAAAGTCATCTAACTATTAAAAAAAAAACACCCTTCCTAACCCTT
3521 CTTTTCTTAAAATTCCACATTCATCCACAATCTCATCCCTTTGTAGAAATTCTTGCCTGAATTCTCACCAAGTTTTGAAT
3601 TCCTAAGGTAGCCCCGATCTAGGATGTGAAGGCTGCCCAGAAAAAGTTTATGGCTGGAGGAGTATCATACAGTGTCTACA
3681 TATGATAGTACTTACAGATTAGGTCTTTGGATGCTTTAACACAAAAGATTTTTGTTATCCTTATTAGTCAAATAACGCTA
3761 TTCTTTTGTGGTTCTAGACCCTGGCTTCTATCTCCCTGTGATTTGTTTTAATGCTGAAATGACTTGGCTATCCAAAGCTT
3841 CTAGTCTAGAGGTCTGTTGGTTGAAGGCAGACATTTCCAAGTTTGTTGAAATAATACGAAGCTGACTAGCTTACGTGAAT
3921 GATGTTGCCCTCATTTGTTTTGGGTGAGGACTCATTACTGCAGTATATTGATCTCTTCACCAAATGCTTTTTCTTTTTCT
4001 GAATAAATGCTGTATTAGAGGTTCTATTTATATATGATTTTTAAAACTTTGGTTTCCTTCTATCCACCAAATACTGTGAA
4081 TTGTTTTTCCATTTATTTTTCTTAGCTAATGTAACTTTATTCTTCACTTTTTTTTAGCCCTAGACTTCCTAGATTTTCTG
4161 TGGCATTCTGTAGGACATTGTATTGCTTGGAAAAAAAAAGATCAAAATCATTCTGGGGCAAATGCTCTATTATCCTTATT
4241 TATGACAAGAGAATAATGAAATTCATAAGAAATTAATAACATTCAGATATTGCTATAAATGTACTTGAGTCATTTTCATT
4321 TGGGGATAGTAATAATGGCTGTGGCAGCTTTAATGGAGAAACCTGTGTTGGCCTCTTTTTCTGGCATTAGGATCTCTTGT
4401 CATAGAACTATTGGTAAAGTACAGGTTTGATAGCAGAGTTCCTGAATTCAGCATATCATCAGAATTTCCATTTACCTTTT
4481 GTCTTTTCTTTTTATTGTATTTTTTAACCTTTTTGTTTCTATTCCTACCTCCCATGAGTAACATTGATTTCTGCTGAAGT
4561 TAGAATTTGTGTTAAGAATTGACTTTAAACTTCTGAAATAGTTGAATATTAGAAGTGGCTTCAGTTGCCATGAAATGATT
4641 GCTTTTCTTTTTCTTTTTTTTTCCTTAAATAAAAATAATGCAGCCTTATATATGTCTCTTCCCCTCAAGAATGTGAATTT
4721 AGGCTGGGCATAGTGACTCACGCCTGTAATCCCAGACCTTTGGGAGGCTGACACGGGAAGATTGCTTGAGCCCAGGAATT
4801 TCAGACCAGCCTGGGCAACACAGGAAGACTCCATCTCTACTTAAAATATTTTTGTTTTTTAGCCAGGTGTGGTGGTATGT
4881 GCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGTGGGAGGATCACTTGAACCCAGGAGTTTGGGGTGCAGTGAGCTATGAT
4961 TGCGACACTGCACTCCAGCCTGGGCAACAGAGCAAGACCCTGTCTCAAAAAAAAAAAAAAAAAAAGAATGTGAATTTAGC
5041 TCCAATTCCAAATGACTAACTCTTAGGCCAGTCATAGCCAATGAAATCATCTGACGGTAGCTTCTGTAGCCCTTAACCTA
5121 AGGAGTCATTAGAGGTTATAGTAAATTAGTTTCTCTAGTGGTGCAGAGAGAAATGCCATCGGGGAAATTATCACTGTCTT
5201 TTTGGCTAAAGTTTTATATTGTGAACTGGATCCCACTTAACAGCTTAAAAACACAAAAATGAAAGGGTAGTCCTAGTTTA
5281 TCTTCTTAATTAGAATCATTATTTGGAAATAAGATTTGCAATGTGCTGTCTATCCCCAAACACTGCTGAGCTTGCTGGAA
5361 AACAGAATTTAACATGAATGTTGTCTGAAAGCTGTAGGATCAATGGCAAAAAAGGGGAAATGTTTGGTAGGGAATTGGAC
5441 CAGTTCTAAGGTATCACTTTTAATTATAAAATAATGTCTTCCTTTTTATCTGCTTTTCAGACAGCCTCAGTGAACTATTA
5521 AACATTTGTGTGCAAAGTCCTATTTTGCTTATCTAAGGCATTTTGACTTGGAAGTATTAAACTTCAGGAACGAGCTAGAG
5601 AAGACAATGAGGGTATGTTAGAGAAGGAAAAATAGGAGCTTTTTGCTTATGGATTTTAGAGGTCCACAAATCGAAAGGAA
5681 AAATAAATTTCTTCATTTCTAACCCTAAAATAATTTTGTTAATGAGATGCTGGGAAGAAGACTACCAAAAGGCCTCAAAG
5761 CTCATGCTTCTAGAATATTCAGTAATTCTGAATAGTCTTTGGGAAGTAGCATTTCTTGGGAAGTAGCATTTCCCTTCTTC
5841 CAAATAACTGTTTGAGATCTTAAAACAGAAAATCCAGTGTTAATGGGCTCTAGATCTTAAACTAGGTGAGCAGCTTCTTA
5921 CATACAACCAGTTCCTTGTTAAGGATCCAGCAGGAAAACCAGCCATAAAACATTTCAACATGCAGTTTGGGGGCTCCCTT
6001 GCTTATTCACTGAGTTTAAGCTCTTGCTGCAACATAGCTCTGTACCATCTGGGATGCTAGCAGTCACAGCAGTTAGCTCA
6081 GATATCTGAGCTGTCTGCCACACAAAGCCTGAGGAGATCATCATTCTTCAGTTTCATTCATTACTTAATGAATGCCAAAT
6161 TAATTGGCAGGAAGAAGAAACACTGTGTGATATACTGAACAAGCCTGTGTGCATGAATAAGGAGCCACTCAAAAAGCCAA
6241 TTTTGAGCTTTATTTCTCCGTTGTTAACAAATCTCAAGAAAGCCTTTGTTACAGTTTAGCTCATGTCATTTGGTTGGTTT
6321 TATTTTCTAGCCCTTTAACATAGGAGGAAAATTGTCATTTCATGTATAACTTGTAACACAGAATTGAACTGATACTAGTT
6401 TCCTTGCCTTAAATTAATTATATGTCATCCCAAGGGTCTCTGTTAATTCTGCTTTGCCAAGCAATAATGAGATCTGGGTT
6481 TGGCATTAGAAGTATTTCATAATTTTGGTTTTTTATTTAGGTTTCCTCCACATCTGTAAAGTGATTGATTAAATTAGAGG
6561 AGGCGTGTAGAATAAATCCCAATCCCATTGCAACTGGCAGAGCTTTATAAATCTTTATAAATTCAGTTACAACAAAGGAG
6641 AGGATCCTACACCATTAGAGCCATGCCATCAGGTGTTTGCAAGTGACAGCTGTAGTGTGTTGCCTCAAATAATACCAAGT
6721 TATAAATAATACCAAGTAATTATCAACTCACTCCCAAATTTAATAAGATATCAAAGTCCAAAAGGTTACTTAGGAGTAGT
6801 CTTCCGTGGGGGAAGATAAATTTATTAAAGAGTCATGTACTGATCTTTTTCTTGGGATTTTTTTTCCTTTCCCAGAAAAA
6881 AAAATTATTTTGGTGACTGATCAATTGTAAACAATTTTCTTCCTTACTTACAAATCATCCGTTCAGAAAAATAAAAGTGG
6961 ACTTCCTTTCCTAAGCATTACAATTAGCCTGGGCAAGAGGTGTTATGATTGTCTTATTCTTTAAGCCGGCTTACTTTTTG
7041 GATTTGTGTGAAATGTCTTTTGAAAAGAAAGTAGATAGTATAGTATTAATTAACTACTTTGTATAGTCTTCTGCATAATT
7121 TAGAGTTGAAAATAATGTAACATTTTCCTGTGAACAGATTCCTTTATGCGTACATACTTTATAAATATACATACATACAC
7201 ATACACATACATTTTTAAAATGCTCTTTTTAAAGAGATTCTTATCTTGCTCCCACTCCAAAAGCTATGTACAGTTGAGTT
7281 ATTAGCCTCAGAGGAAGAGTACAGGAAAGCGAAGATGAGGACCTCCTTTTCTTGTGTTGGTCTTGGGAACAAACAGTATT
7361 CCGTCTTTCAAATATGGCATATTTCTAAACAGTTTGGGAAAGATGTTAGAATTTTTTAAAAGTCAGCTCTTTTATAAATT
7441 GGAAGTACTCAGTAGTCAGAAATTAAGATCCCCTCTGATAGAGATAGATTCTCAAAACCAAAATTGGACTGAAAATTAGA
7521 TTGAGAAGAAAGATACAACTTCCTCCATAGCCAATAAAATCTGTCTTTCCAAGTCTGCTTATTAATGCTGTGAATCGCTC
7601 CTTCTGTTTGTGAAAACATCTCCTGGACTGGAAATGTGGTGCTGTAACCAGCTGAGCCGAAAGTTGGAGAATGTTAAATA
7681 TCTTATATGGGACTTACGATAAAATGTATTGATGTTAGTGATTGTCAAAATAGGTTTATCATTTAAAAAACTAGGAAATT
7761 ACTAAGTATAAAGAAGAAAAACCAGTATTAATTAAGTGATGAGACCTGTTCATTTTGTTTTCCCTGACTTATTTCCATTA
7841 CCAAACATAGTAAAGGCCAGAAAAGATTAAAAAAAAAATTAACACAGCCATTCCATTGTTTTTTACCACATGGAGAAAGG
7921 ACCAGGCTGGAAGCATATGTCCCCCCACCCTTATTTATATTCCTTTGAGCATTGCCGTTTTCTAGACAGACAATCCGAAA
8001 ATAATTGTGTTGATAGGTCTGTTTAAGCCTGAACTCTGGGTGTAAAATGTTATCCAGAAGCTATAGGGAGCTGCCTTGCT
8081 CAGGTCATTGGAAATTTCAACCCTAAGACTCATTGGAATTTCTAAGTCCGTTATGCACCATTATGGGCATATGGAGCATA
