miRTarBase - #MIRT607842 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PHLDA3   
Synonyms TIH1
Description pleckstrin homology like domain family A member 3
Transcript NM_012396   
Expression
Putative miRNA Targets on PHLDA3
3'UTR of PHLDA3
(miRNA target sites are highlighted)
>PHLDA3|NM_012396|3'UTR
   1 ACCACCGGGCGCACCATCTTTCCTTCATGCTACCCACCACCTCAGTGCTGAGGTCAAGGCAGCTTCGTTGTTCCCTCTGG
  81 CTTGTGGGGGCACGGCTGTGCTCCATGTGGCAAGGTGGAAGGCATGGACGTGTGGAGGAGGCGCTGGAGCTGAAGGAATG
 161 GACGAGCCCTGGGAGGAGGGCAGAAGGCTACGCAGGGCTGAGGATGAAGATGCAGCCCCTGGATGGTCCCAGACTCTCAG
 241 GACATGCCCAGCTCAGGGGCTTCGAGCCACAGGCCTGGCCTCATATGGCATGAGGGGGAGCTGGCATAGGAGCCCCCTCC
 321 CTGCTGTGGTCCTGCCCTCTGTCCTGCAGACTGCTCTTAGCCCCCTGGCTTTGTGCCAGGCCTGGAGGAGGGCAGTCCCC
 401 CATGGGGTGCCGAGCCAACGCCTCAGGAATCAGGAGGCCAGCCTGGTACCAAAAGGAGTACCCAGGGCCTGGTACCCAGG
 481 CCCACTCCAGAATGGCCTCTGGACTCACCTTGAGAAGGGGGAGCTGCTGGGCCTAAAGCCCACTCCTGGGGGTCTCCTGC
 561 TGCTTAGGTCCTTTTGGGACCCCCACCCATCCAGGCCCTTTCTTTGCACACTTCTTCCCCCACCTCTACGCATCTTCCCC
 641 CCACTGCGGTGTTCGGCCTGAAGGTGGTGGGGGTGAGGGGGGGTTTGGCCATTAGCATTTCATGTCTTTCCCCAAATGAA
 721 GATGCCCTGCAAAGGGCAGTAACCACACAGTTTGCTGAGTGAAATTCTTTGCCCACAAAGACCCAGGGCTTGGAGCATCT
 801 CTCTCTTTATCCTTAATCTCCCAATTTGCAACCCATTCTGAAGTCTCCAGCCTGGATAGGCAGAGACACTAAAACCCCAG
 881 TAGACAGGGCCTTGGTGGTCCTAGGAAGGAGGGCCCATAGATTCTGGACCGAGGGATGTCAAGCTGGTCAGTTCAGTCCC
 961 TATGAATGTCTCTTCTACAGGAGGCTACCCTGCCCCTGCTACCCTGGGAGAAGCCTCAGCTTTCTGGGCAGAGTTTGTCT
1041 CCCTGTCATTTATACTCTCAGGCTTTATACATTTACACAGTAAGTTCTCCCTCCTGGAGGGTTAAAAGGAATAATTTCAA
1121 CAGGGTGAAGGCCTGGCACGGTGGCTCACAACTGTAATCCAAGGACTTTGGGAGGCTGAGGTGGGTGGATCACCTGAGGT
1201 CAGGAATTTGAGACCAGCCTGGCCAACTTGGTGAAACCCTGTCTCTACTAAAAACAAAAATTAGCCAGGTGAGGTGGCAC
1281 ACACCTATAGCCCCAGCTACTGGGGGAGGCTGAGGCAGGAGAATTGCTTGAACCTGGGAGGCAGAGGTTACAGTGAGCTG
1361 AGATGGCACCACTGCACTCCAGCCTAGGTGACAAAGCAGCAAGACGCAGTCTCAAAACAACAACAACAAAAAAAACGGGA
1441 AAACAGGTACAGACAATAGCTGCCTGGAGTTGTACAGAAACTTGATTGGGTAACCCTGGACCTTTCCAGGCTGTGGCCAG
1521 CAGTTGACCCTGCCTGCCTTTCCTCCATTGTTTTCCCATGTCTGACCTTCCCTGTTGCAAAGCAGTGGCCTACTACAGGG
1601 TCTCTCTGGAGGGAGCAAGGAGGCTCAGTGGCCCCATTCAGCAATTCGAAGTCCCTTTAATTGTTTTGTGCTTCCAACCT
1681 GTTTTGTTCCCGTTCAGATTTCTCTCGCCTTCCAATAAAAACTTCCCTGTCCTGTGCCCCAGTCCCTCAGAGTCCACAAG
1761 AGGTTCAACTTGCTCATCTGATGTGTGAATTACATCACACAGTTGAATGAGAATTTGTTAATTACAACAGAACTTTTATA
1841 AATATGTCACTTACTGTATCCAATTGTACAATTGTCCATGGGTGGCTTAATCCCACCATGGCAAATAAGCGTCTGTTTAT
1921 GCAACCCTAATCAGTGCTGAGAAAGATCAGAGCTCAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::||||| |   :|||||| 
Target 5' atGGCACCACT---GCACTCCa 3'
1363 - 1381 141.00 -18.40
2
miRNA  3' guuuguGGUAACAGUGUGAGGu 5'
                :| ||| ||||||:| 
Target 5' gcccttTCTTTG-CACACTTCt 3'
595 - 615 139.00 -11.70
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             || |||  | | |||||| 
Target 5' ggtAC-CCA--GGCCCACTCCa 3'
471 - 489 122.00 -14.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30478079 7 COSMIC
COSN30507111 10 COSMIC
COSN30137530 16 COSMIC
COSN30477280 23 COSMIC
COSN30190287 30 COSMIC
COSN31560907 30 COSMIC
COSN30190281 43 COSMIC
