miRTarBase - #MIRT623169 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NAA50   
Synonyms MAK3, NAT13, NAT13P, NAT5, NAT5P, SAN
Description N(alpha)-acetyltransferase 50, NatE catalytic subunit
Transcript NM_025146   
Putative miRNA Targets on NAA50
3'UTR of NAA50
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            :|||::||   || ||:|:||| 
3701 - 3725 136.00 -16.30
miRNA  3' guuugugGUAACAG-UGUGAGGu 5'
                 ||||| |  |||||| 
Target 5' ccctagaCATTGCCTTCACTCCa 3'
461 - 483 127.00 -15.80
             | :|:: | ||| ||||| 
4614 - 4635 127.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30507780 10 COSMIC
COSN30511001 14 COSMIC
COSN31566095 20 COSMIC
COSN31514475 36 COSMIC
COSN30144832 43 COSMIC
COSN30180607 48 COSMIC
COSN15368556 50 COSMIC
COSN30495067 55 COSMIC
COSN31512304 69 COSMIC
COSN30510797 76 COSMIC
COSN31533454 81 COSMIC
COSN31524987 120 COSMIC
COSN31581576 140 COSMIC
COSN31482956 144 COSMIC
COSN31558706 199 COSMIC
COSN26167297 481 COSMIC
COSN31557387 717 COSMIC
COSN15048023 724 COSMIC
COSN31550757 1264 COSMIC
COSN7553151 1292 COSMIC
COSN31480640 1339 COSMIC
COSN31593713 1465 COSMIC
COSN31582608 1714 COSMIC
COSN31814441 1800 COSMIC
COSN32103532 1803 COSMIC
COSN24299925 1917 COSMIC
COSN23408735 2057 COSMIC
COSN31572440 2228 COSMIC
COSN1907476 2376 COSMIC
COSN31590785 2408 COSMIC
COSN25767648 2503 COSMIC
COSN30169461 2602 COSMIC
COSN31564620 2662 COSMIC
COSN31541095 2730 COSMIC
COSN28741431 2815 COSMIC
COSN8487925 2815 COSMIC
COSN9734228 3497 COSMIC
COSN29491687 4044 COSMIC
COSN6745056 4697 COSMIC
COSN1907475 4741 COSMIC
COSN27756807 4879 COSMIC
COSN20820464 5226 COSMIC
COSN24775264 5258 COSMIC
COSN14704015 5290 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs769831240 2 dbSNP
rs906106275 3 dbSNP
rs759226514 4 dbSNP
rs1168312195 8 dbSNP
rs776526983 10 dbSNP
rs770446057 11 dbSNP
rs370663148 12 dbSNP
rs538959642 16 dbSNP
rs1485955716 17 dbSNP
rs772650092 21 dbSNP
rs771574003 25 dbSNP
rs1344612847 26 dbSNP
rs999780676 34 dbSNP
rs376595261 36 dbSNP
rs373190948 37 dbSNP
rs371430548 41 dbSNP
rs765852854 50 dbSNP
rs746445244 52 dbSNP
rs1357366013 53 dbSNP
rs1405011841 53 dbSNP
rs1399263984 54 dbSNP
rs1297980971 56 dbSNP
rs895575629 57 dbSNP
rs146114785 71 dbSNP
rs142991144 73 dbSNP
rs567244446 78 dbSNP
rs1214091872 82 dbSNP
rs865775449 84 dbSNP
rs15781 86 dbSNP
rs1488524391 94 dbSNP
rs1219038996 95 dbSNP
rs911102809 99 dbSNP
rs1451060957 100 dbSNP
rs1199693263 101 dbSNP
rs1379813200 106 dbSNP
rs530383482 107 dbSNP
rs985363485 114 dbSNP
rs1363558844 115 dbSNP
rs1381284237 116 dbSNP
rs952518965 129 dbSNP
rs137931216 145 dbSNP
rs1026761932 148 dbSNP
rs1385675468 159 dbSNP
rs113097575 170 dbSNP
rs562947608 171 dbSNP
rs550834840 172 dbSNP
rs1237843331 178 dbSNP
rs1363131271 179 dbSNP
rs1164986643 183 dbSNP
rs539248152 184 dbSNP
rs1210735634 191 dbSNP
rs1425167395 192 dbSNP
rs776675149 194 dbSNP
rs961480294 196 dbSNP
rs57150217 199 dbSNP
rs565606198 214 dbSNP
rs1239347882 232 dbSNP
rs1441876410 236 dbSNP
rs1002840195 241 dbSNP
rs866723525 244 dbSNP
rs1262248064 245 dbSNP
rs1457090355 247 dbSNP
rs905860445 249 dbSNP
rs1163532651 250 dbSNP
rs1198932659 253 dbSNP
rs774901005 253 dbSNP
rs1023197319 254 dbSNP
rs540467953 256 dbSNP
rs1489936139 257 dbSNP
rs1377578532 260 dbSNP
rs1271084506 263 dbSNP
rs186670193 264 dbSNP
rs1223366590 273 dbSNP
rs1320957202 274 dbSNP
rs749981064 279 dbSNP
rs561326272 291 dbSNP
rs1011846362 292 dbSNP
rs1198114994 295 dbSNP
rs1259201004 298 dbSNP
rs543147508 300 dbSNP
rs112433489 301 dbSNP
rs1053280805 317 dbSNP
rs1424801347 324 dbSNP
rs1308438584 329 dbSNP
rs866551964 331 dbSNP
rs1463558032 337 dbSNP
rs1169350285 340 dbSNP
rs934851089 341 dbSNP
rs1222499891 348 dbSNP
rs1343278602 350 dbSNP
rs1301064127 354 dbSNP
rs902228560 361 dbSNP
rs1304389600 362 dbSNP
rs1041196187 366 dbSNP
rs1405033407 371 dbSNP
rs1338730113 372 dbSNP
rs1395216841 378 dbSNP
rs1218019071 383 dbSNP
rs1296379894 385 dbSNP
rs1320165808 387 dbSNP