8161 TTCATACCATGAGGAGGAGTCTTTGTTTATGATGGACTTTTTAATATGGCCATAATTAAACTCACACTCAAAAAGGATGA
8241 GCTATTGTCAAAAGCCAAAAGAAAAACAGACAAAATGAACATGAAGCAAGGAGTCCATAAAACAAGAGTTCTTTACCACG
8321 TTTAAGCAAATGTCTCTCAAAAAAAATTGTATTTCTGTGCACATTAGCTGAGATTCACACATTTTGCACCTCAGTAGTAT
8401 TTCAGATGAGACTCAATGTGTGGAGAAAACCGCTAACTTGTTTGGTTCTACTCTTACCCCCTCTTCTGTGGCAATGTGGG
8481 GTCAGGGCCGTATCCTAAAGTATCCACATGGTCTTAAATGGAAATCATGGGACTCTGGAAAGCTGGCATGAGCTGGTTGG
8561 AGCTTTTAAACAGAAGTGCTTTATGGGTATCAGATCTCTTCTGACATCAATTGTTTCAAATCATTGTTGGGCTCTGTCGT
8641 GTTCTGCAATCTTCCCCATTCCCCTCATGATCTCTGGCTTATCTTTTATCCAATCTGTATGGACTTTTTAGGATTTTTTT
8721 TTTCTTATAGTACAAATAATTTTCAGATCCCAGCTTTGGTAAATGTGTTAATTCTACTTTGTGAATAAATAAATGAGTGA
8801 TCTGCTAAAAATGGCAATTGTAGAATTATGTTGTATGTAATGTACATATGGAGAAAGAATGTATTTTGTTCATTTTCTTA
8881 ATAAAATGTTATATATGGATGCTACAAGATAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAA---CAGUGUGAGgu 5'
              ||: |||    ||||||||  
Target 5' tggcCATAATTAAACTCACACTCaa 3'
8207 - 8231 138.00 -12.80
2
miRNA  3' guUUG-UGGUAAC-----AGUGUGAGGu 5'
            |:| |: ||||      ::|||||| 
Target 5' tgAGCTATGATTGCGACACTGCACTCCa 3'
4950 - 4977 132.00 -14.00
3
miRNA  3' guUUGUGGUAAC-AGUGUGAGGu 5'
            |||||| | | | |||||:: 
Target 5' gaAACACC-TGGCTAACACTTTa 3'
2522 - 2543 131.00 -16.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30182661 4 COSMIC
COSN30475445 13 COSMIC
COSN31605187 41 COSMIC
COSN30490110 47 COSMIC
COSN30482742 48 COSMIC
COSN30495998 49 COSMIC
COSN30493034 68 COSMIC
COSN30501785 76 COSMIC
COSN23016866 102 COSMIC
COSN24403557 153 COSMIC
COSN28889493 176 COSMIC
COSN20070261 254 COSMIC
COSN6594097 254 COSMIC
COSN27588084 344 COSMIC
COSN20285775 481 COSMIC
COSN31527499 689 COSMIC
COSN17076535 695 COSMIC
COSN17076536 696 COSMIC
COSN8515447 702 COSMIC
COSN30403159 767 COSMIC
COSN31555353 812 COSMIC
COSN8515448 819 COSMIC
COSN32055970 1529 COSMIC
COSN31567896 2434 COSMIC
COSN30173959 2674 COSMIC
COSN16061478 2825 COSMIC
COSN25631403 2897 COSMIC
COSN31532304 3047 COSMIC
COSN22554506 3143 COSMIC
COSN20104808 3504 COSMIC
COSN19262140 3772 COSMIC
COSN9923121 3993 COSMIC
COSN31482943 4169 COSMIC
COSN64160 4532 COSMIC
COSN19608639 4728 COSMIC
COSN16737130 5323 COSMIC
COSN9829363 5686 COSMIC
COSN4866038 5747 COSMIC
COSN29817025 6441 COSMIC
COSN28202160 6535 COSMIC
COSN20091696 6710 COSMIC
COSN2201695 6727 COSMIC
COSN32064341 6759 COSMIC
COSN20104809 6767 COSMIC
COSN32062051 6885 COSMIC
COSN4931327 6940 COSMIC
COSN9923122 6973 COSMIC
COSN7653778 7128 COSMIC
COSN6351372 7364 COSMIC
COSN2201696 7513 COSMIC
COSN22167690 7627 COSMIC
COSN6515465 7763 COSMIC
COSN20104810 7879 COSMIC
COSN7960214 8040 COSMIC
COSN7960215 8114 COSMIC
COSN20908541 8192 COSMIC
COSN14710088 8432 COSMIC
COSN2201697 8621 COSMIC
COSN6515466 8650 COSMIC
COSN27311993 8724 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1256593712 5 dbSNP
rs1461820173 13 dbSNP
rs200788391 19 dbSNP
rs1424467365 21 dbSNP
rs758089366 34 dbSNP
rs1242669551 36 dbSNP
rs373003032 38 dbSNP
rs746501584 40 dbSNP
rs907187722 41 dbSNP
rs1196109634 42 dbSNP
rs114954667 48 dbSNP
rs200845698 49 dbSNP
rs893178779 56 dbSNP
rs1327349367 62 dbSNP
rs1360086857 67 dbSNP
rs1012111397 71 dbSNP
rs1354145716 75 dbSNP
rs573298392 83 dbSNP
rs1449868529 85 dbSNP
rs1039746675 89 dbSNP
rs1020116015 90 dbSNP
rs967641659 92 dbSNP
rs1441985897 104 dbSNP
rs1329192883 106 dbSNP
rs371714 110 dbSNP
rs1391152643 121 dbSNP
rs898170797 132 dbSNP
rs765603424 135 dbSNP
rs562548306 138 dbSNP
rs531161025 163 dbSNP
rs1385166801 171 dbSNP
rs561738216 173 dbSNP
rs529046942 175 dbSNP
rs1019462720 176 dbSNP
rs1298159406 177 dbSNP
rs1181442298 184 dbSNP
rs963949239 191 dbSNP
rs866022858 194 dbSNP
rs886887684 206 dbSNP
rs1211416987 208 dbSNP
rs550912918 219 dbSNP
rs1490480689 220 dbSNP
rs397554 228 dbSNP
rs1248312543 237 dbSNP
rs150780881 237 dbSNP
rs371123347 237 dbSNP
rs1341465488 238 dbSNP
rs1193840184 243 dbSNP
rs1333636185 244 dbSNP
rs1272080393 248 dbSNP
rs1303779767 249 dbSNP
rs1405969658 252 dbSNP
rs975010574 252 dbSNP
rs1421587374 253 dbSNP
rs1021542877 254 dbSNP
rs192482723 254 dbSNP
rs959185610 254 dbSNP
rs749824251 256 dbSNP
rs1480666177 258 dbSNP
rs977427632 260 dbSNP
rs533238241 264 dbSNP
rs1250774997 266 dbSNP
rs397594 267 dbSNP
rs554436380 278 dbSNP
rs1204043499 284 dbSNP
rs1348054070 286 dbSNP
rs982978196 293 dbSNP
rs1188646068 298 dbSNP
rs1374139276 314 dbSNP
rs1345349000 315 dbSNP
rs1476707489 319 dbSNP
rs1402335254 324 dbSNP
rs933430511 326 dbSNP
rs200839609 334 dbSNP
rs912409104 334 dbSNP
rs369166809 337 dbSNP
rs1166498377 345 dbSNP
rs1419306551 346 dbSNP
rs1404585678 350 dbSNP
rs908016180 356 dbSNP
rs1039624828 357 dbSNP
rs1328118002 362 dbSNP
rs957163613 365 dbSNP
rs755258889 367 dbSNP
rs1478725942 372 dbSNP
rs1242667825 375 dbSNP
rs1191786848 376 dbSNP
rs1444829752 378 dbSNP
rs940868012 385 dbSNP
rs147313816 386 dbSNP
rs1261584401 393 dbSNP
rs1220879655 398 dbSNP
rs1319127042 406 dbSNP
rs1328103395 410 dbSNP
rs1428681081 414 dbSNP
rs928847443 419 dbSNP
rs1225203017 425 dbSNP
rs1046789730 431 dbSNP
rs1404192872 435 dbSNP
rs549004205 436 dbSNP
rs1173941629 438 dbSNP
rs1411474845 440 dbSNP
rs1269554604 442 dbSNP