COSN30532631 45 COSMIC
COSN30149547 50 COSMIC
COSN18725361 54 COSMIC
COSN28616475 58 COSMIC
COSN24297663 60 COSMIC
COSN30131797 63 COSMIC
COSN26509619 65 COSMIC
COSN31958869 162 COSMIC
COSN21029911 348 COSMIC
COSN21029767 385 COSMIC
COSN26701322 478 COSMIC
COSN15113619 489 COSMIC
COSN22348700 547 COSMIC
COSN21029341 559 COSMIC
COSN22570368 565 COSMIC
COSN21029039 622 COSMIC
COSN6019042 631 COSMIC
COSN23748526 717 COSMIC
COSN23713346 730 COSMIC
COSN22162972 891 COSMIC
COSN16792112 1011 COSMIC
COSN7198112 1290 COSMIC
COSN6437737 1450 COSMIC
COSN9056811 1649 COSMIC
COSN6019041 1703 COSMIC
COSN15325528 1704 COSMIC
COSN16130203 1991 COSMIC
COSN6019040 2165 COSMIC
COSN24398933 2229 COSMIC
COSN30548358 2304 COSMIC
COSN31964844 2308 COSMIC
COSN24308644 2338 COSMIC
COSN6019039 2400 COSMIC
COSN15762957 2412 COSMIC
COSN15632654 2462 COSMIC
COSN24105602 2521 COSMIC
COSN20073653 2535 COSMIC
COSN30165584 2550 COSMIC
COSN31577743 2670 COSMIC
COSN30538897 2707 COSMIC
COSN15632461 2791 COSMIC
COSN30170216 2796 COSMIC
COSN30731769 2839 COSMIC
COSN32056343 2846 COSMIC
COSN24392677 2999 COSMIC
COSN6019038 3119 COSMIC
COSN6019037 3120 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1407331210 2 dbSNP
rs1406100096 6 dbSNP
rs762388991 7 dbSNP
rs773847325 11 dbSNP
rs1254511171 16 dbSNP
rs747623193 22 dbSNP
rs570267782 23 dbSNP
rs1488351653 24 dbSNP
rs762576508 26 dbSNP
rs775166638 28 dbSNP
rs1162823360 29 dbSNP
rs1454183459 31 dbSNP
rs769521341 33 dbSNP
rs1283149159 36 dbSNP
rs759758607 41 dbSNP
rs1228414870 43 dbSNP
rs1330680581 44 dbSNP
rs745604012 45 dbSNP
rs1303266044 52 dbSNP
rs1347866956 53 dbSNP
rs1256930 54 dbSNP
rs1017668975 57 dbSNP
rs1306987977 60 dbSNP
rs530490434 65 dbSNP
rs1317891142 68 dbSNP
rs903606142 69 dbSNP
rs1042128632 70 dbSNP
rs1241674199 71 dbSNP
rs1333574604 72 dbSNP
rs1282046681 73 dbSNP
rs1041576884 74 dbSNP
rs945173353 77 dbSNP
rs1175396564 78 dbSNP
rs764892819 95 dbSNP
rs766471216 99 dbSNP
rs1432535521 101 dbSNP
rs1183754772 104 dbSNP
rs1382964641 105 dbSNP
rs568171459 112 dbSNP
rs896343983 114 dbSNP
rs1056357428 117 dbSNP
rs911452972 119 dbSNP
rs1298074546 120 dbSNP
rs1374758236 126 dbSNP
rs566457907 133 dbSNP
rs984135418 138 dbSNP
rs548008588 143 dbSNP
rs528074022 144 dbSNP
rs931333122 148 dbSNP
rs551285174 150 dbSNP
rs926585597 151 dbSNP
rs972883341 153 dbSNP
rs182772133 154 dbSNP
rs1305809675 156 dbSNP
rs1035534170 158 dbSNP
rs540924562 167 dbSNP
rs1183818113 168 dbSNP
rs1241056359 168 dbSNP
rs1413237959 169 dbSNP
rs1021466099 177 dbSNP
rs1169161554 188 dbSNP
rs1161673904 192 dbSNP
rs1476474530 196 dbSNP
rs772456912 199 dbSNP
rs983551114 215 dbSNP
rs950831811 217 dbSNP
rs1011434533 225 dbSNP
rs923419723 226 dbSNP
rs114390724 228 dbSNP
rs965329839 232 dbSNP
rs1017890753 233 dbSNP
rs1000904953 237 dbSNP
rs1338925453 240 dbSNP
rs1463845368 243 dbSNP
rs367569329 249 dbSNP
rs901551834 258 dbSNP
rs1296390103 261 dbSNP
rs1307945968 262 dbSNP
rs1220379630 265 dbSNP
rs1041235593 272 dbSNP
rs373616035 274 dbSNP
rs564628398 277 dbSNP
rs1020639868 280 dbSNP
rs1009287275 281 dbSNP