rs1208604129 390 dbSNP
rs1255956177 397 dbSNP
rs770979562 410 dbSNP
rs767030024 415 dbSNP
rs1259102861 421 dbSNP
rs1476635595 427 dbSNP
rs1192564237 428 dbSNP
rs149271381 432 dbSNP
rs931212731 435 dbSNP
rs1173815217 444 dbSNP
rs1358524088 449 dbSNP
rs575683935 452 dbSNP
rs1314495299 453 dbSNP
rs972530944 465 dbSNP
rs1399614657 467 dbSNP
rs1279127958 469 dbSNP
rs1175473343 472 dbSNP
rs1479558612 477 dbSNP
rs961509780 486 dbSNP
rs1035736943 498 dbSNP
rs1431728600 504 dbSNP
rs1313304780 505 dbSNP
rs981949715 509 dbSNP
rs1437297520 510 dbSNP
rs1248590174 511 dbSNP
rs552839712 521 dbSNP
rs761502451 524 dbSNP
rs1215399075 529 dbSNP
rs1481273978 538 dbSNP
rs1486531388 553 dbSNP
rs1255719522 554 dbSNP
rs1343634544 559 dbSNP
rs1022956710 562 dbSNP
rs1424295692 564 dbSNP
rs113308735 568 dbSNP
rs1011625595 570 dbSNP
rs1202205010 574 dbSNP
rs1175502564 579 dbSNP
rs1378223260 581 dbSNP
rs893386286 585 dbSNP
rs1320891124 587 dbSNP
rs1347195024 611 dbSNP
rs1031937328 619 dbSNP
rs998994584 624 dbSNP
rs1334632621 626 dbSNP
rs774030448 627 dbSNP
rs761181508 629 dbSNP
rs1304297479 630 dbSNP
rs112550966 631 dbSNP
rs1241352214 638 dbSNP
rs1284444101 654 dbSNP
rs1318359238 655 dbSNP
rs1219015701 661 dbSNP
rs539512001 662 dbSNP
rs1335766547 671 dbSNP
rs1040771172 672 dbSNP
rs1408095827 675 dbSNP
rs768431357 681 dbSNP
rs878876333 682 dbSNP
rs6438166 688 dbSNP
rs1236312042 691 dbSNP
rs765262649 691 dbSNP
rs943772095 693 dbSNP
rs1159030972 694 dbSNP
rs539072008 707 dbSNP
rs773609331 712 dbSNP
rs1049381262 720 dbSNP
rs775348921 722 dbSNP
rs931013682 723 dbSNP
rs919808013 726 dbSNP
rs1376824831 743 dbSNP
rs1447891179 744 dbSNP
rs1420160782 745 dbSNP
rs577839865 758 dbSNP
rs1226234941 759 dbSNP
rs1288750662 766 dbSNP
rs939844520 770 dbSNP
rs747018380 773 dbSNP
rs138358313 778 dbSNP
rs1462933267 779 dbSNP
rs981324085 780 dbSNP
rs1200655536 784 dbSNP
rs970546945 785 dbSNP
rs772085515 792 dbSNP
rs1471712802 800 dbSNP
rs534507815 801 dbSNP
rs150091303 803 dbSNP
rs570234850 808 dbSNP
rs1414823399 823 dbSNP
rs957362044 825 dbSNP
rs1399733540 826 dbSNP
rs58048794 830 dbSNP
rs1336222404 831 dbSNP
rs1331518455 842 dbSNP
rs1314272950 845 dbSNP
rs536771522 853 dbSNP
rs1031906085 856 dbSNP
rs569274569 870 dbSNP
rs1283182693 871 dbSNP
rs1355703213 877 dbSNP
rs1234825708 879 dbSNP
rs550945234 881 dbSNP
rs1275748121 884 dbSNP
rs1316817518 897 dbSNP
rs1450439358 901 dbSNP
rs1384682517 902 dbSNP
rs1337200549 912 dbSNP
rs1196276396 918 dbSNP
rs999526974 920 dbSNP
rs529097709 925 dbSNP
rs1209177233 929 dbSNP
rs1383112276 943 dbSNP
rs1160305563 949 dbSNP
rs1258404818 958 dbSNP
rs1476305013 962 dbSNP
rs748378032 967 dbSNP
rs1454385141 968 dbSNP
rs1191848028 970 dbSNP
rs1019512742 972 dbSNP
rs1007765504 975 dbSNP
rs1182252479 983 dbSNP
rs1170106216 986 dbSNP
rs889524959 988 dbSNP
rs1244077867 994 dbSNP
rs779336855 996 dbSNP
rs1335270667 1002 dbSNP
rs1192961634 1004 dbSNP
rs1049475415 1020 dbSNP
rs532970044 1024 dbSNP
rs755337157 1027 dbSNP
rs565430768 1034 dbSNP
rs1271799236 1035 dbSNP
rs193001068 1039 dbSNP
rs1218639789 1040 dbSNP
rs770154042 1045 dbSNP
rs114440342 1050 dbSNP
rs1214684846 1058 dbSNP
rs377686358 1060 dbSNP
rs948590849 1066 dbSNP
rs756670246 1075 dbSNP
rs748555776 1090 dbSNP
rs1447598247 1091 dbSNP
rs915959750 1092 dbSNP
rs561489644 1096 dbSNP
rs1376060412 1106 dbSNP
rs779462473 1114 dbSNP
rs1174875998 1119 dbSNP
rs1284529294 1122 dbSNP
rs1418290945 1123 dbSNP
rs1156409285 1125 dbSNP
rs957330696 1131 dbSNP
rs140867057 1141 dbSNP
rs1328906588 1152 dbSNP
rs1435644742 1153 dbSNP
rs1304121343 1160 dbSNP
rs1324850120 1171 dbSNP
rs1349732319 1178 dbSNP
rs1320518170 1182 dbSNP
rs1285497528 1192 dbSNP
rs1351669259 1196 dbSNP
rs924594737 1201 dbSNP
rs1383030234 1204 dbSNP
rs1265333045 1209 dbSNP
rs1365013731 1220 dbSNP
rs977472896 1225 dbSNP
rs1194766447 1236 dbSNP
rs966693501 1237 dbSNP
rs369346867 1243 dbSNP
rs376776576 1244 dbSNP
rs576825241 1245 dbSNP
rs1427067527 1250 dbSNP