rs1167303513 454 dbSNP
rs140725015 460 dbSNP
rs1244382478 467 dbSNP
rs1460568469 467 dbSNP
rs1335180753 468 dbSNP
rs886835670 470 dbSNP
rs1270810016 477 dbSNP
rs1272913710 483 dbSNP
rs1213393047 486 dbSNP
rs527440900 489 dbSNP
rs1057475377 491 dbSNP
rs894647692 493 dbSNP
rs893168054 503 dbSNP
rs1333677545 514 dbSNP
rs1208796360 526 dbSNP
rs1013541973 537 dbSNP
rs1354963294 553 dbSNP
rs1327952121 555 dbSNP
rs1263284990 561 dbSNP
rs1387043740 565 dbSNP
rs1021825168 567 dbSNP
rs968971233 593 dbSNP
rs998794343 600 dbSNP
rs1475708242 620 dbSNP
rs1481158992 623 dbSNP
rs1031650535 624 dbSNP
rs954928779 626 dbSNP
rs1461163109 627 dbSNP
rs987578863 633 dbSNP
rs912344803 652 dbSNP
rs1311737112 655 dbSNP
rs963906708 656 dbSNP
rs1432500907 673 dbSNP
rs1387178619 680 dbSNP
rs975684927 686 dbSNP
rs1367343426 691 dbSNP
rs1303728232 694 dbSNP
rs919825182 697 dbSNP
rs1363228667 698 dbSNP
rs1160677907 699 dbSNP
rs1317480119 707 dbSNP
rs1419236818 709 dbSNP
rs750784588 716 dbSNP
rs1416388104 719 dbSNP
rs549016262 724 dbSNP
rs1046737099 731 dbSNP
rs536018739 753 dbSNP
rs1481652200 769 dbSNP
rs903292322 770 dbSNP
rs1199414042 774 dbSNP
rs1489876604 780 dbSNP
rs1333677056 786 dbSNP
rs1007992117 797 dbSNP
rs1262500064 804 dbSNP
rs1239371576 808 dbSNP
rs1282479851 809 dbSNP
rs1262160776 812 dbSNP
rs1347238038 813 dbSNP
rs1019410356 814 dbSNP
rs963896782 816 dbSNP
rs1404201657 821 dbSNP
rs747743856 832 dbSNP
rs1026648002 842 dbSNP
rs938392695 843 dbSNP
rs1204053662 851 dbSNP
rs1344217190 863 dbSNP
rs1156546237 870 dbSNP
rs1284173114 872 dbSNP
rs1471158460 874 dbSNP
rs1479719599 875 dbSNP
rs1486316949 875 dbSNP
rs372711634 876 dbSNP
rs1056880751 877 dbSNP
rs771906580 895 dbSNP
rs1187159706 901 dbSNP
rs894250590 903 dbSNP
rs142295248 906 dbSNP
rs535625970 908 dbSNP
rs982539429 909 dbSNP
rs904761070 916 dbSNP
rs557703978 921 dbSNP
rs970481079 935 dbSNP
rs999075596 936 dbSNP
rs1491476638 943 dbSNP
rs773060411 944 dbSNP
rs1286743636 955 dbSNP
rs1454197697 963 dbSNP
rs1451636624 968 dbSNP
rs183913713 973 dbSNP
rs1176101481 978 dbSNP
rs928793755 979 dbSNP
rs539736413 983 dbSNP
rs954734200 984 dbSNP
rs1056475912 996 dbSNP
rs1417391601 998 dbSNP
rs1185501047 1006 dbSNP
rs1461915490 1031 dbSNP
rs201032382 1033 dbSNP
rs1242789789 1043 dbSNP
rs1436558230 1046 dbSNP
rs151247672 1064 dbSNP
rs947348494 1067 dbSNP
rs1041737966 1069 dbSNP
rs1228137840 1078 dbSNP
rs1306861444 1079 dbSNP
rs966808516 1093 dbSNP
rs1391786265 1106 dbSNP
rs1294715662 1109 dbSNP
rs1247563312 1112 dbSNP
rs903236903 1119 dbSNP
rs1335718352 1122 dbSNP
rs1450903564 1123 dbSNP
rs975223207 1125 dbSNP
rs944135217 1133 dbSNP
rs1371884909 1136 dbSNP
rs1333630227 1146 dbSNP
rs1040849385 1149 dbSNP
rs899715185 1160 dbSNP
rs1384813091 1161 dbSNP
rs35069368 1161 dbSNP
rs982699449 1164 dbSNP
rs573146296 1166 dbSNP
rs908495496 1167 dbSNP
rs938353842 1172 dbSNP
rs1303567821 1173 dbSNP
rs367750680 1178 dbSNP
rs539331451 1178 dbSNP
rs996757033 1192 dbSNP
rs540383070 1199 dbSNP
rs1224029921 1201 dbSNP
rs1359615998 1205 dbSNP
rs770875799 1219 dbSNP
rs776379731 1224 dbSNP
rs1004260942 1229 dbSNP
rs1337166296 1230 dbSNP
rs1015268889 1234 dbSNP
rs1308104021 1242 dbSNP
rs759546814 1246 dbSNP
rs1369227550 1247 dbSNP
rs771952847 1258 dbSNP
rs1425376254 1260 dbSNP
rs904706738 1261 dbSNP
rs981890059 1275 dbSNP
rs1035843820 1283 dbSNP
rs1417618990 1286 dbSNP
rs959159300 1287 dbSNP
rs991687666 1289 dbSNP
rs934873021 1296 dbSNP
rs139321372 1311 dbSNP
rs982630384 1312 dbSNP
rs947666285 1331 dbSNP
rs977792978 1332 dbSNP
rs547224791 1335 dbSNP
rs1418326319 1339 dbSNP
rs1374787260 1342 dbSNP
rs1462247328 1345 dbSNP
rs570544443 1349 dbSNP
rs944122261 1359 dbSNP
rs1290311724 1363 dbSNP
rs544444345 1370 dbSNP
rs1207580948 1374 dbSNP
rs1018042760 1375 dbSNP
rs1238747168 1385 dbSNP
rs1349093462 1389 dbSNP
rs1299724846 1393 dbSNP
rs1393843360 1394 dbSNP
rs1390498394 1396 dbSNP
rs1406028092 1401 dbSNP
rs900558596 1410 dbSNP
rs994932858 1416 dbSNP
rs1041133643 1421 dbSNP
rs1402572188 1422 dbSNP
rs1385903959 1423 dbSNP
rs1303726839 1433 dbSNP
rs1456495301 1434 dbSNP
rs1409411205 1436 dbSNP
rs899663015 1440 dbSNP
rs1178321985 1446 dbSNP
rs932447603 1453 dbSNP
rs1268119508 1467 dbSNP
rs1231456645 1471 dbSNP
rs1196108775 1479 dbSNP
rs73490835 1481 dbSNP
rs1312186275 1494 dbSNP
rs146492516 1510 dbSNP
rs1015498638 1514 dbSNP
rs1298160618 1518 dbSNP
rs1265316312 1520 dbSNP
rs1224544907 1521 dbSNP
rs888319776 1525 dbSNP
rs1273621284 1528 dbSNP
rs1004139647 1533 dbSNP
rs1327159538 1539 dbSNP
rs992483154 1547 dbSNP
rs545317326 1549 dbSNP
rs1015259078 1552 dbSNP
rs1338396892 1570 dbSNP
rs906224466 1584 dbSNP
rs948439007 1585 dbSNP
rs796327198 1586 dbSNP
rs189356822 1596 dbSNP
rs775324724 1597 dbSNP
rs1033403414 1598 dbSNP
rs1191851953 1612 dbSNP
rs1463239386 1617 dbSNP
rs762021103 1618 dbSNP
rs527243094 1622 dbSNP
rs548820534 1625 dbSNP
rs934820754 1630 dbSNP
rs1204676309 1637 dbSNP
rs1053723449 1641 dbSNP
rs767770626 1646 dbSNP
rs1429097296 1648 dbSNP
rs181344628 1652 dbSNP
rs747709227 1656 dbSNP
rs1269625806 1659 dbSNP
rs1226301848 1663 dbSNP
rs1039003581 1664 dbSNP
rs760403487 1671 dbSNP