rs1467633287 292 dbSNP
rs1419623479 297 dbSNP
rs931552699 304 dbSNP
rs896270704 309 dbSNP
rs1339594348 311 dbSNP
rs1343591214 312 dbSNP
rs1056683853 314 dbSNP
rs1002075818 315 dbSNP
rs1289730230 318 dbSNP
rs938781029 319 dbSNP
rs759294109 323 dbSNP
rs1038290978 338 dbSNP
rs941984419 339 dbSNP
rs116489041 341 dbSNP
rs1047788911 344 dbSNP
rs768994248 345 dbSNP
rs144555320 349 dbSNP
rs555806528 360 dbSNP
rs965835276 365 dbSNP
rs1168236508 376 dbSNP
rs541989664 378 dbSNP
rs1481055632 385 dbSNP
rs910756649 386 dbSNP
rs1406224647 389 dbSNP
rs1400560769 395 dbSNP
rs979672557 396 dbSNP
rs6696278 397 dbSNP
rs1302665004 401 dbSNP
rs1020566379 403 dbSNP
rs1344724835 406 dbSNP
rs192746362 411 dbSNP
rs539309507 415 dbSNP
rs1370900878 416 dbSNP
rs1223039699 417 dbSNP
rs1284463456 419 dbSNP
rs1048586622 421 dbSNP
rs114542426 430 dbSNP
rs1437936616 431 dbSNP
rs897359455 437 dbSNP
rs1037051602 452 dbSNP
rs1231715455 453 dbSNP
rs1469928847 456 dbSNP
rs1271813797 461 dbSNP
rs1034782290 465 dbSNP
rs76938657 468 dbSNP
rs1422980277 478 dbSNP
rs928637806 480 dbSNP
rs1366256106 482 dbSNP
rs1044482896 484 dbSNP
rs948803556 486 dbSNP
rs139681066 487 dbSNP
rs1038663059 489 dbSNP
rs1349777313 491 dbSNP
rs1279930750 492 dbSNP
rs1378587832 496 dbSNP
rs745338041 497 dbSNP
rs1303786424 505 dbSNP
rs1233308249 506 dbSNP
rs1359501010 506 dbSNP
rs1211166532 510 dbSNP
rs914439149 512 dbSNP
rs1437791473 515 dbSNP
rs781257653 516 dbSNP
rs1240428689 517 dbSNP
rs749297511 518 dbSNP
rs1386133121 524 dbSNP
rs1473803518 525 dbSNP
rs35018028 525 dbSNP
rs529438800 527 dbSNP
rs568197565 532 dbSNP
rs548258759 535 dbSNP
rs1417224067 536 dbSNP
rs887047770 539 dbSNP
rs1409322214 549 dbSNP
rs956002683 550 dbSNP
rs924495286 552 dbSNP
rs1047756785 556 dbSNP
rs1450234848 580 dbSNP
rs1383105234 588 dbSNP
rs929326899 599 dbSNP
rs757127822 600 dbSNP
rs1336476878 613 dbSNP
rs1246300232 615 dbSNP
rs528241268 617 dbSNP
rs1017270308 619 dbSNP
rs1007351864 622 dbSNP
rs565632327 628 dbSNP
rs751447633 629 dbSNP
rs1243921488 630 dbSNP
rs910736196 633 dbSNP
rs1377508886 639 dbSNP
rs979601912 640 dbSNP
rs1027156892 642 dbSNP
rs1171262987 647 dbSNP
rs1475824068 647 dbSNP
rs946953172 657 dbSNP
rs1423637986 659 dbSNP
rs914196651 667 dbSNP
rs973237329 672 dbSNP
rs987731389 673 dbSNP
rs960405090 674 dbSNP
rs1035156619 675 dbSNP
rs1325341160 677 dbSNP
rs1400118321 683 dbSNP
rs1280620602 685 dbSNP
rs1470186469 687 dbSNP
rs1322057812 692 dbSNP
rs1223212634 703 dbSNP
rs637743 705 dbSNP
rs969572196 706 dbSNP
rs533630598 708 dbSNP
rs1417364107 717 dbSNP
rs1016757057 718 dbSNP
rs1005427658 720 dbSNP
rs887016565 722 dbSNP
rs1310256712 724 dbSNP
rs1044365727 725 dbSNP
rs1224331286 726 dbSNP
rs1419721006 727 dbSNP
rs746135474 728 dbSNP
rs1287734053 729 dbSNP
rs146858789 731 dbSNP
rs1404864090 734 dbSNP
rs1302669209 735 dbSNP
rs1333159165 737 dbSNP
rs1237404084 738 dbSNP
rs993867447 739 dbSNP
rs1043438905 741 dbSNP
rs893200272 742 dbSNP
rs544604687 743 dbSNP
rs1040832035 746 dbSNP
rs943454857 748 dbSNP
rs1274842066 749 dbSNP
rs889224244 750 dbSNP
rs868614697 752 dbSNP
