miRTarBase - #MIRT616471 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ADRA2B   
Synonyms ADRA2L1, ADRA2RL1, ADRARL1, ALPHA2BAR, FAME2, alpha-2BAR
Description adrenoceptor alpha 2B
Transcript NM_000682   
Expression
Putative miRNA Targets on ADRA2B
3'UTR of ADRA2B
(miRNA target sites are highlighted)
>ADRA2B|NM_000682|3'UTR
   1 GCCCGCCTGCGCTGCCCCTGTGGGGTTGGTGCGGTGGCGCCGGGGTCACCCTGCTTCTTGCCCTGCTGTGTGTGGCTGCC
  81 TCCCCTGGGCTTTCTGCTCCCTGCCCAGATCCTGTAGGCCTCATCTTAGGAACCCCTTGGGAGGGGTGGGCAGGGGGGCT
 161 GCTAGCAAGGGTCCCAGTGAAGCTTCCCCTTGCCGGCTTAGCTGTGGGGGACCCCTTCTCCACCCTCTCCCTGAGCACAG
 241 GCCGATGGAGGTGGTTCAAATCCTCTGGAACATAGCCAAGACCAGGAGAAGAGAGAGCACTTTCTTCCCAGAGCCCCATG
 321 CTCTCCAGACCAATGTCTGGGCTTCCCTTTCTTGAGGACCTTGTGTTCCTGGCAGGTCACTTGCTTGTGGTGTTTTCGTT
 401 TCTTTTTCATCTCCCCCCCACCCACAAAGAGCACGGAGCCAGCCTTCCACTTTTCCCAGTGGGGCCTGCTGCTGAGGGGG
 481 AGGAAGAAACGAAGACTGATCACCCACGCTAGGCACTCGCGGTCCCTGGCAGGCGCTGGGATGGGGGCTTATGGGGTGGC
 561 ATCGTCTCTGGGCCCTCCTTTCCCCCTTTGCCTGTTTTCGGATCTGTGGTTCCTTTGAAAGCCAGAACAATGGATCGGCT
 641 TCCTTACCCAGCACCCCTCCGGTAGGTGGGTGGCCACGTGGATGCCTCGCTGGGGCGGTCTTGGAGGCCTGGTCTCTGCC
 721 TCGACGGGAGATCCCCGATCACTGGCATTCACCCCCTGCAAAAATCGGGGCGACAATAGCTCACTGCCTACTTGCTGCAG
 801 GGAGATGAAAGGCTTTGCAGAAAGCTTTGAGCTCTGTGGGGGAACACACTAGAGAACCAAAAATGTGATTATATGGTGAT
 881 ATAAAAATCCCTTTCCTCTGTGTTTACCACCACCTGTCTTCCTGTAGACTTTTGTTCTGTCCCTGGGGTGTGTGAATTCC
 961 TACCCCGAACTGGAAGCCGGGAGTGGCAGACAGAATCACTATTTCAAGTTAAAGGATCTCTTTGAGAATGTGTTCTTCTG
1041 GCTGCAAAGGTCTGAGTTATTACGCTACATGACAACGTTTCGACATTTCACCGGCAACACCAAGAGGGTTTTTAGTGGCT
1121 TGGGTCTCCCCAGTGGGGGATAAGTCTTTTGTCATCAAGGAGGCAAATTGTCTCCCCAAGACAGCTCAAAATATCCACAC
1201 CTCGGCAACAGTCTAAGATGAGAGCCTGTGACAGGTGGCAGCGCCCCCAGGTGGGGTACTGGCATCAGAGCCTGGTGCGC
1281 CCCTAGGGGAGCCTCCCACTGGAGTGCCCGGCCAGGTCTCCAAGCCCCAAATGAGTCCTTGTGAACCACAACTGATCCCC
1361 CCAGGTGGGTGCTTGTGGACTGCCTCGGACCCAGCCACGCTGCTCCCCGCAATGCTGATGGGGCTGTGCATTGAGGACCC
1441 CTGCTTCCTGGTTCTCAGTCCCACCCCAAAACCTGGCACCCAGAACAGTTGGAAGTGTGGAAAGGAGGTTTATCGGCCTT
1521 CCCTTGGAGAGGGCCTGGCTTCAACATTGGGCCAGTAGGCATCTTAGCTTGGCAGGTGTCGGGGGAATGGGCCAGATGGA
1601 CCTGCTAGATTTGGAAGGGCACCGAGGGAGTTTTCTGGGTGTAGAGAGAATGGAGGGGACCAAAAAGAGTCCTTCCTGGG
1681 GTGTGGGAGGCTTCCCAGCTTGGTCCTCAGTGGGTTGTTGAGGCCAGAGTATCGCCCTGGGATGTGGTGGGGAGCTGGGC
1761 CAGGAGAGGGACTGACTGTGACCCTCTGCTGGCCGGTCTTGTGTGCGCCCCATGGGACCCCCAGTGTTCTTGCCTGTGAC
1841 CTCTTATTGCGACATGCAGGTGGTGTTTTTTTTTTTTTTAAACTCTGAGCTATTTTATCAATAAAGGATATTTTGTAATA
1921 AG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUAC---ACGACGAu 5'