rs1021803038 1672 dbSNP
rs969369722 1675 dbSNP
rs1316048065 1677 dbSNP
rs12538523 1702 dbSNP
rs1461311059 1706 dbSNP
rs924596045 1712 dbSNP
rs944069815 1714 dbSNP
rs1331966162 1723 dbSNP
rs550804318 1724 dbSNP
rs976734211 1725 dbSNP
rs868361045 1731 dbSNP
rs932752442 1736 dbSNP
rs569106376 1739 dbSNP
rs140959486 1748 dbSNP
rs1472268342 1749 dbSNP
rs909750438 1757 dbSNP
rs1367491211 1765 dbSNP
rs1383309177 1773 dbSNP
rs12533308 1775 dbSNP
rs1207099105 1789 dbSNP
rs766512186 1795 dbSNP
rs906462859 1796 dbSNP
rs184729091 1798 dbSNP
rs1272980654 1799 dbSNP
rs1218426272 1813 dbSNP
rs1203076454 1820 dbSNP
rs754234032 1821 dbSNP
rs1337313794 1824 dbSNP
rs1377252694 1830 dbSNP
rs1282172921 1833 dbSNP
rs190011525 1839 dbSNP
rs1022589656 1848 dbSNP
rs1486251492 1854 dbSNP
rs755522990 1858 dbSNP
rs1022208918 1859 dbSNP
rs968936349 1892 dbSNP
rs999049483 1895 dbSNP
rs1163669860 1896 dbSNP
rs1031855137 1901 dbSNP
rs965618300 1903 dbSNP
rs575867985 1905 dbSNP
rs1179293772 1916 dbSNP
rs921279668 1917 dbSNP
rs377313054 1920 dbSNP
rs779406293 1931 dbSNP
rs984259650 1937 dbSNP
rs574217605 1938 dbSNP
rs939808016 1939 dbSNP
rs1220967737 1942 dbSNP
rs1459591599 1953 dbSNP
rs1036887102 1957 dbSNP
rs1351204340 1960 dbSNP
rs922214057 1972 dbSNP
rs1407847181 1973 dbSNP
rs927828608 1977 dbSNP
rs1345228684 1980 dbSNP
rs930618188 1982 dbSNP
rs1432316560 1983 dbSNP
rs1303176359 1985 dbSNP
rs1291088680 1986 dbSNP
rs1360498877 1989 dbSNP
rs1399781191 1992 dbSNP
rs1435188698 1993 dbSNP
rs1294356137 1996 dbSNP
rs1357570161 1998 dbSNP
rs770889897 1998 dbSNP
rs181714553 2000 dbSNP
rs1054787799 2005 dbSNP
rs1289455311 2021 dbSNP
rs879034047 2022 dbSNP
rs886500282 2037 dbSNP
rs894850908 2044 dbSNP
rs1022013172 2057 dbSNP
rs1481682976 2080 dbSNP
rs144891232 2086 dbSNP
rs577865598 2090 dbSNP
rs1487570577 2096 dbSNP
rs1244044504 2098 dbSNP
rs1218042575 2101 dbSNP
rs1036831741 2102 dbSNP
rs758091763 2112 dbSNP
rs1188362575 2120 dbSNP
rs776297503 2124 dbSNP
rs902273231 2139 dbSNP
rs77448884 2142 dbSNP
rs1283891993 2145 dbSNP
rs1014127410 2171 dbSNP
rs118177235 2174 dbSNP
rs867114851 2175 dbSNP
rs1032654242 2176 dbSNP
rs955757281 2179 dbSNP
rs965564741 2199 dbSNP
rs1359176130 2202 dbSNP
rs370698476 2204 dbSNP
rs1314050110 2205 dbSNP
rs1421656587 2209 dbSNP
rs1187218027 2216 dbSNP
rs911686182 2217 dbSNP
rs966604010 2221 dbSNP
rs974967428 2222 dbSNP
rs1377598617 2223 dbSNP
rs1462536791 2231 dbSNP
rs1256504908 2233 dbSNP
rs1413333071 2235 dbSNP
rs555324856 2241 dbSNP
rs930900946 2244 dbSNP
rs954093260 2247 dbSNP
rs907882086 2249 dbSNP
rs575237535 2252 dbSNP
rs1352857757 2261 dbSNP
rs1302639354 2263 dbSNP
rs1464948115 2266 dbSNP
rs1211455889 2272 dbSNP
rs1171193966 2274 dbSNP
rs185839192 2279 dbSNP
rs909946156 2287 dbSNP
rs961458153 2299 dbSNP
rs1233098312 2309 dbSNP
rs1256516382 2326 dbSNP
rs146768340 2328 dbSNP
rs972529596 2334 dbSNP
rs927816790 2337 dbSNP
rs191028260 2343 dbSNP
rs531352513 2346 dbSNP
rs1253058339 2348 dbSNP
rs990776363 2351 dbSNP
rs549420223 2359 dbSNP
rs1174953936 2364 dbSNP
rs1247630288 2365 dbSNP
rs181815913 2367 dbSNP
rs745731135 2368 dbSNP
rs1454347570 2373 dbSNP
rs946374062 2383 dbSNP
rs769793319 2389 dbSNP
rs902221958 2390 dbSNP
rs775236327 2393 dbSNP
rs955706911 2405 dbSNP
rs1385788511 2408 dbSNP
rs1053206695 2409 dbSNP
rs1009941226 2412 dbSNP
rs1368139104 2415 dbSNP
rs1425494309 2415 dbSNP
rs148901719 2417 dbSNP
rs551811958 2419 dbSNP
rs775716774 2432 dbSNP
rs1186557054 2433 dbSNP
rs1444685846 2434 dbSNP
rs1252577362 2437 dbSNP
rs762789272 2439 dbSNP
rs1296700222 2440 dbSNP
rs1019098285 2441 dbSNP
rs1248931387 2445 dbSNP
rs1376190455 2447 dbSNP
rs1224096693 2453 dbSNP
rs1028546489 2455 dbSNP
rs1356579455 2456 dbSNP
rs975294369 2471 dbSNP
rs890054683 2474 dbSNP
rs1305450367 2490 dbSNP
rs1319164021 2492 dbSNP
rs1345728031 2492 dbSNP
rs1289386125 2493 dbSNP
rs1218416634 2495 dbSNP
rs768465823 2499 dbSNP
rs1273513995 2515 dbSNP
rs1439167612 2518 dbSNP
rs867522947 2519 dbSNP
rs773383394 2540 dbSNP
rs1390254923 2544 dbSNP
rs1161750054 2549 dbSNP
rs1456189320 2550 dbSNP
rs961446497 2558 dbSNP
rs1365257292 2559 dbSNP
rs878976558 2568 dbSNP
rs985042646 2575 dbSNP
rs540910484 2576 dbSNP
rs940679248 2577 dbSNP
rs1195026731 2578 dbSNP
rs567178528 2586 dbSNP
rs1266212774 2587 dbSNP
rs1034834148 2601 dbSNP
rs554382734 2606 dbSNP
rs766314838 2609 dbSNP
rs534208047 2610 dbSNP
rs1486646712 2623 dbSNP
rs1684176 2636 dbSNP
rs916476947 2640 dbSNP
rs1172326464 2646 dbSNP
rs143459058 2652 dbSNP
rs1412020645 2655 dbSNP
rs186041695 2661 dbSNP
rs1399844442 2696 dbSNP
rs935878723 2701 dbSNP
rs1321687824 2714 dbSNP
rs1384093674 2718 dbSNP
rs1441730391 2722 dbSNP
rs375595190 2724 dbSNP
rs1328078157 2726 dbSNP
rs1320951093 2734 dbSNP
rs1456540442 2742 dbSNP
rs923640656 2746 dbSNP
rs1409656107 2749 dbSNP
rs1174303606 2753 dbSNP
rs1478322401 2756 dbSNP
rs1054295200 2761 dbSNP
rs562404289 2761 dbSNP
rs935077749 2764 dbSNP
rs147976672 2778 dbSNP
rs901334801 2799 dbSNP
rs1248311994 2804 dbSNP
rs1208465206 2810 dbSNP
rs1018632036 2822 dbSNP
rs1265532560 2832 dbSNP
rs1270715833 2839 dbSNP
rs901561596 2849 dbSNP
rs934153249 2860 dbSNP
rs995946947 2868 dbSNP