rs946922241 753 dbSNP
rs6693347 754 dbSNP
rs1401728662 756 dbSNP
rs1363165395 757 dbSNP
rs1411891503 758 dbSNP
rs1156254511 760 dbSNP
rs1294613990 760 dbSNP
rs1475918715 762 dbSNP
rs1164906197 764 dbSNP
rs1193790473 764 dbSNP
rs1222466329 764 dbSNP
rs1242563416 764 dbSNP
rs1249544410 764 dbSNP
rs1265908345 764 dbSNP
rs1313270305 764 dbSNP
rs1358775206 764 dbSNP
rs1377848733 764 dbSNP
rs1379440954 764 dbSNP
rs1443431805 764 dbSNP
rs1489440666 764 dbSNP
rs200538508 764 dbSNP
rs369038569 764 dbSNP
rs369307187 764 dbSNP
rs56225084 764 dbSNP
rs61818312 764 dbSNP
rs748866028 764 dbSNP
rs1200336476 767 dbSNP
rs1240843224 767 dbSNP
rs1257739839 767 dbSNP
rs752137436 767 dbSNP
rs755713471 767 dbSNP
rs1180970270 770 dbSNP
rs1482144051 773 dbSNP
rs1243704561 775 dbSNP
rs1216248904 788 dbSNP
rs1170317567 789 dbSNP
rs1194374349 792 dbSNP
rs1425029067 792 dbSNP
rs1467465922 792 dbSNP
rs562193987 792 dbSNP
rs757247379 792 dbSNP
rs763647640 792 dbSNP
rs1304882156 793 dbSNP
rs1316212581 799 dbSNP
rs1381772825 802 dbSNP
rs1277432123 805 dbSNP
rs113283143 806 dbSNP
rs1220172713 811 dbSNP
rs1226609147 818 dbSNP
rs1337097498 820 dbSNP
rs1261042412 826 dbSNP
rs573013149 833 dbSNP
rs1294112793 834 dbSNP
rs1228029052 848 dbSNP
rs552916700 849 dbSNP
rs976446979 852 dbSNP
rs1192327488 857 dbSNP
rs927637355 859 dbSNP
rs187732624 861 dbSNP
rs1290938970 863 dbSNP
rs969161777 869 dbSNP
rs910229755 879 dbSNP
rs1388493203 885 dbSNP
rs1016727255 887 dbSNP
rs771784902 887 dbSNP
rs983921586 888 dbSNP
rs636852 895 dbSNP
rs1025545020 901 dbSNP
rs1340991027 902 dbSNP
rs1401756104 907 dbSNP
rs1281371157 922 dbSNP
rs1366603748 924 dbSNP
rs1219634991 926 dbSNP
rs1418018684 927 dbSNP
rs1163633896 930 dbSNP
rs1302887410 932 dbSNP
rs1421625826 933 dbSNP
rs951792196 934 dbSNP
rs1489017477 935 dbSNP
rs1220867133 936 dbSNP
rs6693310 938 dbSNP
rs1464299007 959 dbSNP
rs1246085167 961 dbSNP
rs1193316803 963 dbSNP
rs182604219 971 dbSNP
rs1018930154 972 dbSNP
rs1266040434 975 dbSNP
rs1422863200 977 dbSNP
rs1301189421 980 dbSNP
rs1003570999 986 dbSNP
rs1008015206 992 dbSNP
rs1276401138 998 dbSNP
rs1370647767 1004 dbSNP
rs1238956716 1009 dbSNP
rs1309586412 1014 dbSNP
rs1355203149 1017 dbSNP
rs1243168187 1020 dbSNP
rs1289743649 1023 dbSNP
rs889192748 1026 dbSNP
rs568242328 1027 dbSNP
rs1457654419 1034 dbSNP
rs1179458122 1035 dbSNP
rs1382449740 1046 dbSNP
rs192087713 1053 dbSNP
rs534663425 1057 dbSNP
rs149986097 1063 dbSNP
rs1325508334 1065 dbSNP
rs939599609 1066 dbSNP
rs1012841302 1072 dbSNP
rs1445838276 1077 dbSNP
rs1296024873 1078 dbSNP
rs370905764 1084 dbSNP
rs775599374 1086 dbSNP
rs893126637 1092 dbSNP
rs1356514047 1093 dbSNP
rs1054493721 1095 dbSNP
rs1271555936 1097 dbSNP
rs1317654445 1106 dbSNP
rs934762052 1110 dbSNP
rs186437822 1111 dbSNP
rs947719533 1112 dbSNP
rs1186858304 1120 dbSNP
rs1040174359 1121 dbSNP
rs111610744 1125 dbSNP
rs750459883 1129 dbSNP
rs1195421091 1134 dbSNP
rs985805707 1141 dbSNP
rs951165729 1146 dbSNP
rs569582832 1147 dbSNP
rs918411553 1153 dbSNP
rs1266615643 1155 dbSNP
rs977016449 1156 dbSNP
rs1393920564 1162 dbSNP