rs1008105438 1258 dbSNP
rs1159986286 1267 dbSNP
rs1387910937 1274 dbSNP
rs953548855 1277 dbSNP
rs563803406 1280 dbSNP
rs1373103741 1281 dbSNP
rs1444560579 1282 dbSNP
rs545069120 1283 dbSNP
rs1028004267 1284 dbSNP
rs1336180557 1291 dbSNP
rs1241419779 1292 dbSNP
rs1355676428 1293 dbSNP
rs995228977 1293 dbSNP
rs898276909 1295 dbSNP
rs147649168 1296 dbSNP
rs1801388 1297 dbSNP
rs1474625556 1315 dbSNP
rs1244256393 1316 dbSNP
rs1456818199 1325 dbSNP
rs761377130 1330 dbSNP
rs1037084574 1345 dbSNP
rs1251656923 1346 dbSNP
rs1421289744 1352 dbSNP
rs1183483833 1359 dbSNP
rs62265553 1364 dbSNP
rs1366375487 1375 dbSNP
rs1488439470 1380 dbSNP
rs1003918794 1386 dbSNP
rs1267491430 1391 dbSNP
rs117298828 1392 dbSNP
rs1490800463 1400 dbSNP
rs1297581074 1401 dbSNP
rs1290524444 1403 dbSNP
rs907083745 1408 dbSNP
rs751195763 1412 dbSNP
rs1340104365 1423 dbSNP
rs1234199926 1431 dbSNP
rs1295185877 1433 dbSNP
rs1316193676 1435 dbSNP
rs1198532212 1440 dbSNP
rs769548235 1449 dbSNP
rs541318687 1454 dbSNP
rs1199107299 1458 dbSNP
rs948513283 1458 dbSNP
rs1345152112 1459 dbSNP
rs1474669104 1461 dbSNP
rs573472415 1463 dbSNP
rs1419352716 1467 dbSNP
rs1054319575 1472 dbSNP
rs1169599233 1473 dbSNP
rs1463273392 1474 dbSNP
rs146980042 1484 dbSNP
rs924759003 1485 dbSNP
rs1415600744 1486 dbSNP
rs775293881 1490 dbSNP
rs977817462 1497 dbSNP
rs1214082792 1500 dbSNP
rs1296847844 1509 dbSNP
rs141379034 1514 dbSNP
rs569388931 1519 dbSNP
rs147693467 1520 dbSNP
rs188283678 1527 dbSNP
rs1328769910 1533 dbSNP
rs539024657 1542 dbSNP
rs1259213211 1552 dbSNP
rs1422064293 1553 dbSNP
rs1486990522 1553 dbSNP
rs1168874836 1559 dbSNP
rs1185440501 1566 dbSNP
rs1477919148 1568 dbSNP
rs565672998 1584 dbSNP
rs1173921195 1585 dbSNP
rs953517502 1598 dbSNP
rs540544926 1602 dbSNP
rs1175707229 1619 dbSNP
rs115532727 1622 dbSNP
rs1430025200 1623 dbSNP
rs1289511776 1629 dbSNP
rs1246851410 1645 dbSNP
rs1203708362 1664 dbSNP
rs973563835 1671 dbSNP
rs183793414 1681 dbSNP
rs567996117 1687 dbSNP
rs962431296 1693 dbSNP
rs549578477 1700 dbSNP
rs1236977885 1710 dbSNP
rs531178936 1716 dbSNP
rs1004248100 1718 dbSNP
rs1199044518 1722 dbSNP
rs1242164845 1723 dbSNP
rs1323029443 1726 dbSNP
rs906888027 1727 dbSNP
rs563760372 1739 dbSNP
rs376110337 1740 dbSNP
rs1012827745 1742 dbSNP
rs1378326050 1743 dbSNP
rs1400318594 1745 dbSNP
rs1368352624 1751 dbSNP
rs557612604 1754 dbSNP
rs1456478170 1756 dbSNP
rs772179949 1762 dbSNP
rs1372370122 1764 dbSNP
rs149220995 1764 dbSNP
rs935853649 1764 dbSNP
rs1356821745 1765 dbSNP
rs748253046 1770 dbSNP
rs545491495 1771 dbSNP
rs1211292551 1784 dbSNP
rs1404436165 1784 dbSNP
rs1272398112 1790 dbSNP
rs1468855951 1791 dbSNP
rs1173808255 1794 dbSNP
rs533125399 1795 dbSNP
rs1236103455 1799 dbSNP
rs7648784 1800 dbSNP
rs1177951599 1805 dbSNP
rs1410458173 1815 dbSNP
rs540933721 1821 dbSNP
rs1164303398 1843 dbSNP
rs1395392334 1846 dbSNP
rs1463451865 1865 dbSNP
rs1329955280 1868 dbSNP
rs1443411808 1871 dbSNP
rs911908578 1872 dbSNP
rs1176158973 1875 dbSNP
rs1468480166 1880 dbSNP
rs1231145781 1887 dbSNP
rs986122326 1889 dbSNP
rs1334963918 1891 dbSNP
rs769034297 1893 dbSNP
rs920882433 1894 dbSNP
rs1234546799 1899 dbSNP
rs1436959109 1905 dbSNP
rs1204966112 1908 dbSNP
rs867311595 1908 dbSNP
rs1234464855 1910 dbSNP
rs973510148 1911 dbSNP
rs1187568273 1912 dbSNP
rs573583601 1916 dbSNP
rs1179246495 1917 dbSNP
rs555269690 1927 dbSNP
rs1460704775 1938 dbSNP
rs1261071548 1941 dbSNP
rs1476244133 1942 dbSNP
rs1169098145 1944 dbSNP
rs962241617 1948 dbSNP
rs1205778454 1951 dbSNP
rs1331283498 1963 dbSNP
rs1357844035 1970 dbSNP
rs1412513794 1974 dbSNP
rs1311926058 1975 dbSNP
rs1355489568 1978 dbSNP
rs1234610866 1981 dbSNP
rs1268281498 1984 dbSNP
rs1471651900 1985 dbSNP
rs1313016588 1993 dbSNP
rs1274836848 2000 dbSNP
rs1283596929 2005 dbSNP
rs1222143880 2008 dbSNP
rs142846139 2009 dbSNP
rs1210384410 2010 dbSNP
rs1310610713 2028 dbSNP
rs982567370 2030 dbSNP
rs1191118612 2033 dbSNP
rs1241665599 2036 dbSNP
rs971584051 2037 dbSNP
rs1023957123 2046 dbSNP