rs1273098458 2869 dbSNP
rs1229762714 2871 dbSNP
rs1341136936 2876 dbSNP
rs1212589806 2879 dbSNP
rs1366159242 2885 dbSNP
rs1297225621 2889 dbSNP
rs1434072023 2893 dbSNP
rs1029126119 2914 dbSNP
rs10273646 2919 dbSNP
rs1414933612 2940 dbSNP
rs1335139250 2942 dbSNP
rs1170273396 2953 dbSNP
rs1431147418 2961 dbSNP
rs1214990205 2967 dbSNP
rs1250640941 2969 dbSNP
rs1390403493 2976 dbSNP
rs1187606022 2977 dbSNP
rs984990448 2978 dbSNP
rs753088027 2979 dbSNP
rs1188705445 2983 dbSNP
rs962342699 2986 dbSNP
rs758783741 2990 dbSNP
rs1006254367 2993 dbSNP
rs1343036259 3002 dbSNP
rs190900516 3003 dbSNP
rs992543369 3005 dbSNP
rs1643270 3008 dbSNP
rs1169073201 3018 dbSNP
rs572345172 3025 dbSNP
rs897184066 3041 dbSNP
rs1285687191 3053 dbSNP
rs1448547402 3069 dbSNP
rs1423170806 3070 dbSNP
rs994241318 3074 dbSNP
rs1332190953 3080 dbSNP
rs948097930 3088 dbSNP
rs1035075556 3095 dbSNP
rs1167159407 3099 dbSNP
rs1167424427 3100 dbSNP
rs1427382391 3106 dbSNP
rs925407964 3111 dbSNP
rs751102817 3112 dbSNP
rs762362958 3113 dbSNP
rs1472710942 3121 dbSNP
rs1388625645 3122 dbSNP
rs960799399 3124 dbSNP
rs1184892812 3128 dbSNP
rs891683176 3130 dbSNP
rs945999719 3131 dbSNP
rs1040411014 3135 dbSNP
rs542556576 3136 dbSNP
rs1361834893 3138 dbSNP
rs901510684 3145 dbSNP
rs1228670784 3147 dbSNP
rs1328195510 3176 dbSNP
rs756944807 3185 dbSNP
rs1397897629 3190 dbSNP
rs995880648 3192 dbSNP
rs1028738671 3193 dbSNP
rs1277381725 3202 dbSNP
rs1306847349 3212 dbSNP
rs1355661961 3225 dbSNP
rs887554993 3241 dbSNP
rs561333366 3246 dbSNP
rs967980515 3250 dbSNP
rs979795188 3254 dbSNP
rs923588036 3258 dbSNP
rs956400687 3266 dbSNP
rs975739670 3275 dbSNP
rs922987303 3276 dbSNP
rs745425487 3283 dbSNP
rs962576794 3288 dbSNP
rs1354969164 3290 dbSNP
rs1473176093 3299 dbSNP
rs1205212710 3309 dbSNP
rs575594747 3312 dbSNP
rs1180069280 3316 dbSNP
rs1489544744 3317 dbSNP
rs931734616 3323 dbSNP
rs1049917097 3344 dbSNP
rs1287423969 3354 dbSNP
rs1025689739 3358 dbSNP
rs1262974764 3359 dbSNP
rs1475759330 3360 dbSNP
rs911419027 3369 dbSNP
rs980770231 3373 dbSNP
rs543131969 3379 dbSNP
rs1293609411 3381 dbSNP
rs1435258424 3399 dbSNP
rs958135108 3400 dbSNP
rs564612709 3401 dbSNP
rs941604193 3403 dbSNP
rs989914509 3404 dbSNP
rs1157664195 3409 dbSNP
rs913074511 3411 dbSNP
rs1425886264 3416 dbSNP
rs1038663335 3419 dbSNP
rs1190719997 3425 dbSNP
rs945913944 3426 dbSNP
rs1366936470 3427 dbSNP
rs1040288988 3454 dbSNP
rs1210350873 3467 dbSNP
rs897425746 3470 dbSNP
rs923214189 3486 dbSNP
rs1472504873 3490 dbSNP
rs1159275767 3492 dbSNP
rs149567429 3494 dbSNP
rs879446184 3494 dbSNP
rs994143820 3495 dbSNP
rs1313910476 3499 dbSNP
rs1050108812 3500 dbSNP
rs1218181680 3504 dbSNP
rs1056481216 3505 dbSNP
rs1436260532 3507 dbSNP
rs1364849587 3508 dbSNP
rs1387017276 3509 dbSNP
rs896534655 3512 dbSNP
rs1012779380 3516 dbSNP
rs1023463189 3518 dbSNP
rs1005986987 3522 dbSNP
rs1360274481 3537 dbSNP
rs1036901546 3543 dbSNP
rs55887872 3558 dbSNP
rs1412903374 3573 dbSNP
rs1392240229 3576 dbSNP
rs897993297 3603 dbSNP
rs1355730592 3605 dbSNP
rs1417827730 3607 dbSNP
rs1189385485 3609 dbSNP
rs1449095702 3612 dbSNP
rs1467690895 3612 dbSNP
rs1247140020 3615 dbSNP
rs1332598294 3616 dbSNP
rs532090054 3616 dbSNP
rs750791565 3617 dbSNP
rs1416404253 3621 dbSNP
rs1208813011 3626 dbSNP
rs1345191595 3629 dbSNP
rs1276174351 3634 dbSNP
rs1310054519 3636 dbSNP
rs1293822487 3637 dbSNP
rs1398210854 3638 dbSNP
rs1380521233 3642 dbSNP
rs1302831111 3651 dbSNP
rs1000775246 3655 dbSNP
rs1014206439 3657 dbSNP
rs200081907 3659 dbSNP
rs1169338792 3661 dbSNP
rs1429292623 3665 dbSNP
rs769701783 3672 dbSNP
rs1280835945 3677 dbSNP
rs1030846405 3681 dbSNP
rs1388601429 3685 dbSNP
rs956626624 3686 dbSNP
rs551981743 3701 dbSNP
rs1425407860 3709 dbSNP
rs1256761292 3733 dbSNP
rs1181154625 3735 dbSNP
rs975688655 3740 dbSNP
rs922977474 3744 dbSNP
rs1253301734 3745 dbSNP
rs560508651 3751 dbSNP
rs528033561 3757 dbSNP
rs113514011 3758 dbSNP
rs1247420015 3761 dbSNP
rs1254318450 3764 dbSNP
rs1423508735 3776 dbSNP
rs1322635968 3777 dbSNP
rs1312459626 3778 dbSNP
rs1231951193 3784 dbSNP
rs1352888890 3790 dbSNP
rs779920621 3791 dbSNP
rs1032318211 3796 dbSNP
rs1437928397 3799 dbSNP
rs1157914960 3801 dbSNP
rs1395618000 3802 dbSNP
rs958081500 3803 dbSNP
rs536359260 3823 dbSNP
rs941498223 3827 dbSNP
rs1458618763 3829 dbSNP
rs1038568361 3831 dbSNP
rs918802830 3834 dbSNP
rs1436351124 3836 dbSNP
rs567671880 3844 dbSNP
rs1474158633 3846 dbSNP
rs1414161673 3849 dbSNP
rs914012234 3855 dbSNP
rs967228609 3857 dbSNP
rs930218965 3873 dbSNP
rs749255015 3874 dbSNP
rs896515400 3881 dbSNP
rs1012313292 3886 dbSNP
rs1289598982 3895 dbSNP
rs145845528 3898 dbSNP
rs1333997497 3899 dbSNP
rs538207542 3899 dbSNP
rs908884002 3900 dbSNP
rs550319718 3915 dbSNP
rs1390321794 3916 dbSNP
rs1324950327 3920 dbSNP
rs1373955251 3922 dbSNP
rs1459719311 3928 dbSNP
rs1238791254 3931 dbSNP
rs373102343 3933 dbSNP
rs1309159560 3934 dbSNP
rs370183509 3944 dbSNP
rs1472224540 3945 dbSNP
rs1036105618 3946 dbSNP
rs1200396578 3947 dbSNP
rs1000616252 3953 dbSNP
rs1433385527 3963 dbSNP
rs897601120 3974 dbSNP
rs1349304278 3985 dbSNP
rs1466575893 3988 dbSNP
rs1235852837 3992 dbSNP