rs1333176245 1163 dbSNP
rs1449641191 1166 dbSNP
rs1268881112 1175 dbSNP
rs965323013 1181 dbSNP
rs920237724 1182 dbSNP
rs972262994 1188 dbSNP
rs1018644830 1206 dbSNP
rs1206206813 1208 dbSNP
rs1279651419 1223 dbSNP
rs908711213 1224 dbSNP
rs1007527279 1226 dbSNP
rs981594280 1241 dbSNP
rs971635445 1243 dbSNP
rs953395197 1244 dbSNP
rs1236977982 1245 dbSNP
rs1194379543 1247 dbSNP
rs551243829 1249 dbSNP
rs1301227693 1250 dbSNP
rs79500475 1255 dbSNP
rs1402495486 1256 dbSNP
rs556126430 1256 dbSNP
rs78920789 1256 dbSNP
rs1384536942 1258 dbSNP
rs1374945325 1259 dbSNP
rs1298382600 1260 dbSNP
rs1295812076 1276 dbSNP
rs1033009202 1277 dbSNP
rs767572957 1284 dbSNP
rs1368327027 1286 dbSNP
rs545344938 1294 dbSNP
rs1022305986 1301 dbSNP
rs1275623184 1305 dbSNP
rs376646604 1311 dbSNP
rs892572266 1312 dbSNP
rs762226660 1314 dbSNP
rs1265313306 1323 dbSNP
rs1431179946 1324 dbSNP
rs140562649 1331 dbSNP
rs543859980 1333 dbSNP
rs1478812282 1339 dbSNP
rs888936238 1341 dbSNP
rs1431492665 1342 dbSNP
rs1359342458 1373 dbSNP
rs1050355875 1374 dbSNP
rs1300561321 1375 dbSNP
rs930542818 1378 dbSNP
rs920291654 1392 dbSNP
rs113766276 1394 dbSNP
rs1324634288 1396 dbSNP
rs1333251340 1402 dbSNP
rs1238245637 1407 dbSNP
rs1045727184 1413 dbSNP
rs147218139 1423 dbSNP
rs1242438421 1426 dbSNP
rs1035993462 1428 dbSNP
rs909562906 1438 dbSNP
rs1346205260 1440 dbSNP
rs1048119168 1442 dbSNP
rs1453178455 1444 dbSNP
rs80208624 1450 dbSNP
rs918380530 1451 dbSNP
rs1159937232 1458 dbSNP
rs1367177286 1463 dbSNP
rs1288357938 1475 dbSNP
rs1457833484 1477 dbSNP
rs578153978 1477 dbSNP
rs976607137 1478 dbSNP
rs1408710955 1479 dbSNP
rs1164412345 1484 dbSNP
rs555147756 1491 dbSNP
rs1314373669 1493 dbSNP
rs1330879041 1497 dbSNP
rs965597884 1499 dbSNP
rs1377962903 1500 dbSNP
rs1415143255 1508 dbSNP
rs911115409 1510 dbSNP
rs1448999995 1512 dbSNP
rs1310677099 1513 dbSNP
rs1401299620 1514 dbSNP
rs1170735327 1524 dbSNP
rs556664751 1527 dbSNP
rs991737896 1530 dbSNP
rs1364328828 1531 dbSNP
rs1196550674 1538 dbSNP
rs957585682 1540 dbSNP
rs1457945306 1545 dbSNP
rs1033432205 1549 dbSNP
rs1253460088 1553 dbSNP
rs1472326005 1554 dbSNP
rs1166083261 1555 dbSNP
rs1370729168 1564 dbSNP
rs998845588 1580 dbSNP
rs143773079 1583 dbSNP
rs1401226038 1585 dbSNP
rs1019054829 1602 dbSNP
rs1008966328 1607 dbSNP
rs1255983682 1610 dbSNP
rs1378488703 1613 dbSNP
rs1396725906 1620 dbSNP
rs1022232545 1624 dbSNP
rs1199099708 1628 dbSNP
rs1357295497 1629 dbSNP
rs1216508206 1633 dbSNP
rs182842698 1635 dbSNP
rs746259772 1637 dbSNP
rs994763230 1638 dbSNP
rs1253932886 1641 dbSNP
rs574652983 1650 dbSNP
rs1181973318 1655 dbSNP
rs1003674995 1656 dbSNP
rs906714038 1662 dbSNP
rs927602101 1663 dbSNP
rs796088114 1664 dbSNP
rs1479029338 1665 dbSNP
rs111836154 1671 dbSNP
rs916089248 1674 dbSNP
rs1383730853 1675 dbSNP
rs1466580234 1681 dbSNP
rs888725199 1682 dbSNP
rs1389241141 1686 dbSNP
rs138090486 1689 dbSNP
rs1340876012 1691 dbSNP
rs572296910 1694 dbSNP
rs1298694989 1696 dbSNP
rs929662913 1697 dbSNP
rs1311258931 1703 dbSNP
rs926199663 1706 dbSNP
rs1281820286 1713 dbSNP
rs1487059248 1717 dbSNP