                ||| |: |   ||||||| 
Target 5' cttttcCCAGTGGGGCCTGCTGCTg 3'
450 - 474 148.00 -15.50
2
miRNA  3' guguuUGGU-AAUACACGACGau 5'
               ||::  ||  ||||||  
Target 5' agctcACTGCCTACTTGCTGCag 3'
778 - 800 125.00 -10.80
3
miRNA  3' guguuugguaauacaCGACGAu 5'
                         |||||| 
Target 5' ggggtgggcagggggGCTGCTa 3'
143 - 164 120.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN14014091 4 COSMIC
COSN26965300 5 COSMIC
COSN28870996 10 COSMIC
COSN30497486 36 COSMIC
COSN30183396 39 COSMIC
COSN30132870 58 COSMIC
COSN25117604 559 COSMIC
COSN31533446 677 COSMIC
COSN20264592 678 COSMIC
COSN28813930 697 COSMIC
COSN31594009 723 COSMIC
COSN22766537 725 COSMIC
COSN20090594 733 COSMIC
COSN30540307 766 COSMIC
COSN31538657 771 COSMIC
COSN31527473 772 COSMIC
COSN28770186 850 COSMIC
COSN31543900 863 COSMIC
COSN31518346 864 COSMIC
COSN30170927 895 COSMIC
COSN21772980 933 COSMIC
COSN31539771 991 COSMIC
COSN26496125 1025 COSMIC
COSN29455604 1082 COSMIC
COSN1862873 1268 COSMIC
COSN6559674 1287 COSMIC
COSN17181444 1301 COSMIC
COSN28409022 1733 COSMIC
COSN6559673 1807 COSMIC
COSN7996021 1851 COSMIC
COSN20096968 1865 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs186085130 2 dbSNP
rs766575378 4 dbSNP
rs34894270 5 dbSNP
rs1283553335 9 dbSNP
rs528195928 10 dbSNP
rs749269879 11 dbSNP
rs1297637620 18 dbSNP
rs1382769067 19 dbSNP
rs1262727139 20 dbSNP
rs1383948248 20 dbSNP
rs1286857033 23 dbSNP
rs775092649 24 dbSNP
rs769442805 29 dbSNP
rs75133239 32 dbSNP
rs770552082 33 dbSNP
rs372042632 38 dbSNP
rs368428483 39 dbSNP
rs35355631 41 dbSNP
rs753214024 42 dbSNP
rs556484226 43 dbSNP
rs1316142769 44 dbSNP
rs1462056306 45 dbSNP
rs371368208 47 dbSNP
rs1277183780 48 dbSNP
rs764094629 50 dbSNP
rs1205347965 61 dbSNP
rs906851956 64 dbSNP
rs1276496565 75 dbSNP
rs1456621047 75 dbSNP
rs1195795878 82 dbSNP
rs1041898466 83 dbSNP
rs945793647 85 dbSNP
rs892981408 89 dbSNP
rs1006000772 105 dbSNP
rs1430286375 106 dbSNP
rs1189372558 108 dbSNP
rs1421590994 112 dbSNP
rs1409978118 115 dbSNP
rs539984737 125 dbSNP
rs1169361703 137 dbSNP
rs1397575418 145 dbSNP
rs950535357 146 dbSNP
rs1054178905 153 dbSNP
rs1462689779 153 dbSNP
rs901308907 154 dbSNP
rs1273543358 156 dbSNP
rs1364704456 157 dbSNP
rs1219266371 158 dbSNP
rs931911943 170 dbSNP
rs1316212878 173 dbSNP
rs751256620 183 dbSNP
rs1385233244 187 dbSNP
rs1007129361 191 dbSNP
rs889818891 194 dbSNP
rs567807078 195 dbSNP
rs571178478 200 dbSNP
rs1467462425 208 dbSNP