rs1030801888 3994 dbSNP
rs1254667322 4006 dbSNP
rs756477964 4007 dbSNP
rs1257789251 4009 dbSNP
rs554905401 4012 dbSNP
rs1196553850 4013 dbSNP
rs1301611360 4020 dbSNP
rs1437561733 4021 dbSNP
rs1367005802 4024 dbSNP
rs1321011038 4029 dbSNP
rs892377499 4032 dbSNP
rs1382760468 4038 dbSNP
rs1456448750 4039 dbSNP
rs766603771 4048 dbSNP
rs905425297 4054 dbSNP
rs183041976 4063 dbSNP
rs1029935890 4069 dbSNP
rs1191301082 4074 dbSNP
rs188076348 4076 dbSNP
rs1248994893 4092 dbSNP
rs1455572401 4093 dbSNP
rs1445755305 4100 dbSNP
rs1010016766 4128 dbSNP
rs958028763 4128 dbSNP
rs985827567 4130 dbSNP
rs1344479681 4150 dbSNP
rs1278285574 4152 dbSNP
rs1016405758 4153 dbSNP
rs1021024151 4177 dbSNP
rs963160070 4182 dbSNP
rs774211495 4186 dbSNP
rs975914595 4187 dbSNP
rs1462330084 4189 dbSNP
rs547373859 4191 dbSNP
rs191164289 4192 dbSNP
rs1445382466 4204 dbSNP
rs183175312 4209 dbSNP
rs760795398 4220 dbSNP
rs1431202722 4230 dbSNP
rs1390459012 4232 dbSNP
rs986046789 4235 dbSNP
rs771249945 4239 dbSNP
rs992432068 4243 dbSNP
rs1372321331 4244 dbSNP
rs909165152 4247 dbSNP
rs941665979 4264 dbSNP
rs1255426916 4266 dbSNP
rs1388989786 4266 dbSNP
rs1299845437 4282 dbSNP
rs752546582 4287 dbSNP
rs1274271709 4291 dbSNP
rs138481727 4296 dbSNP
rs918993060 4302 dbSNP
rs187459354 4304 dbSNP
rs1245378921 4313 dbSNP
rs1354769205 4318 dbSNP
rs1310520572 4321 dbSNP
rs1411172482 4323 dbSNP
rs1370785391 4324 dbSNP
rs373711489 4325 dbSNP
rs1045089582 4331 dbSNP
rs1046525866 4332 dbSNP
rs1260232435 4333 dbSNP
rs905373069 4340 dbSNP
rs144875283 4341 dbSNP
rs1372137982 4343 dbSNP
rs938222339 4344 dbSNP
rs1475153071 4349 dbSNP
rs1053955688 4354 dbSNP
rs1184430359 4376 dbSNP
rs894089660 4380 dbSNP
rs776540654 4402 dbSNP
rs1232385637 4410 dbSNP
rs1202614539 4411 dbSNP
rs1198066407 4412 dbSNP
rs936792572 4425 dbSNP
rs554411074 4442 dbSNP
rs575656416 4445 dbSNP
rs192600093 4447 dbSNP
rs1291437593 4450 dbSNP
rs901225958 4452 dbSNP
rs1278472497 4455 dbSNP
rs1439503863 4455 dbSNP
rs1351304324 4464 dbSNP
rs1324580710 4465 dbSNP
rs558111672 4475 dbSNP
rs1266589787 4476 dbSNP
rs1428887126 4495 dbSNP
rs998682879 4498 dbSNP
rs1407298440 4500 dbSNP
rs1473207198 4500 dbSNP
rs576908901 4511 dbSNP
rs1030637347 4512 dbSNP
rs1175579890 4515 dbSNP
rs1479117232 4516 dbSNP
rs889058236 4518 dbSNP
rs759739351 4520 dbSNP
rs1007599999 4522 dbSNP
rs1420986162 4528 dbSNP
rs1030128484 4529 dbSNP
rs540764111 4544 dbSNP
rs953187574 4545 dbSNP
rs1464825429 4562 dbSNP
rs1015937696 4564 dbSNP
rs184785850 4582 dbSNP
rs971844499 4584 dbSNP
rs1733864 4591 dbSNP
rs1016172163 4597 dbSNP
rs1221614814 4618 dbSNP
rs187639322 4619 dbSNP
rs1455939230 4631 dbSNP
rs1369148985 4638 dbSNP
rs1323003429 4640 dbSNP
rs1292233367 4642 dbSNP
rs992340256 4644 dbSNP
rs1458184508 4647 dbSNP
rs963646115 4649 dbSNP
rs1156976714 4650 dbSNP
rs918926750 4654 dbSNP
rs971727786 4654 dbSNP
rs1173190364 4658 dbSNP
rs1383122445 4659 dbSNP
rs918138797 4663 dbSNP
rs1280533942 4664 dbSNP
rs1338681304 4665 dbSNP
rs1190324025 4669 dbSNP
rs948339725 4670 dbSNP
rs1218195566 4674 dbSNP
rs1241512314 4679 dbSNP
rs527839167 4682 dbSNP
rs75698445 4684 dbSNP
rs1323505195 4687 dbSNP
rs1333073146 4696 dbSNP
rs114763097 4700 dbSNP
rs926407325 4702 dbSNP
rs192541147 4703 dbSNP
rs550240431 4704 dbSNP
rs1436332942 4707 dbSNP
rs1053903639 4732 dbSNP
rs1287694262 4742 dbSNP
rs936740168 4742 dbSNP
rs571548385 4743 dbSNP
rs1173133223 4747 dbSNP
rs1433063831 4753 dbSNP
rs1052503113 4761 dbSNP
rs1170244524 4775 dbSNP
rs1428957878 4776 dbSNP
rs1418542411 4779 dbSNP
rs945630057 4783 dbSNP
rs1484212661 4788 dbSNP
rs1042355762 4789 dbSNP
rs552656874 4807 dbSNP
rs1209590120 4808 dbSNP
rs752015871 4809 dbSNP
rs1276419067 4815 dbSNP
rs532642473 4821 dbSNP
rs1307222876 4823 dbSNP
rs569227499 4825 dbSNP
rs1230491437 4833 dbSNP
rs998235221 4834 dbSNP
rs1312315239 4848 dbSNP
rs888996331 4859 dbSNP
rs1028399970 4869 dbSNP
rs889900076 4876 dbSNP
rs1007378121 4883 dbSNP
rs1461674145 4889 dbSNP
rs1353664376 4895 dbSNP
rs1168087360 4903 dbSNP
rs1425463893 4905 dbSNP
rs1418537992 4916 dbSNP
rs1007507822 4917 dbSNP
rs1138264 4930 dbSNP
rs547534634 4932 dbSNP
rs1163538647 4940 dbSNP
rs1253364580 4941 dbSNP
rs1195956247 4943 dbSNP
rs898852866 4944 dbSNP
rs1249931156 4963 dbSNP
rs993232952 4964 dbSNP
rs1026040199 4965 dbSNP
rs1293288859 4969 dbSNP
rs1232004538 4972 dbSNP
rs112816609 4974 dbSNP
rs1300608914 4977 dbSNP
rs1014130923 4979 dbSNP
rs1025175853 4980 dbSNP
rs1026271287 4983 dbSNP
rs1459301027 4984 dbSNP
rs1294066966 4989 dbSNP
rs1381707538 4990 dbSNP
rs1164045859 4992 dbSNP
rs1226653298 4994 dbSNP
rs1312164549 4999 dbSNP
rs1317620360 5006 dbSNP
rs1338252131 5006 dbSNP
rs1459819705 5006 dbSNP
rs1212312365 5007 dbSNP
rs1238483734 5007 dbSNP
rs1261353093 5007 dbSNP
rs1303761190 5007 dbSNP
rs1331882170 5007 dbSNP
rs1334191013 5007 dbSNP
rs1441918884 5007 dbSNP
rs1449579444 5007 dbSNP
rs3079482 5007 dbSNP
rs398067281 5007 dbSNP
rs572948374 5007 dbSNP
rs758264068 5007 dbSNP
rs970793012 5009 dbSNP
rs1242181425 5012 dbSNP
rs970043219 5018 dbSNP
rs1487806948 5019 dbSNP
rs1438569258 5023 dbSNP
rs1387093532 5024 dbSNP
rs1238840423 5026 dbSNP