rs1216480771 1720 dbSNP
rs896871462 1730 dbSNP
rs1041196457 1731 dbSNP
rs978062411 1738 dbSNP
rs1433970613 1758 dbSNP
rs967425482 1764 dbSNP
rs866220999 1768 dbSNP
rs1419232640 1770 dbSNP
rs1297455128 1771 dbSNP
rs1361129067 1775 dbSNP
rs963555460 1778 dbSNP
rs1366714538 1792 dbSNP
rs911031422 1794 dbSNP
rs985282029 1799 dbSNP
rs1219441096 1802 dbSNP
rs953407419 1803 dbSNP
rs1473211509 1806 dbSNP
rs1028832879 1807 dbSNP
rs994649195 1808 dbSNP
rs1449238728 1813 dbSNP
rs899090533 1816 dbSNP
rs1489035055 1817 dbSNP
rs1430705064 1819 dbSNP
rs185958427 1820 dbSNP
rs1014867255 1824 dbSNP
rs1005206045 1825 dbSNP
rs558667125 1827 dbSNP
rs947301740 1834 dbSNP
rs1408555552 1838 dbSNP
rs1274429806 1842 dbSNP
rs1162674002 1844 dbSNP
rs1349056038 1851 dbSNP
rs1209924828 1859 dbSNP
rs914523737 1871 dbSNP
rs1327440204 1877 dbSNP
rs1355154106 1878 dbSNP
rs1374235000 1884 dbSNP
rs538776107 1884 dbSNP
rs1445314921 1886 dbSNP
rs1309336061 1891 dbSNP
rs1352301820 1895 dbSNP
rs1227075159 1896 dbSNP
rs1282103753 1899 dbSNP
rs906233899 1906 dbSNP
rs989405297 1910 dbSNP
rs1046014242 1912 dbSNP
rs1349307012 1921 dbSNP
rs569590557 1922 dbSNP
rs1365727149 1924 dbSNP
rs956708544 1934 dbSNP
rs781619837 1938 dbSNP
rs1031060880 1940 dbSNP
rs947811572 1944 dbSNP
rs770795010 1949 dbSNP
rs982618751 1951 dbSNP
rs531859043 1957 dbSNP
rs1234664674 1958 dbSNP
rs1406057082 1963 dbSNP
rs1471872635 1964 dbSNP
rs1180021530 1980 dbSNP
rs936200184 1986 dbSNP
rs926093197 1991 dbSNP
rs977739872 2003 dbSNP
rs1390246631 2010 dbSNP
rs1024205293 2016 dbSNP
rs1161728725 2017 dbSNP
rs946281932 2018 dbSNP
rs1012461299 2027 dbSNP
rs1331668721 2029 dbSNP
rs1336994589 2032 dbSNP
rs1391235173 2040 dbSNP
rs1284085026 2045 dbSNP
rs911905020 2048 dbSNP
rs987429093 2051 dbSNP
rs888694253 2056 dbSNP
rs1317762506 2060 dbSNP
rs1255463994 2063 dbSNP
rs1027250228 2082 dbSNP
rs1450582785 2094 dbSNP
rs993796500 2095 dbSNP
rs201633106 2096 dbSNP
rs150777324 2097 dbSNP
rs1342603374 2099 dbSNP
rs1475502020 2100 dbSNP
rs1190065506 2102 dbSNP
rs1273566098 2102 dbSNP
rs1421168099 2103 dbSNP
rs1029052721 2104 dbSNP
rs973467111 2105 dbSNP
rs1225921484 2106 dbSNP
rs117531044 2107 dbSNP
rs1412205483 2108 dbSNP
rs1015165320 2109 dbSNP
rs1375589185 2115 dbSNP
rs1437253125 2116 dbSNP
rs1330656439 2117 dbSNP
rs1321820775 2120 dbSNP
rs1276901236 2122 dbSNP
rs1340268875 2125 dbSNP
rs1219654988 2139 dbSNP
rs141184434 2140 dbSNP
rs1343139725 2145 dbSNP
rs148222451 2148 dbSNP
rs1279406625 2150 dbSNP
rs1486717905 2153 dbSNP
rs1168297720 2157 dbSNP
rs1428260010 2161 dbSNP
rs1024616344 2162 dbSNP
rs1193641795 2177 dbSNP
rs1049541808 2178 dbSNP
rs1011841815 2179 dbSNP
rs1476831405 2185 dbSNP
rs894802990 2187 dbSNP
rs1053489561 2189 dbSNP
rs936413200 2192 dbSNP
rs904723010 2193 dbSNP
rs1042242570 2194 dbSNP
rs947229644 2195 dbSNP
rs1244543758 2196 dbSNP
rs914450415 2199 dbSNP
rs1320707884 2200 dbSNP
rs528648632 2202 dbSNP
rs757921633 2204 dbSNP
rs181083302 2210 dbSNP
rs1350080946 2213 dbSNP
rs1238095788 2217 dbSNP
rs1283710741 2220 dbSNP
rs552251247 2225 dbSNP
rs12409710 2228 dbSNP