rs1192946261 212 dbSNP
rs766071340 214 dbSNP
rs1420798625 224 dbSNP
rs1475931799 225 dbSNP
rs762724722 229 dbSNP
rs944075854 230 dbSNP
rs1389608050 231 dbSNP
rs548084606 235 dbSNP
rs1421966215 243 dbSNP
rs762498509 244 dbSNP
rs1166887493 247 dbSNP
rs924021791 250 dbSNP
rs1452966906 252 dbSNP
rs982869358 253 dbSNP
rs1478157934 261 dbSNP
rs1278163488 263 dbSNP
rs1248152162 272 dbSNP
rs13306148 273 dbSNP
rs951403038 274 dbSNP
rs1196125511 281 dbSNP
rs949275616 284 dbSNP
rs750015513 286 dbSNP
rs917744622 287 dbSNP
rs990722083 288 dbSNP
rs1456228455 294 dbSNP
rs1226880953 295 dbSNP
rs1384534196 297 dbSNP
rs1286084511 301 dbSNP
rs1257207331 307 dbSNP
rs959270704 309 dbSNP
rs527711374 317 dbSNP
rs182375643 318 dbSNP
rs974211754 333 dbSNP
rs958848978 337 dbSNP
rs1187644848 344 dbSNP
rs1367471314 345 dbSNP
rs1219650647 347 dbSNP
rs984884585 360 dbSNP
rs556387749 364 dbSNP
rs1276875583 365 dbSNP
rs138176506 373 dbSNP
rs1231134250 376 dbSNP
rs1298069664 379 dbSNP
rs1359215513 385 dbSNP
rs548702396 397 dbSNP
rs764619276 398 dbSNP
rs1334913103 411 dbSNP
rs1340021116 414 dbSNP
rs1242844284 415 dbSNP
rs906897536 416 dbSNP
rs1019914851 417 dbSNP
rs538033325 419 dbSNP
rs1398481186 420 dbSNP
rs4907299 423 dbSNP
rs1440234042 429 dbSNP
rs1183506625 433 dbSNP
rs545807537 434 dbSNP
rs931839908 435 dbSNP
rs565885152 438 dbSNP
rs900331187 443 dbSNP
rs1170497256 458 dbSNP
rs1453226603 461 dbSNP
rs29000571 463 dbSNP
rs1394959300 465 dbSNP
rs530660031 472 dbSNP
rs763907974 474 dbSNP
rs1456377739 476 dbSNP
rs944602868 477 dbSNP
rs527687674 478 dbSNP
rs1377935929 481 dbSNP
rs1042904224 485 dbSNP
rs912555463 490 dbSNP
rs1210525183 491 dbSNP
rs1372999608 491 dbSNP
rs1233842264 494 dbSNP
rs1255390853 497 dbSNP
rs1047071090 503 dbSNP
rs896353880 504 dbSNP
rs566816240 507 dbSNP
rs930060334 508 dbSNP
rs1457049633 514 dbSNP
rs937824429 515 dbSNP
rs920038585 516 dbSNP
rs560037946 518 dbSNP
rs909137004 519 dbSNP
rs974139681 520 dbSNP
rs760396139 521 dbSNP
rs927477043 528 dbSNP
rs1279527180 530 dbSNP
rs548591271 534 dbSNP
rs540121216 535 dbSNP
rs1361281678 544 dbSNP
rs1387156999 551 dbSNP
rs145519326 554 dbSNP
rs775706621 556 dbSNP
rs1300451976 557 dbSNP
rs976265274 562 dbSNP
rs965798169 563 dbSNP
rs1278277702 564 dbSNP
rs1316805453 573 dbSNP
rs1196342886 574 dbSNP
rs1274689786 575 dbSNP
rs1433729519 584 dbSNP
rs1210816417 587 dbSNP
rs1019927108 591 dbSNP
rs1360837988 594 dbSNP
rs191577530 609 dbSNP
rs1437325214 613 dbSNP
rs1017341480 617 dbSNP