rs1423454108 2047 dbSNP
rs1434512989 2048 dbSNP
rs1012627704 2051 dbSNP
rs894390087 2061 dbSNP
rs1467226153 2062 dbSNP
rs1359387763 2064 dbSNP
rs1157667699 2066 dbSNP
rs1032936817 2071 dbSNP
rs999991414 2081 dbSNP
rs1271886390 2093 dbSNP
rs1345406340 2095 dbSNP
rs903034292 2097 dbSNP
rs1409612850 2098 dbSNP
rs1350317514 2105 dbSNP
rs546154646 2105 dbSNP
rs1042165401 2107 dbSNP
rs944794521 2110 dbSNP
rs890557137 2113 dbSNP
rs1050380849 2122 dbSNP
rs1185227824 2125 dbSNP
rs931993797 2126 dbSNP
rs920808892 2143 dbSNP
rs973645745 2156 dbSNP
rs575841973 2168 dbSNP
rs940827989 2171 dbSNP
rs1213988173 2172 dbSNP
rs1156491145 2196 dbSNP
rs1318807315 2198 dbSNP
rs1286880096 2210 dbSNP
rs908024498 2213 dbSNP
rs1440161459 2214 dbSNP
rs982712263 2216 dbSNP
rs1372975319 2220 dbSNP
rs971168140 2228 dbSNP
rs1279212465 2240 dbSNP
rs917037106 2242 dbSNP
rs1245821404 2243 dbSNP
rs1206980201 2250 dbSNP
rs1271424901 2255 dbSNP
rs746913121 2261 dbSNP
rs991118730 2261 dbSNP
rs1357968313 2262 dbSNP
rs1255246793 2275 dbSNP
rs373977890 2280 dbSNP
rs1317529973 2287 dbSNP
rs1417732149 2293 dbSNP
rs1396989484 2298 dbSNP
rs958362669 2300 dbSNP
rs1362879965 2311 dbSNP
rs557523333 2319 dbSNP
rs190689462 2322 dbSNP
rs1391725698 2323 dbSNP
rs1460839180 2327 dbSNP
rs565507101 2329 dbSNP
rs138415445 2330 dbSNP
rs374360288 2330 dbSNP
rs1389474650 2333 dbSNP
rs1328359215 2334 dbSNP
rs1020096451 2335 dbSNP
rs1423879749 2336 dbSNP
rs563235930 2338 dbSNP
rs553716747 2342 dbSNP
rs780447621 2353 dbSNP
rs535474666 2362 dbSNP
rs1275627239 2370 dbSNP
rs1479831323 2380 dbSNP
rs1166575464 2381 dbSNP
rs1195595746 2388 dbSNP
rs1251779907 2389 dbSNP
rs1050474577 2390 dbSNP
rs146414976 2393 dbSNP
rs899186794 2393 dbSNP
rs1474612830 2397 dbSNP
rs1037697177 2403 dbSNP
rs1370124065 2404 dbSNP
rs866170252 2405 dbSNP
rs940935587 2407 dbSNP
rs1397004069 2416 dbSNP
rs1411862466 2417 dbSNP
rs1311323369 2421 dbSNP
rs1184969203 2440 dbSNP
rs908161086 2474 dbSNP
rs1046552008 2478 dbSNP
rs758380384 2482 dbSNP
rs916962961 2485 dbSNP
rs1227418573 2489 dbSNP
rs991255964 2497 dbSNP
rs867538291 2500 dbSNP
rs1206806051 2504 dbSNP
rs1254987466 2508 dbSNP
rs1485020368 2508 dbSNP
rs1188039864 2513 dbSNP
rs958329986 2514 dbSNP
rs1426637845 2521 dbSNP
rs1221849429 2526 dbSNP
rs925595712 2528 dbSNP
rs1373388805 2531 dbSNP
rs1489986843 2532 dbSNP
rs1431418820 2535 dbSNP
rs978857164 2538 dbSNP
rs1375079811 2549 dbSNP
rs1435648515 2562 dbSNP
rs1304648529 2563 dbSNP
rs967316913 2569 dbSNP
rs1382126222 2570 dbSNP
rs7648021 2571 dbSNP
rs148536673 2584 dbSNP
rs1293944645 2585 dbSNP
rs1441827561 2620 dbSNP
rs1280150878 2623 dbSNP
rs1049157 2627 dbSNP
rs1346684031 2633 dbSNP
rs867002807 2636 dbSNP
rs758397635 2640 dbSNP
rs1212392231 2647 dbSNP
rs954565255 2648 dbSNP
rs1298199414 2652 dbSNP
rs1029007150 2669 dbSNP
rs531085146 2674 dbSNP
rs1451030997 2682 dbSNP
rs1191514736 2693 dbSNP
rs1394316867 2703 dbSNP
rs1363229955 2706 dbSNP
rs1435549529 2706 dbSNP
rs1343470323 2709 dbSNP
rs1295212277 2718 dbSNP
rs996205561 2726 dbSNP
rs1458382707 2727 dbSNP
rs1289905752 2737 dbSNP
rs1391464778 2747 dbSNP
rs899280230 2749 dbSNP
rs1303099752 2752 dbSNP
rs1353684910 2753 dbSNP
rs1168096914 2755 dbSNP
rs1219404388 2767 dbSNP
rs1037664569 2781 dbSNP
rs909738763 2788 dbSNP
rs1005326895 2797 dbSNP
rs570263988 2798 dbSNP
rs1047088521 2801 dbSNP
rs1424624858 2803 dbSNP
rs1466191430 2804 dbSNP
rs752462095 2806 dbSNP
rs1211796835 2818 dbSNP
rs1252115744 2821 dbSNP
rs765072304 2827 dbSNP
rs916763226 2830 dbSNP
rs1479496395 2833 dbSNP
rs551553510 2835 dbSNP
rs1055329668 2843 dbSNP
rs1269614184 2844 dbSNP
rs533482347 2852 dbSNP
rs977197545 2856 dbSNP
rs145692196 2865 dbSNP
rs756695255 2870 dbSNP
rs913126819 2873 dbSNP
rs755185182 2875 dbSNP
rs958322345 2897 dbSNP
rs1319491743 2901 dbSNP
rs114406338 2902 dbSNP
rs754067356 2903 dbSNP
rs149778127 2912 dbSNP
rs1330659137 2914 dbSNP
rs1231339542 2918 dbSNP
rs966988849 2925 dbSNP
rs963422514 2926 dbSNP
rs1451908717 2927 dbSNP