rs563659522 2229 dbSNP
rs777745148 2233 dbSNP
rs1279227761 2235 dbSNP
rs971218138 2237 dbSNP
rs1455166092 2239 dbSNP
rs543466521 2246 dbSNP
rs1156312218 2249 dbSNP
rs1218642565 2252 dbSNP
rs1023756129 2255 dbSNP
rs758232185 2256 dbSNP
rs747935286 2259 dbSNP
rs1273088763 2262 dbSNP
rs1160872121 2263 dbSNP
rs1388998576 2266 dbSNP
rs1411760922 2267 dbSNP
rs375516884 2277 dbSNP
rs1373511987 2284 dbSNP
rs973519288 2286 dbSNP
rs778467309 2290 dbSNP
rs994405566 2291 dbSNP
rs961672644 2292 dbSNP
rs1336495491 2298 dbSNP
rs983667286 2299 dbSNP
rs1019694291 2304 dbSNP
rs1024879523 2307 dbSNP
rs1007926233 2312 dbSNP
rs1273355213 2313 dbSNP
rs1469546693 2321 dbSNP
rs959068535 2323 dbSNP
rs889498474 2324 dbSNP
rs189612371 2325 dbSNP
rs1184538052 2326 dbSNP
rs561000859 2330 dbSNP
rs1472651809 2335 dbSNP
rs1011341101 2337 dbSNP
rs1397214422 2339 dbSNP
rs1179640317 2342 dbSNP
rs1484109126 2350 dbSNP
rs11546146 2353 dbSNP
rs541369368 2354 dbSNP
rs1052911787 2361 dbSNP
rs1338635189 2366 dbSNP
rs1232394202 2384 dbSNP
rs934555846 2389 dbSNP
rs928610066 2395 dbSNP
rs1336760774 2400 dbSNP
rs1286293836 2404 dbSNP
rs1230272509 2406 dbSNP
rs1329986776 2408 dbSNP
rs1046824766 2409 dbSNP
rs1052056381 2410 dbSNP
rs932214801 2413 dbSNP
rs367985847 2416 dbSNP
rs959824249 2425 dbSNP
rs1038068286 2426 dbSNP
rs942146064 2430 dbSNP
rs1381622491 2431 dbSNP
rs558832422 2434 dbSNP
rs907924188 2441 dbSNP
rs1303732354 2448 dbSNP
rs1477072239 2449 dbSNP
rs1170185257 2452 dbSNP
rs781122936 2456 dbSNP
rs1463533716 2459 dbSNP
rs1301184974 2461 dbSNP
rs1053582 2462 dbSNP
rs1414090339 2463 dbSNP
rs970994100 2463 dbSNP
rs917744486 2465 dbSNP
rs1216605826 2467 dbSNP
rs143001949 2472 dbSNP
rs1307728557 2476 dbSNP
rs1229224941 2477 dbSNP
rs1253733548 2478 dbSNP
rs959246149 2492 dbSNP
rs556097842 2496 dbSNP
rs1260261524 2499 dbSNP
rs1156321131 2501 dbSNP
rs1425121153 2508 dbSNP
rs536585369 2510 dbSNP
rs568572062 2510 dbSNP
rs1430510863 2519 dbSNP
rs535852320 2524 dbSNP
rs1008269914 2526 dbSNP
rs1435469579 2529 dbSNP
rs953755064 2538 dbSNP
rs1007958971 2542 dbSNP
rs1377200760 2543 dbSNP
rs1397844554 2548 dbSNP
rs1181025704 2555 dbSNP
rs1471709831 2558 dbSNP
rs1028000913 2563 dbSNP
rs1288055507 2564 dbSNP
rs185903497 2568 dbSNP
rs1051900125 2573 dbSNP
rs892911454 2574 dbSNP
rs1267516427 2577 dbSNP
rs115173412 2581 dbSNP
rs181068507 2583 dbSNP
rs267598300 2596 dbSNP
rs942057490 2601 dbSNP
rs907082261 2602 dbSNP
rs565889045 2603 dbSNP
rs1243053161 2605 dbSNP
rs949393183 2612 dbSNP
rs1189670986 2617 dbSNP
rs1228078718 2618 dbSNP
rs1377508711 2619 dbSNP
rs916600153 2620 dbSNP
rs949461016 2623 dbSNP
rs1400232879 2625 dbSNP
rs917755833 2632 dbSNP
rs1417780685 2638 dbSNP
rs980019007 2642 dbSNP
rs1158341697 2643 dbSNP
rs1345539093 2645 dbSNP
rs1055150699 2650 dbSNP
rs1291394362 2653 dbSNP
rs931380602 2658 dbSNP
rs745982760 2659 dbSNP
rs1369800183 2661 dbSNP
rs1440933616 2673 dbSNP
rs1304977052 2676 dbSNP
rs1374105538 2679 dbSNP
rs1405875585 2681 dbSNP
rs760479030 2682 dbSNP
rs1285635159 2685 dbSNP
rs1319055508 2687 dbSNP
rs920040236 2697 dbSNP