rs544150391 622 dbSNP
rs1292740307 632 dbSNP
rs1388377306 636 dbSNP
rs35994755 636 dbSNP
rs1001121437 637 dbSNP
rs902533572 642 dbSNP
rs1294675647 654 dbSNP
rs995873107 655 dbSNP
rs1013513759 657 dbSNP
rs772400466 660 dbSNP
rs1186002148 665 dbSNP
rs1219404950 666 dbSNP
rs558589033 668 dbSNP
rs1487980372 670 dbSNP
rs1191600037 677 dbSNP
rs1055095826 678 dbSNP
rs1424596337 684 dbSNP
rs1164401170 688 dbSNP
rs539669669 689 dbSNP
rs2733970 696 dbSNP
rs577495626 697 dbSNP
rs1359828957 698 dbSNP
rs1397527374 707 dbSNP
rs746075861 713 dbSNP
rs1304065401 718 dbSNP
rs929986509 721 dbSNP
rs919924647 722 dbSNP
rs774533357 725 dbSNP
rs1320241153 726 dbSNP
rs1242807556 727 dbSNP
rs1038500360 732 dbSNP
rs929221874 733 dbSNP
rs1229400239 736 dbSNP
rs1215155116 737 dbSNP
rs919138871 748 dbSNP
rs1381724645 750 dbSNP
rs1483649963 761 dbSNP
rs13306149 766 dbSNP
rs927456848 767 dbSNP
rs981610883 770 dbSNP
rs1441249326 771 dbSNP
rs975790769 772 dbSNP
rs770863217 776 dbSNP
rs1417785725 779 dbSNP
rs1178193946 782 dbSNP
rs913508878 783 dbSNP
rs1299710020 788 dbSNP
rs760888362 791 dbSNP
rs1344127303 797 dbSNP
rs1310427855 812 dbSNP
rs957067948 824 dbSNP
rs1281377760 825 dbSNP
rs1032603953 840 dbSNP
rs1312810943 845 dbSNP
rs3813662 850 dbSNP
rs980122991 854 dbSNP
rs1459248600 858 dbSNP
rs1179571080 863 dbSNP
rs756557066 871 dbSNP
rs1019205302 880 dbSNP
rs534484437 882 dbSNP
rs1478047816 887 dbSNP
rs1013544946 888 dbSNP
rs1379513423 889 dbSNP
rs138645845 891 dbSNP
rs1330308368 906 dbSNP
rs1264140933 909 dbSNP
rs562946970 914 dbSNP
rs1033759772 916 dbSNP
rs1219217516 926 dbSNP
rs538196617 928 dbSNP
rs1241610443 929 dbSNP
rs185624106 932 dbSNP
rs994750623 934 dbSNP
rs1199484713 937 dbSNP
rs1048899131 941 dbSNP
rs45568638 958 dbSNP
rs1223501028 959 dbSNP
rs1247153992 963 dbSNP
rs373071216 966 dbSNP
rs552610795 967 dbSNP
rs1477888266 969 dbSNP
rs1233035594 978 dbSNP
rs1408518628 979 dbSNP
rs781405076 983 dbSNP
rs1319067981 991 dbSNP
rs532203315 997 dbSNP
rs1350898666 999 dbSNP
rs1436355008 1001 dbSNP
rs369276346 1001 dbSNP
rs910215044 1006 dbSNP
rs1342395413 1008 dbSNP
rs1050193874 1022 dbSNP
rs181713863 1026 dbSNP
rs1230297914 1027 dbSNP
rs1290319184 1029 dbSNP
rs1450858653 1030 dbSNP
rs1220125095 1032 dbSNP
rs1187036724 1042 dbSNP
rs1360590620 1044 dbSNP
rs925666849 1049 dbSNP
rs1046213312 1052 dbSNP
rs29000572 1063 dbSNP
rs764827329 1064 dbSNP
rs1473573318 1068 dbSNP
rs967242711 1070 dbSNP
rs529942240 1076 dbSNP
rs189142434 1077 dbSNP
rs756684192 1081 dbSNP