rs1302834165 2930 dbSNP
rs1326497507 2937 dbSNP
rs561609346 2942 dbSNP
rs1025210753 2943 dbSNP
rs1004847812 2947 dbSNP
rs1480417285 2947 dbSNP
rs1414223144 2957 dbSNP
rs187781127 2958 dbSNP
rs1014364622 2962 dbSNP
rs1474278156 2971 dbSNP
rs1164759780 2975 dbSNP
rs1372532709 2979 dbSNP
rs886456502 2980 dbSNP
rs1168764922 2981 dbSNP
rs895494720 2992 dbSNP
rs1378180 2995 dbSNP
rs1349942 2997 dbSNP
rs1440990672 2998 dbSNP
rs1308294021 3000 dbSNP
rs1025195265 3012 dbSNP
rs183379851 3013 dbSNP
rs1034408907 3015 dbSNP
rs1466979059 3028 dbSNP
rs564322387 3033 dbSNP
rs1356947589 3036 dbSNP
rs1400846941 3040 dbSNP
rs1270583950 3043 dbSNP
rs1233577944 3044 dbSNP
rs1306737399 3045 dbSNP
rs1001296507 3050 dbSNP
rs866926913 3053 dbSNP
rs557035839 3055 dbSNP
rs1175933642 3058 dbSNP
rs1254256999 3060 dbSNP
rs895423680 3062 dbSNP
rs1187300352 3067 dbSNP
rs1474049454 3070 dbSNP
rs1468476822 3073 dbSNP
rs1379391331 3074 dbSNP
rs1055295021 3079 dbSNP
rs888164857 3086 dbSNP
rs1418941741 3092 dbSNP
rs1168776422 3101 dbSNP
rs1413835358 3105 dbSNP
rs1372027118 3109 dbSNP
rs1432552293 3111 dbSNP
rs1311721418 3117 dbSNP
rs1048251642 3121 dbSNP
rs1450078375 3126 dbSNP
rs1268365330 3128 dbSNP
rs1181123876 3137 dbSNP
rs1228870682 3138 dbSNP
rs1458493060 3138 dbSNP
rs1276589056 3139 dbSNP
rs778598078 3141 dbSNP
rs929810235 3142 dbSNP
rs904237738 3147 dbSNP
rs1043219377 3149 dbSNP
rs545716605 3155 dbSNP
rs572087362 3156 dbSNP
rs1233356626 3158 dbSNP
rs1452152002 3163 dbSNP
rs140172897 3165 dbSNP
rs1402230189 3172 dbSNP
rs146165253 3173 dbSNP
rs35007726 3175 dbSNP
rs189684140 3180 dbSNP
rs1344524460 3182 dbSNP
rs974515717 3198 dbSNP
rs1299523776 3209 dbSNP
rs1368573087 3212 dbSNP
rs1377331441 3218 dbSNP
rs1335862202 3220 dbSNP
rs1275691293 3229 dbSNP
rs985829549 3239 dbSNP
rs1203475287 3257 dbSNP
rs1283734077 3258 dbSNP
rs963186509 3258 dbSNP
rs1016326448 3262 dbSNP
rs1211167210 3268 dbSNP
rs936773212 3271 dbSNP
rs1404630800 3278 dbSNP
rs1468335745 3287 dbSNP
rs766426483 3289 dbSNP
rs925355601 3295 dbSNP
rs1197649105 3296 dbSNP
rs760695256 3308 dbSNP
rs978277338 3312 dbSNP
rs966852977 3316 dbSNP
rs1173179314 3320 dbSNP
rs1156287030 3325 dbSNP
rs1410645600 3333 dbSNP
rs1457678783 3337 dbSNP
rs950858129 3346 dbSNP
rs1391955894 3348 dbSNP
rs1439913582 3349 dbSNP
rs1324373062 3352 dbSNP
rs1333044092 3355 dbSNP
rs371814280 3356 dbSNP
rs1279000889 3358 dbSNP
rs1362203921 3358 dbSNP
rs1160942303 3359 dbSNP
rs773732336 3363 dbSNP
rs1440903119 3367 dbSNP
rs1025534289 3370 dbSNP
rs895390839 3374 dbSNP
rs1033938459 3377 dbSNP
rs1440282784 3378 dbSNP
rs1452949955 3380 dbSNP
rs1179274742 3383 dbSNP
rs1250378379 3386 dbSNP
rs1472648269 3387 dbSNP
rs142952119 3389 dbSNP
rs1200741996 3392 dbSNP
rs959852974 3397 dbSNP
rs1283318434 3399 dbSNP
rs1163611139 3404 dbSNP
rs1242165143 3419 dbSNP
rs1354359988 3424 dbSNP
rs1328458118 3425 dbSNP
rs1351119086 3426 dbSNP
rs574632442 3427 dbSNP
rs1034030378 3431 dbSNP
rs1042590708 3433 dbSNP
rs1334746611 3444 dbSNP
rs1001602256 3452 dbSNP
rs1267569597 3453 dbSNP
rs1243523692 3457 dbSNP
rs765079309 3462 dbSNP
rs757022645 3464 dbSNP
rs945770505 3475 dbSNP
rs1335102165 3476 dbSNP
rs1381907190 3477 dbSNP
rs1026673453 3487 dbSNP
rs891584720 3489 dbSNP
rs139653752 3502 dbSNP
rs1188200454 3505 dbSNP
rs1369929067 3506 dbSNP
rs570114737 3515 dbSNP
rs921814029 3516 dbSNP
rs1431919934 3518 dbSNP
rs1311119045 3524 dbSNP
rs1038947778 3526 dbSNP
rs941839382 3527 dbSNP
rs551934635 3533 dbSNP
rs539671750 3536 dbSNP
rs566162206 3537 dbSNP
rs1227162404 3539 dbSNP
rs1298889576 3548 dbSNP
rs1342417439 3548 dbSNP
rs374367812 3551 dbSNP
rs74554993 3553 dbSNP
rs1041237389 3559 dbSNP
rs1473975331 3560 dbSNP
rs1200904994 3561 dbSNP
rs1258187804 3561 dbSNP
rs918039980 3563 dbSNP
rs1187679756 3573 dbSNP
rs1369446152 3575 dbSNP
rs766424048 3576 dbSNP
rs1446085113 3582 dbSNP
rs992123835 3583 dbSNP
rs1218164641 3585 dbSNP
rs1383433685 3586 dbSNP
rs1488545437 3602 dbSNP
rs1435085530 3617 dbSNP