rs397822304 5026 dbSNP
rs201166641 5027 dbSNP
rs536034261 5030 dbSNP
rs1408009512 5033 dbSNP
rs981070140 5046 dbSNP
rs1247000521 5047 dbSNP
rs1252719766 5049 dbSNP
rs540326063 5055 dbSNP
rs925274472 5067 dbSNP
rs958005880 5069 dbSNP
rs538322332 5082 dbSNP
rs988122637 5086 dbSNP
rs555034452 5087 dbSNP
rs1419464177 5092 dbSNP
rs140037795 5096 dbSNP
rs989576435 5097 dbSNP
rs915402943 5098 dbSNP
rs945609517 5112 dbSNP
rs1446032180 5116 dbSNP
rs538106378 5118 dbSNP
rs933415959 5133 dbSNP
rs1052024391 5135 dbSNP
rs1242424446 5142 dbSNP
rs933961923 5157 dbSNP
rs184343059 5158 dbSNP
rs889846201 5161 dbSNP
rs1005650065 5162 dbSNP
rs1037502582 5164 dbSNP
rs1172149584 5171 dbSNP
rs943260400 5176 dbSNP
rs558174874 5178 dbSNP
rs190014390 5181 dbSNP
rs554122033 5182 dbSNP
rs1258298966 5191 dbSNP
rs1310239102 5192 dbSNP
rs1485452468 5197 dbSNP
rs1230896340 5199 dbSNP
rs1278546015 5199 dbSNP
rs1341146347 5200 dbSNP
rs1270577351 5205 dbSNP
rs1226554435 5206 dbSNP
rs1208935728 5208 dbSNP
rs1233100935 5210 dbSNP
rs970691373 5213 dbSNP
rs879474598 5219 dbSNP
rs1003136537 5222 dbSNP
rs1176297963 5231 dbSNP
rs1047430443 5234 dbSNP
rs1167725336 5237 dbSNP
rs1474693348 5251 dbSNP
rs895561348 5259 dbSNP
rs959081606 5266 dbSNP
rs1474885217 5267 dbSNP
rs1236856166 5268 dbSNP
rs371552326 5274 dbSNP
rs1439677726 5285 dbSNP
rs989192941 5286 dbSNP
rs1173699955 5296 dbSNP
rs1273409914 5300 dbSNP
rs1014045485 5315 dbSNP
rs541129311 5322 dbSNP
rs1337353124 5323 dbSNP
rs1275046167 5324 dbSNP
rs757473218 5333 dbSNP
rs754968421 5337 dbSNP
rs1443870926 5339 dbSNP
rs978309250 5340 dbSNP
rs1328572548 5364 dbSNP
rs922821979 5375 dbSNP
rs149425422 5376 dbSNP
rs1401375260 5377 dbSNP
rs1166217531 5383 dbSNP
rs1461400865 5388 dbSNP
rs1415721277 5392 dbSNP
rs1179067881 5394 dbSNP
rs572621117 5398 dbSNP
rs969613312 5407 dbSNP
rs1002800197 5414 dbSNP
rs1449083806 5415 dbSNP
rs1470623142 5421 dbSNP
rs1032535110 5426 dbSNP
rs934245052 5435 dbSNP
rs543271537 5449 dbSNP
rs1049724158 5451 dbSNP
rs911231803 5452 dbSNP
rs778569471 5454 dbSNP
rs748012781 5461 dbSNP
rs561451380 5478 dbSNP
rs1334106622 5479 dbSNP
rs913937377 5492 dbSNP
rs954953790 5498 dbSNP
rs1225013777 5501 dbSNP
rs987595172 5502 dbSNP
rs1278526907 5507 dbSNP
rs532091185 5509 dbSNP
rs1439593531 5518 dbSNP
rs897268089 5519 dbSNP
rs117439433 5531 dbSNP
rs1218439431 5534 dbSNP
rs1392982014 5535 dbSNP
rs1161363062 5545 dbSNP
rs1401427131 5555 dbSNP
rs1273248662 5556 dbSNP
rs1319638661 5565 dbSNP
rs1407354336 5566 dbSNP
rs181144476 5572 dbSNP
rs1455762643 5576 dbSNP
rs1254601776 5580 dbSNP
rs1256819710 5586 dbSNP
rs1467957158 5587 dbSNP
rs532370518 5592 dbSNP
rs920470827 5593 dbSNP
rs929215556 5600 dbSNP
rs1447023960 5608 dbSNP
rs1200120223 5621 dbSNP
rs1221679438 5629 dbSNP
rs561586281 5634 dbSNP
rs1477237862 5639 dbSNP
rs1047427717 5650 dbSNP
rs1424566071 5651 dbSNP
rs895508362 5661 dbSNP
rs144697549 5663 dbSNP
rs1432125221 5670 dbSNP
rs1168822693 5673 dbSNP
rs1044123364 5674 dbSNP
rs1406029076 5678 dbSNP
rs1395969438 5684 dbSNP
rs1174013474 5692 dbSNP
rs1010561340 5696 dbSNP
rs148500435 5713 dbSNP
rs966505908 5716 dbSNP
rs1486173394 5720 dbSNP
rs1240984593 5725 dbSNP
rs1213889363 5726 dbSNP
rs1002339285 5728 dbSNP
rs978637923 5736 dbSNP
rs1032481828 5761 dbSNP
rs1280684258 5767 dbSNP
rs1209713588 5772 dbSNP
rs1298216973 5792 dbSNP
rs1310749377 5792 dbSNP
rs894055236 5795 dbSNP
rs1278664447 5799 dbSNP
rs1009812127 5800 dbSNP
rs1416760367 5801 dbSNP
rs144294912 5812 dbSNP
rs1020891858 5830 dbSNP
rs1733862 5840 dbSNP
rs1277189447 5844 dbSNP
rs745980108 5849 dbSNP
rs1172323539 5850 dbSNP
rs1429030772 5854 dbSNP
rs1190876413 5862 dbSNP
rs911511909 5879 dbSNP
rs1257620004 5880 dbSNP
rs941331052 5884 dbSNP
rs974123803 5887 dbSNP
rs1253412654 5891 dbSNP
rs569508611 5892 dbSNP
rs918642081 5905 dbSNP
rs930087648 5907 dbSNP
rs536948993 5923 dbSNP
rs1292639211 5931 dbSNP
rs558529213 5932 dbSNP
rs1356120413 5936 dbSNP
rs570441972 5941 dbSNP
rs1292785849 5945 dbSNP
rs746120730 5952 dbSNP
rs889450247 5959 dbSNP
rs906378109 5960 dbSNP
rs146079488 5968 dbSNP
rs1017664812 5979 dbSNP
rs556245479 5981 dbSNP
rs1479024191 5987 dbSNP
rs895094242 5988 dbSNP
rs1186651850 5993 dbSNP
rs1191691321 5995 dbSNP
rs1423194937 5998 dbSNP
rs1421665666 6013 dbSNP
rs1473157754 6021 dbSNP
rs769924539 6035 dbSNP
rs574482037 6038 dbSNP
rs1388444334 6041 dbSNP
rs1021975005 6045 dbSNP
rs1404651116 6054 dbSNP
rs902227405 6054 dbSNP
rs1298769863 6058 dbSNP
rs920467116 6058 dbSNP
rs749521967 6075 dbSNP
rs999285348 6080 dbSNP
rs1272606360 6083 dbSNP
rs929190998 6092 dbSNP
rs763536983 6094 dbSNP
rs1397932396 6121 dbSNP
rs1307894577 6124 dbSNP
rs917167072 6127 dbSNP
rs1391053643 6136 dbSNP
rs535541666 6145 dbSNP
rs764705289 6148 dbSNP
rs1044459572 6151 dbSNP
rs1395191382 6160 dbSNP
rs905579007 6168 dbSNP
rs1163563993 6171 dbSNP
rs1455988731 6171 dbSNP
rs1018521590 6186 dbSNP
rs935784811 6194 dbSNP
rs866569953 6196 dbSNP
rs1006515301 6201 dbSNP
rs1418167502 6210 dbSNP
rs1053877995 6214 dbSNP
rs1281971388 6220 dbSNP
rs974449950 6231 dbSNP
rs1228210255 6237 dbSNP
rs1252999535 6239 dbSNP
rs1208584242 6241 dbSNP
rs1287371627 6247 dbSNP