rs796969517 1092 dbSNP
rs1400628855 1093 dbSNP
rs1465901848 1095 dbSNP
rs974405311 1097 dbSNP
rs964717576 1099 dbSNP
rs1033622554 1107 dbSNP
rs1285054826 1108 dbSNP
rs1324826051 1108 dbSNP
rs185994066 1116 dbSNP
rs988853034 1122 dbSNP
rs1018722044 1134 dbSNP
rs1426948195 1135 dbSNP
rs987626193 1136 dbSNP
rs955128423 1140 dbSNP
rs1419161475 1143 dbSNP
rs575151053 1145 dbSNP
rs564861251 1146 dbSNP
rs994760343 1154 dbSNP
rs1259018491 1158 dbSNP
rs1443692267 1184 dbSNP
rs899058556 1189 dbSNP
rs1187755938 1194 dbSNP
rs1236566041 1198 dbSNP
rs1017364312 1200 dbSNP
rs29000573 1203 dbSNP
rs140847349 1204 dbSNP
rs753780141 1208 dbSNP
rs950144071 1213 dbSNP
rs1225765392 1220 dbSNP
rs888811857 1220 dbSNP
rs1050102730 1224 dbSNP
rs891964741 1225 dbSNP
rs1053190305 1227 dbSNP
rs554401747 1242 dbSNP
rs1377416445 1243 dbSNP
rs1220430849 1244 dbSNP
rs936268871 1249 dbSNP
rs1041827792 1250 dbSNP
rs1346458180 1252 dbSNP
rs926235236 1263 dbSNP
rs1200536123 1267 dbSNP
rs975384281 1269 dbSNP
rs1263897413 1278 dbSNP
rs878993585 1279 dbSNP
rs943089900 1280 dbSNP
rs1200213242 1284 dbSNP
rs911541737 1289 dbSNP
rs534341445 1291 dbSNP
rs950408264 1295 dbSNP
rs1026170918 1300 dbSNP
rs973205289 1301 dbSNP
rs963195206 1309 dbSNP
rs1401678006 1310 dbSNP
rs29000574 1310 dbSNP
rs980740831 1312 dbSNP
rs952106546 1318 dbSNP
rs1002523091 1319 dbSNP
rs1329041091 1323 dbSNP
rs555209479 1326 dbSNP
rs1304695759 1335 dbSNP
rs1332772350 1336 dbSNP
rs1354138675 1347 dbSNP
rs1177085603 1357 dbSNP
rs961925526 1359 dbSNP
rs550129572 1362 dbSNP
rs1024687582 1365 dbSNP
rs1014308546 1371 dbSNP
rs1258326496 1376 dbSNP
rs1393357077 1383 dbSNP
rs29000575 1386 dbSNP
rs564247121 1387 dbSNP
rs142587561 1398 dbSNP
rs760596638 1401 dbSNP
rs1200252498 1407 dbSNP
rs1428659255 1408 dbSNP
rs1479511031 1409 dbSNP
rs552430969 1410 dbSNP
rs904688078 1413 dbSNP
rs546034489 1415 dbSNP
rs1256172573 1421 dbSNP
rs566581196 1430 dbSNP
rs1392698851 1431 dbSNP
rs1387246972 1454 dbSNP
rs1345030818 1457 dbSNP
rs546400372 1461 dbSNP
rs529806398 1468 dbSNP
rs892665680 1473 dbSNP
rs1051843278 1474 dbSNP
rs1278359079 1486 dbSNP
rs1378986317 1489 dbSNP
rs148821178 1496 dbSNP
rs1390557502 1497 dbSNP
rs29000576 1502 dbSNP
rs1303578967 1503 dbSNP
rs1358969752 1504 dbSNP
rs939480880 1508 dbSNP
rs1373931241 1512 dbSNP
rs759824225 1514 dbSNP
rs1195948439 1515 dbSNP
rs1264066620 1522 dbSNP
rs147773851 1530 dbSNP
rs1382676316 1546 dbSNP
rs963240487 1547 dbSNP
rs920571419 1567 dbSNP