rs1298771530 3622 dbSNP
rs1367847986 3625 dbSNP
rs1290933769 3627 dbSNP
rs372797649 3628 dbSNP
rs186242500 3629 dbSNP
rs889693284 3636 dbSNP
rs1298757542 3640 dbSNP
rs1358165878 3648 dbSNP
rs1284620041 3651 dbSNP
rs1049790280 3656 dbSNP
rs1033905916 3661 dbSNP
rs1248364533 3661 dbSNP
rs1191923365 3667 dbSNP
rs1001105675 3668 dbSNP
rs968355657 3673 dbSNP
rs181271561 3676 dbSNP
rs1009772601 3680 dbSNP
rs925384998 3683 dbSNP
rs1362186082 3686 dbSNP
rs1457148807 3688 dbSNP
rs978183874 3690 dbSNP
rs117068007 3691 dbSNP
rs1439161697 3694 dbSNP
rs918096901 3695 dbSNP
rs1400676748 3696 dbSNP
rs531487982 3705 dbSNP
rs992703456 3708 dbSNP
rs1302719959 3712 dbSNP
rs1326494490 3713 dbSNP
rs997115655 3715 dbSNP
rs1268711419 3716 dbSNP
rs1365108388 3718 dbSNP
rs1211588400 3724 dbSNP
rs1301802321 3725 dbSNP
rs1407620466 3726 dbSNP
rs1193187073 3729 dbSNP
rs550498651 3732 dbSNP
rs1248460220 3733 dbSNP
rs1160468037 3737 dbSNP
rs1472312207 3737 dbSNP
rs900189742 3742 dbSNP
rs1391844062 3746 dbSNP
rs1167726673 3758 dbSNP
rs12695294 3760 dbSNP
rs1350869322 3763 dbSNP
rs1421035429 3768 dbSNP
rs34971812 3771 dbSNP
rs1294945552 3781 dbSNP
rs1195477664 3782 dbSNP
rs1034346766 3783 dbSNP
rs1267609890 3784 dbSNP
rs1408697657 3785 dbSNP
rs1288510015 3787 dbSNP
rs979762688 3788 dbSNP
rs150879694 3789 dbSNP
rs868461212 3795 dbSNP
rs993897482 3797 dbSNP
rs1453279948 3800 dbSNP
rs929161145 3807 dbSNP
rs917953655 3810 dbSNP
rs1482889390 3811 dbSNP
rs1182971489 3819 dbSNP
rs961076534 3820 dbSNP
rs749492896 3821 dbSNP
rs926593679 3822 dbSNP
rs1407449698 3823 dbSNP
rs775638478 3824 dbSNP
rs1019477068 3826 dbSNP
rs1166392200 3832 dbSNP
rs572190981 3836 dbSNP
rs1260231101 3840 dbSNP
rs1219520876 3843 dbSNP
rs968699121 3845 dbSNP
rs535196944 3864 dbSNP
rs1050092141 3865 dbSNP
rs1439169751 3872 dbSNP
rs1295202611 3878 dbSNP
rs1341696669 3879 dbSNP
rs1206183624 3883 dbSNP
rs1276810336 3888 dbSNP
rs1010109864 3893 dbSNP
rs1238564317 3899 dbSNP
rs1332180492 3906 dbSNP
rs191540563 3908 dbSNP
rs1185133310 3909 dbSNP
rs1030009615 3911 dbSNP
rs1408563723 3918 dbSNP
rs1448471574 3926 dbSNP
rs903871721 3927 dbSNP
rs1168871342 3928 dbSNP
rs767717469 3931 dbSNP
rs1412276830 3938 dbSNP
rs571203814 3940 dbSNP
rs1402997420 3943 dbSNP
rs1333002397 3950 dbSNP
rs1042370902 3951 dbSNP
rs34462229 3956 dbSNP
rs541946193 3963 dbSNP
rs1172337395 3964 dbSNP
rs1364226239 3965 dbSNP
rs746229017 3970 dbSNP
rs1300108122 3971 dbSNP
rs917989397 3972 dbSNP
rs574456751 3973 dbSNP
rs1279498626 3984 dbSNP
rs1188984214 3986 dbSNP
rs900283180 3988 dbSNP
rs769211827 3990 dbSNP
rs867926903 3990 dbSNP
rs1017221788 3993 dbSNP
rs938160399 3993 dbSNP
rs552428827 3994 dbSNP
rs1465650176 3999 dbSNP
rs866072252 4013 dbSNP
rs887655127 4018 dbSNP
rs556208685 4031 dbSNP
rs781672267 4033 dbSNP
rs757792561 4034 dbSNP
rs554684369 4046 dbSNP
rs1425311176 4049 dbSNP
rs1199451954 4051 dbSNP
rs1156880305 4058 dbSNP
rs1387558973 4077 dbSNP
rs1435546727 4083 dbSNP
rs929106632 4085 dbSNP
rs1436095867 4098 dbSNP
rs1275484515 4100 dbSNP
rs1347259236 4102 dbSNP
rs896331409 4104 dbSNP
rs1330167802 4109 dbSNP
rs1210953958 4110 dbSNP
rs1265766612 4115 dbSNP
rs1449483923 4121 dbSNP
rs1197761347 4127 dbSNP
rs1276507104 4131 dbSNP
rs961191814 4134 dbSNP
rs1246728894 4137 dbSNP
rs1481137322 4138 dbSNP
rs532646465 4152 dbSNP
rs1056338094 4156 dbSNP
rs1411139452 4159 dbSNP
rs1457762131 4160 dbSNP
rs1019763836 4161 dbSNP
rs563604893 4162 dbSNP
rs1404950873 4172 dbSNP
rs1008088201 4182 dbSNP
rs954025159 4192 dbSNP
rs1324484129 4204 dbSNP
rs1345871651 4209 dbSNP
rs1028134924 4224 dbSNP
rs938076841 4227 dbSNP
rs1000785487 4231 dbSNP
rs1287872661 4234 dbSNP
rs746472103 4235 dbSNP
rs1042448227 4238 dbSNP
rs1230811469 4239 dbSNP
rs537873985 4243 dbSNP
rs552903305 4244 dbSNP
rs1445274440 4246 dbSNP
rs1290152722 4250 dbSNP
rs1490757180 4251 dbSNP
rs896595108 4263 dbSNP
rs979393525 4265 dbSNP
rs777241717 4267 dbSNP
rs1332493888 4271 dbSNP
rs1472860199 4272 dbSNP