rs1486857778 6248 dbSNP
rs918601118 6249 dbSNP
rs1238548925 6251 dbSNP
rs184440901 6255 dbSNP
rs576670200 6260 dbSNP
rs774560390 6261 dbSNP
rs1236292823 6263 dbSNP
rs1371630675 6265 dbSNP
rs1322732098 6266 dbSNP
rs1385018243 6283 dbSNP
rs1214977686 6284 dbSNP
rs1021132159 6298 dbSNP
rs1288987652 6301 dbSNP
rs1418696778 6305 dbSNP
rs1378166674 6306 dbSNP
rs1175915150 6318 dbSNP
rs890721325 6319 dbSNP
rs1394870382 6323 dbSNP
rs544145397 6332 dbSNP
rs1189911192 6335 dbSNP
rs1430842389 6341 dbSNP
rs1204677782 6342 dbSNP
rs1262477776 6342 dbSNP
rs1008860253 6343 dbSNP
rs1282817088 6344 dbSNP
rs1018029577 6351 dbSNP
rs1054906805 6374 dbSNP
rs1366758412 6384 dbSNP
rs964816341 6396 dbSNP
rs1295662638 6407 dbSNP
rs946663755 6408 dbSNP
rs371641506 6409 dbSNP
rs973508166 6420 dbSNP
rs1314269774 6425 dbSNP
rs762192872 6430 dbSNP
rs1382160223 6441 dbSNP
rs767806797 6463 dbSNP
rs750025896 6465 dbSNP
rs1417630656 6471 dbSNP
rs1171231032 6488 dbSNP
rs983302333 6491 dbSNP
rs1430336397 6509 dbSNP
rs1463957793 6515 dbSNP
rs1192555563 6516 dbSNP
rs1374207305 6516 dbSNP
rs1297399147 6522 dbSNP
rs1259712561 6524 dbSNP
rs1476841586 6524 dbSNP
rs1188859341 6526 dbSNP
rs917136580 6531 dbSNP
rs565412923 6547 dbSNP
rs577446037 6557 dbSNP
rs979786337 6560 dbSNP
rs1341387770 6564 dbSNP
rs926992128 6565 dbSNP
rs890905048 6566 dbSNP
rs1007037967 6575 dbSNP
rs935732716 6589 dbSNP
rs1446899270 6592 dbSNP
rs1339554645 6594 dbSNP
rs1018465885 6608 dbSNP
rs962919639 6612 dbSNP
rs1356547009 6619 dbSNP
rs1170512927 6625 dbSNP
rs1464537090 6633 dbSNP
rs1054159669 6636 dbSNP
rs1420060835 6661 dbSNP
rs995773339 6664 dbSNP
rs912994682 6665 dbSNP
rs1026355972 6678 dbSNP
rs945521895 6683 dbSNP
rs1184260446 6684 dbSNP
rs1439280361 6690 dbSNP
rs541103559 6710 dbSNP
rs1197892495 6717 dbSNP
rs1316034378 6719 dbSNP
rs981877757 6727 dbSNP
rs890678184 6730 dbSNP
rs1009596788 6731 dbSNP
rs1260551897 6734 dbSNP
rs1039018141 6737 dbSNP
rs1233427306 6738 dbSNP
rs1355203684 6747 dbSNP
rs1281997325 6752 dbSNP
rs188829036 6756 dbSNP
rs371048868 6760 dbSNP
rs3079487 6761 dbSNP
rs397773659 6761 dbSNP
rs72581252 6765 dbSNP
rs1202331451 6769 dbSNP
rs1331132487 6781 dbSNP
rs958796883 6785 dbSNP
rs368310933 6786 dbSNP
rs1326661470 6792 dbSNP
rs1404774774 6794 dbSNP
rs1411741021 6802 dbSNP
rs1160463808 6804 dbSNP
rs1441906624 6805 dbSNP
rs530177301 6806 dbSNP
rs1380650466 6807 dbSNP
rs1177833473 6808 dbSNP
rs1239902807 6814 dbSNP
rs548227534 6815 dbSNP
rs1437803688 6818 dbSNP
rs916418173 6818 dbSNP
rs1222223136 6821 dbSNP
rs1450479948 6831 dbSNP
rs1157997537 6836 dbSNP
rs563150034 6837 dbSNP
rs1225069457 6848 dbSNP
rs1308956972 6858 dbSNP
rs1350992537 6858 dbSNP
rs1377949066 6860 dbSNP
rs1467393864 6868 dbSNP
rs1373656540 6872 dbSNP
rs1304739644 6873 dbSNP
rs1043642945 6876 dbSNP
rs1436422570 6876 dbSNP
rs946581168 6876 dbSNP
rs755777383 6879 dbSNP
rs1027717424 6886 dbSNP
rs1401124219 6889 dbSNP
rs1157821873 6900 dbSNP
rs1465683626 6903 dbSNP
rs765862719 6905 dbSNP
rs950783095 6908 dbSNP
rs140072338 6909 dbSNP
rs1244439585 6913 dbSNP
rs1217370842 6923 dbSNP
rs1488412361 6923 dbSNP
rs552465173 6925 dbSNP
rs1214024994 6930 dbSNP
rs753414909 6932 dbSNP
rs971338271 6935 dbSNP
rs1379727560 6939 dbSNP
rs980448702 6942 dbSNP
rs1306925905 6953 dbSNP
rs1331985114 6957 dbSNP
rs1366177324 6959 dbSNP
rs1271990245 6969 dbSNP
rs926965230 6976 dbSNP
rs1254482219 6982 dbSNP
rs1323148267 6984 dbSNP
rs774477895 6994 dbSNP
rs1296516578 6995 dbSNP
rs1436840261 7000 dbSNP
rs541514989 7002 dbSNP
rs1176569839 7004 dbSNP
rs778956402 7007 dbSNP
rs1188212402 7010 dbSNP
rs989790441 7019 dbSNP
rs534901639 7028 dbSNP
rs912944081 7029 dbSNP
rs143425090 7031 dbSNP
rs748056728 7039 dbSNP
rs1256935285 7046 dbSNP
rs1209931608 7056 dbSNP
rs1267985550 7057 dbSNP
rs546156580 7058 dbSNP
rs912085405 7065 dbSNP
rs10260552 7069 dbSNP
rs1039665563 7070 dbSNP
rs1196560521 7073 dbSNP
rs1317321555 7076 dbSNP
rs1276415907 7081 dbSNP
rs1416817955 7082 dbSNP
rs900774231 7083 dbSNP
rs1303196048 7085 dbSNP
rs1446934926 7096 dbSNP
rs1357231072 7112 dbSNP
rs1465857679 7116 dbSNP
rs1466109667 7143 dbSNP
rs1172396449 7149 dbSNP
rs1422246762 7157 dbSNP
rs1167979922 7162 dbSNP
rs951740241 7170 dbSNP
rs994800543 7171 dbSNP
rs1002804684 7175 dbSNP
rs1035662217 7180 dbSNP
rs1397420619 7183 dbSNP
rs1464664899 7187 dbSNP
rs1049101066 7189 dbSNP
rs141903662 7193 dbSNP
rs79762267 7193 dbSNP
rs886518081 7195 dbSNP
rs1256208563 7197 dbSNP
rs1388858040 7197 dbSNP
rs181922493 7198 dbSNP
rs1235275566 7202 dbSNP
rs1005010915 7207 dbSNP
rs145536760 7207 dbSNP
rs1024126096 7211 dbSNP
rs971664244 7217 dbSNP
rs1001388097 7224 dbSNP
rs914693700 7225 dbSNP
rs1299711633 7226 dbSNP
rs1345300768 7232 dbSNP
rs1034655354 7236 dbSNP
rs1399534544 7244 dbSNP
rs1328684757 7245 dbSNP
rs957286088 7246 dbSNP
rs989740048 7250 dbSNP
rs912934125 7263 dbSNP
rs1421719689 7264 dbSNP
rs146718170 7269 dbSNP
rs1179709530 7285 dbSNP
rs1457700097 7286 dbSNP
rs773789675 7294 dbSNP
rs1216114388 7295 dbSNP
rs935256697 7308 dbSNP
rs1043893 7311 dbSNP
rs73722825 7312 dbSNP
rs1319009708 7314 dbSNP
rs974941233 7315 dbSNP
rs1478030118 7316 dbSNP