rs972200607 1575 dbSNP
rs926415599 1577 dbSNP
rs564884933 1580 dbSNP
rs1298273968 1581 dbSNP
rs1183181626 1583 dbSNP
rs1339330743 1584 dbSNP
rs1380153479 1586 dbSNP
rs971025313 1588 dbSNP
rs774394011 1591 dbSNP
rs1024320781 1592 dbSNP
rs953160122 1600 dbSNP
rs1291621066 1601 dbSNP
rs1279213000 1606 dbSNP
rs1216678635 1608 dbSNP
rs1357905374 1619 dbSNP
rs1219519085 1622 dbSNP
rs1014236587 1623 dbSNP
rs780406709 1624 dbSNP
rs1238254021 1627 dbSNP
rs904212761 1630 dbSNP
rs369917442 1641 dbSNP
rs1031757142 1643 dbSNP
rs1159235149 1644 dbSNP
rs1344044535 1648 dbSNP
rs145612437 1651 dbSNP
rs1000231137 1656 dbSNP
rs1304157237 1662 dbSNP
rs1314589166 1669 dbSNP
rs1379465305 1676 dbSNP
rs1451536463 1685 dbSNP
rs1314787149 1686 dbSNP
rs528195262 1695 dbSNP
rs1381091453 1699 dbSNP
rs904699219 1702 dbSNP
rs1242918929 1717 dbSNP
rs1412772265 1733 dbSNP
rs1039575527 1734 dbSNP
rs1353759444 1735 dbSNP
rs1213740349 1739 dbSNP
rs1257918291 1744 dbSNP
rs1007828158 1747 dbSNP
rs890674101 1748 dbSNP
rs1483699980 1759 dbSNP
rs1052004997 1763 dbSNP
rs1203321637 1769 dbSNP
rs549146717 1780 dbSNP
rs1400636984 1783 dbSNP
rs928980321 1794 dbSNP
rs559448446 1795 dbSNP
rs540844696 1802 dbSNP
rs918917449 1806 dbSNP
rs1407174549 1808 dbSNP
rs1416735212 1812 dbSNP
rs1177589802 1813 dbSNP
rs1453690364 1824 dbSNP
rs1369613778 1825 dbSNP
rs1359299137 1827 dbSNP
rs1037463210 1836 dbSNP
rs182407237 1840 dbSNP
rs554991744 1850 dbSNP
rs926495507 1851 dbSNP
rs1449508800 1859 dbSNP
rs76946607 1865 dbSNP
rs34790807 1866 dbSNP
rs1056772747 1867 dbSNP
rs1222618940 1869 dbSNP
rs1193970748 1870 dbSNP
rs1324426793 1874 dbSNP
rs939554966 1875 dbSNP
rs905366590 1879 dbSNP
rs11464083 1880 dbSNP
rs1192888253 1880 dbSNP
rs1458875561 1880 dbSNP
rs1259069154 1881 dbSNP
rs1479834892 1883 dbSNP
rs1491418179 1883 dbSNP
rs1491184066 1884 dbSNP
rs1356963729 1885 dbSNP
rs1267194584 1887 dbSNP
rs1231206695 1890 dbSNP
rs1173763359 1892 dbSNP
rs1425330523 1893 dbSNP
rs865975612 1901 dbSNP
rs1333920231 1907 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084080. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SantaCruzAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer -0.176 5.6e-2 -0.124 1.3e-1 83 Click to see details
GSE19536 Breast cancer -0.116 1.3e-1 -0.096 1.7e-1 100 Click to see details
GSE28260 Renal cortex and medulla 0.296 1.6e-1 0.253 2.0e-1 13 Click to see details
GSE19350 CNS germ cell tumors -0.282 1.9e-1 0.007 4.9e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.181 1.9e-1 0.313 6.4e-2 25 Click to see details