rs1447014537 4276 dbSNP
rs946741032 4277 dbSNP
rs914117842 4283 dbSNP
rs988425409 4286 dbSNP
rs955841756 4289 dbSNP
rs1358223165 4290 dbSNP
rs1428114517 4296 dbSNP
rs1173271308 4299 dbSNP
rs1371274227 4301 dbSNP
rs1412162450 4308 dbSNP
rs1311224849 4313 dbSNP
rs1029765712 4317 dbSNP
rs757941850 4317 dbSNP
rs750620830 4319 dbSNP
rs1157904535 4322 dbSNP
rs1273232442 4325 dbSNP
rs1437771965 4331 dbSNP
rs75102659 4332 dbSNP
rs186688015 4336 dbSNP
rs1441840079 4338 dbSNP
rs930929092 4338 dbSNP
rs1179025652 4340 dbSNP
rs1447840035 4341 dbSNP
rs1168217355 4343 dbSNP
rs1390802708 4345 dbSNP
rs919505866 4347 dbSNP
rs1301237558 4357 dbSNP
rs540013581 4359 dbSNP
rs972394856 4360 dbSNP
rs1339072707 4361 dbSNP
rs887467785 4366 dbSNP
rs1225669092 4368 dbSNP
rs1212597839 4369 dbSNP
rs566145632 4374 dbSNP
rs1342170782 4379 dbSNP
rs1228971014 4387 dbSNP
rs961321258 4404 dbSNP
rs1482867457 4408 dbSNP
rs1200994084 4413 dbSNP
rs993411917 4415 dbSNP
rs912198538 4416 dbSNP
rs1188091673 4426 dbSNP
rs1463384670 4426 dbSNP
rs896445731 4436 dbSNP
rs986972120 4436 dbSNP
rs953779616 4439 dbSNP
rs1310365506 4440 dbSNP
rs1386836988 4445 dbSNP
rs1434838773 4445 dbSNP
rs539443404 4447 dbSNP
rs549780465 4448 dbSNP
rs535571286 4453 dbSNP
rs530024318 4460 dbSNP
rs1449838736 4463 dbSNP
rs1359184632 4469 dbSNP
rs1264933049 4470 dbSNP
rs946679622 4471 dbSNP
rs1207862500 4472 dbSNP
rs1268578517 4472 dbSNP
rs1297075813 4480 dbSNP
rs1486955403 4482 dbSNP
rs6786282 4483 dbSNP
rs988569531 4484 dbSNP
rs1159236991 4486 dbSNP
rs1202145959 4487 dbSNP
rs922890786 4488 dbSNP
rs1443772734 4489 dbSNP
rs1347346495 4494 dbSNP
rs1020867658 4495 dbSNP
rs1291440908 4500 dbSNP
rs975518962 4502 dbSNP
rs1183799924 4506 dbSNP
rs1009599117 4507 dbSNP
rs1348531167 4509 dbSNP
rs1473263198 4512 dbSNP
rs541323162 4521 dbSNP
rs1241557371 4525 dbSNP
rs1227748512 4526 dbSNP
rs531658001 4529 dbSNP
rs1035005122 4530 dbSNP
rs1219578390 4533 dbSNP
rs1002703136 4534 dbSNP
rs905276755 4535 dbSNP
rs1488969695 4540 dbSNP
rs1049257662 4543 dbSNP
rs770434342 4551 dbSNP
rs898111520 4552 dbSNP
rs1036583865 4554 dbSNP
rs984567929 4566 dbSNP
rs951914182 4569 dbSNP
rs1025978987 4570 dbSNP
rs1348926601 4573 dbSNP
rs1315294178 4580 dbSNP
rs760670970 4582 dbSNP
rs1221562557 4592 dbSNP
rs1368200499 4597 dbSNP
rs564399933 4600 dbSNP
rs1280079303 4606 dbSNP
rs1226399609 4608 dbSNP
rs960581925 4615 dbSNP
rs1360413366 4619 dbSNP
rs1248498093 4620 dbSNP
rs1034938776 4625 dbSNP
rs1482776358 4640 dbSNP
rs746470125 4644 dbSNP
rs773324607 4645 dbSNP
rs115460237 4647 dbSNP
rs1361974419 4648 dbSNP
rs1415025542 4652 dbSNP
rs751613180 4655 dbSNP
rs1457393320 4662 dbSNP
rs1165109179 4676 dbSNP
rs1387726224 4678 dbSNP
rs1347855074 4682 dbSNP
rs905041331 4684 dbSNP
rs986446851 4685 dbSNP
rs932428063 4687 dbSNP
rs1290620342 4688 dbSNP
rs1166695796 4692 dbSNP
rs1445801569 4694 dbSNP
rs148225509 4697 dbSNP
rs116284124 4698 dbSNP
rs560108519 4706 dbSNP
rs1052438749 4709 dbSNP
rs934000774 4714 dbSNP
rs922816041 4715 dbSNP
rs1039948851 4716 dbSNP
rs1191849557 4722 dbSNP
rs541911182 4723 dbSNP
rs1264056114 4724 dbSNP
rs1310925231 4728 dbSNP
rs1210067443 4730 dbSNP
rs1462948519 4737 dbSNP
rs942841547 4737 dbSNP
rs967863008 4743 dbSNP
rs1487808468 4748 dbSNP
rs1267533998 4749 dbSNP
rs1222785615 4753 dbSNP
rs1307340815 4758 dbSNP
rs1257021354 4770 dbSNP
rs1216451516 4771 dbSNP
rs1412649851 4778 dbSNP
rs1421078568 4778 dbSNP
rs1175285317 4781 dbSNP
rs374821704 4785 dbSNP
rs534853344 4786 dbSNP
rs1318356775 4790 dbSNP
rs984736030 4794 dbSNP
rs1386108082 4795 dbSNP
rs1365415792 4804 dbSNP
rs181421444 4823 dbSNP
rs951823581 4825 dbSNP
rs1365608659 4842 dbSNP
rs1219098358 4847 dbSNP
rs919012057 4849 dbSNP
rs1326363720 4851 dbSNP
rs1207203199 4862 dbSNP
rs1267949975 4868 dbSNP
rs1458209985 4870 dbSNP
rs1193497143 4873 dbSNP
rs1446038691 4873 dbSNP
rs1243298920 4874 dbSNP
rs1476756808 4882 dbSNP
rs1266988484 4884 dbSNP
rs988483037 4891 dbSNP
rs971687328 4907 dbSNP
rs1429886823 4919 dbSNP