GSE38226 Liver fibrosis -0.166 2.4e-1 -0.025 4.6e-1 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.167 2.4e-1 -0.009 4.8e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.143 2.5e-1 0.149 2.4e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.182 2.5e-1 -0.026 4.6e-1 16 Click to see details
GSE21849 B cell lymphoma 0.127 2.6e-1 0.177 1.8e-1 29 Click to see details
GSE21687 Ependynoma primary tumors -0.082 2.6e-1 -0.158 1.1e-1 64 Click to see details
GSE19783 ER- ER- breast cancer -0.062 2.9e-1 0.026 4.1e-1 79 Click to see details
GSE28544 Breast cancer 0.111 3.0e-1 0.118 2.9e-1 24 Click to see details
GSE17498 Multiple myeloma -0.083 3.1e-1 -0.063 3.5e-1 40 Click to see details
GSE42095 Differentiated embryonic stem cells 0.109 3.1e-1 0.125 2.8e-1 23 Click to see details
GSE19783 ER+ ER+ breast cancer 0.107 3.3e-1 -0.149 2.7e-1 20 Click to see details
GSE17306 Multiple myeloma 0.052 3.6e-1 -0.083 2.9e-1 49 Click to see details
GSE14794 Lymphoblastoid cells -0.019 4.3e-1 -0.016 4.4e-1 90 Click to see details
GSE32688 Pancreatic cancer -0.032 4.3e-1 0.121 2.5e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.014 4.7e-1 -0.013 4.8e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.014 4.7e-1 -0.013 4.8e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.454 0 -0.428 0.01 32 Click to see details
KIRP 0.354 0.02 0.240 0.09 32 Click to see details
KIRC -0.225 0.03 -0.257 0.02 68 Click to see details
HNSC -0.251 0.05 -0.252 0.05 42 Click to see details
LUSC 0.18 0.14 0.163 0.16 38 Click to see details
CESC 0.883 0.16 0.500 0.33 3 Click to see details
PAAD 0.633 0.18 0.400 0.3 4 Click to see details
LIHC -0.107 0.23 -0.116 0.21 49 Click to see details
LUAD -0.224 0.24 -0.140 0.33 12 Click to see details
COAD -0.279 0.25 -0.476 0.12 8 Click to see details
UCEC 0.109 0.33 -0.007 0.49 19 Click to see details
PRAD 0.057 0.35 0.008 0.48 50 Click to see details
CHOL -0.139 0.36 -0.033 0.47 9 Click to see details
BLCA -0.071 0.39 -0.131 0.3 18 Click to see details
KICH 0.034 0.44 0.083 0.35 25 Click to see details
PCPG 0.179 0.44 -0.500 0.33 3 Click to see details
BRCA 0.014 0.45 0.061 0.29 84 Click to see details
ESCA -0.034 0.46 0.382 0.12 11 Click to see details
THCA 0.01 0.47 0.016 0.45 59 Click to see details
THCA 0.01 0.47 0.016 0.45 59 Click to see details
THCA 0.01 0.47 0.016 0.45 59 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*