rs1470943555 4923 dbSNP
rs960379381 4924 dbSNP
rs1387670787 4929 dbSNP
rs762997685 4936 dbSNP
rs775719621 4942 dbSNP
rs1329349400 4943 dbSNP
rs1035440188 4944 dbSNP
rs1002206737 4958 dbSNP
rs1284069550 4965 dbSNP
rs1347919963 4981 dbSNP
rs1227139983 4982 dbSNP
rs905309291 4984 dbSNP
rs1288074836 4993 dbSNP
rs969319648 5004 dbSNP
rs1205282065 5007 dbSNP
rs78879645 5019 dbSNP
rs562598241 5020 dbSNP
rs115857004 5028 dbSNP
rs1269025251 5038 dbSNP
rs576804872 5046 dbSNP
rs898013720 5054 dbSNP
rs1179951372 5057 dbSNP
rs1362949294 5060 dbSNP
rs1160153767 5064 dbSNP
rs1388833471 5066 dbSNP
rs1424318373 5072 dbSNP
rs1303806995 5076 dbSNP
rs1367564745 5086 dbSNP
rs558389059 5088 dbSNP
rs1192348695 5089 dbSNP
rs1052951299 5098 dbSNP
rs189031916 5100 dbSNP
rs1282841307 5104 dbSNP
rs1353778896 5108 dbSNP
rs572112589 5115 dbSNP
rs944959021 5116 dbSNP
rs1490700943 5121 dbSNP
rs890704358 5122 dbSNP
rs72952659 5133 dbSNP
rs1438385668 5136 dbSNP
rs1258070771 5142 dbSNP
rs910161470 5167 dbSNP
rs1444196176 5170 dbSNP
rs932318818 5179 dbSNP
rs921046280 5186 dbSNP
rs1164480785 5195 dbSNP
rs979189106 5205 dbSNP
rs759904249 5211 dbSNP
rs1048522806 5215 dbSNP
rs930141178 5219 dbSNP
rs1167463393 5221 dbSNP
rs777000773 5221 dbSNP
rs1303315585 5225 dbSNP
rs1393684108 5226 dbSNP
rs1332562461 5238 dbSNP
rs946426680 5246 dbSNP
rs1387323252 5254 dbSNP
rs913740715 5257 dbSNP
rs1451387106 5260 dbSNP
rs369288519 5260 dbSNP
rs1375809796 5262 dbSNP
rs918989968 5265 dbSNP
rs1225526162 5269 dbSNP
rs530289012 5274 dbSNP
rs960945489 5279 dbSNP
rs1197519794 5283 dbSNP
rs1253762076 5302 dbSNP
rs747481561 5303 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guuugugguaaCAGUGUGAGGu 5'
Target 5' -------agagGUUGCACUCCa 3'
1 - 15
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000240922.3 | 3UTR | AGAGGUUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084079
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000240922.3 | 3UTR | CAGAGGUUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.748 1.6e-3 0.571 2.1e-2 13 Click to see details
GSE28544 Breast cancer 0.402 2.6e-2 0.475 9.5e-3 24 Click to see details
GSE19350 CNS germ cell tumors -0.493 5.2e-2 -0.311 1.6e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.315 6.7e-2 0.306 7.3e-2 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.224 1.5e-1 -0.401 2.9e-2 23 Click to see details
GSE32688 Pancreatic cancer -0.187 1.5e-1 -0.096 3.0e-1 32 Click to see details
GSE38226 Liver fibrosis 0.201 1.9e-1 0.104 3.3e-1 21 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.159 2.2e-1 -0.116 2.9e-1 25 Click to see details
GSE21849 B cell lymphoma 0.132 2.5e-1 0.233 1.1e-1 29 Click to see details
GSE21687 Ependynoma primary tumors 0.076 2.8e-1 0.125 1.6e-1 64 Click to see details
GSE17498 Multiple myeloma -0.071 3.3e-1 -0.189 1.2e-1 40 Click to see details
GSE17306 Multiple myeloma 0.055 3.5e-1 0.114 2.2e-1 49 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.061 4.0e-1 -0.179 2.3e-1 20 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.085 4.4e-1 -0.257 3.1e-1 6 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.019 4.6e-1 0.012 4.8e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
ESCA -0.925 0.01 -0.800 0.05 5 Click to see details
LIHC 0.245 0.04 -0.122 0.2 49 Click to see details
KIRP -0.589 0.05 0.033 0.47 9 Click to see details
STAD 0.569 0.07 0.238 0.29 8 Click to see details
CHOL 0.304 0.21 0.300 0.22 9 Click to see details
HNSC 0.781 0.21 1.000 0.5 3 Click to see details
THCA -0.404 0.25 -0.100 0.44 5 Click to see details
KIRC -0.093 0.32 -0.189 0.16 29 Click to see details
KICH -0.139 0.37 -0.214 0.31 8 Click to see details
KICH -0.139 0.37 -0.214 0.31 8 Click to see details
KICH -0.139 0.37 -0.214 0.31 8 Click to see details
KICH -0.139 0.37 -0.214 0.31 8 Click to see details
KICH -0.139 0.37 -0.214 0.31 8 Click to see details
KICH -0.139 0.37 -0.214 0.31 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2