rs1219830546 2711 dbSNP
rs973276858 2713 dbSNP
rs1365118534 2714 dbSNP
rs1469063568 2716 dbSNP
rs1317893964 2721 dbSNP
rs1195805798 2722 dbSNP
rs1236395129 2728 dbSNP
rs552362079 2731 dbSNP
rs190601783 2732 dbSNP
rs372518542 2733 dbSNP
rs937947226 2735 dbSNP
rs1162453447 2738 dbSNP
rs1393536451 2741 dbSNP
rs987083531 2749 dbSNP
rs1188983261 2751 dbSNP
rs1397475079 2755 dbSNP
rs1448734089 2756 dbSNP
rs979359959 2776 dbSNP
rs1376181591 2778 dbSNP
rs966802658 2780 dbSNP
rs1246141431 2784 dbSNP
rs1184815812 2790 dbSNP
rs1053592 2791 dbSNP
rs986964088 2792 dbSNP
rs765639327 2793 dbSNP
rs1256419743 2795 dbSNP
rs550274837 2796 dbSNP
rs1027927478 2797 dbSNP
rs1233333729 2802 dbSNP
rs989814758 2803 dbSNP
rs957111554 2804 dbSNP
rs1475442172 2805 dbSNP
rs900661238 2808 dbSNP
rs1016953372 2809 dbSNP
rs140796266 2810 dbSNP
rs999057428 2811 dbSNP
rs1446418677 2815 dbSNP
rs1006473046 2816 dbSNP
rs1229625788 2817 dbSNP
rs1235560805 2824 dbSNP
rs886471078 2829 dbSNP
rs1365048272 2831 dbSNP
rs1296092912 2832 dbSNP
rs561303441 2835 dbSNP
rs1387983826 2838 dbSNP
rs1215443121 2839 dbSNP
rs748371333 2839 dbSNP
rs907055042 2839 dbSNP
rs1024615961 2841 dbSNP
rs949472298 2844 dbSNP
rs1208613332 2845 dbSNP
rs1256747690 2846 dbSNP
rs1292581414 2846 dbSNP
rs1485853412 2846 dbSNP
rs1240198399 2850 dbSNP
rs372640674 2853 dbSNP
rs896549701 2853 dbSNP
rs1433776041 2860 dbSNP
rs1187002769 2873 dbSNP
rs1168176933 2874 dbSNP
rs375378782 2901 dbSNP
rs894434324 2908 dbSNP
rs185046566 2927 dbSNP
rs137903087 2929 dbSNP
rs898540864 2932 dbSNP
rs1388217798 2934 dbSNP
rs767513546 2937 dbSNP
rs1434973298 2940 dbSNP
rs1268061147 2943 dbSNP
rs940154921 2948 dbSNP
rs912717752 2951 dbSNP
rs1431718737 2954 dbSNP
rs987398801 2971 dbSNP
rs1272196582 2974 dbSNP
rs1342901208 2978 dbSNP
rs932902500 2980 dbSNP
rs181529902 2982 dbSNP
rs989741692 2994 dbSNP
rs1259359507 2996 dbSNP
rs1446261127 3005 dbSNP
rs957038970 3011 dbSNP
rs576217171 3013 dbSNP
rs913561676 3022 dbSNP
rs1243516927 3027 dbSNP
rs1451956135 3030 dbSNP
rs1192475950 3032 dbSNP
rs1031816276 3033 dbSNP
rs955122336 3042 dbSNP
rs1028107051 3048 dbSNP
rs1341955545 3054 dbSNP
rs1401674708 3069 dbSNP
rs1250116737 3075 dbSNP
rs975142947 3076 dbSNP
rs1236161056 3080 dbSNP
rs1375261910 3085 dbSNP
rs759144034 3092 dbSNP
rs776298097 3093 dbSNP
rs1351910467 3099 dbSNP
rs1304247731 3100 dbSNP
rs1016422721 3104 dbSNP
rs1006890166 3105 dbSNP
rs1258912938 3112 dbSNP
rs886653384 3117 dbSNP
rs188956475 3122 dbSNP
rs542750240 3124 dbSNP
rs1466850900 3125 dbSNP
rs1212761259 3126 dbSNP
rs1024137514 3129 dbSNP
rs1455235007 3131 dbSNP
rs1180225478 3132 dbSNP
rs1013510636 3136 dbSNP
rs1363760042 3136 dbSNP
rs1160669956 3137 dbSNP
rs746498116 3140 dbSNP
rs896476612 3141 dbSNP
rs573553986 3147 dbSNP
rs1396724324 3153 dbSNP
rs1055160422 3155 dbSNP
rs894360782 3156 dbSNP
rs184591693 3157 dbSNP
rs1175400284 3160 dbSNP
rs1289982433 3161 dbSNP
rs1332468816 3163 dbSNP
rs1043527951 3171 dbSNP
rs1469387687 3180 dbSNP
rs945305128 3191 dbSNP
rs1414438248 3193 dbSNP
rs1250361875 3196 dbSNP
rs1183236859 3201 dbSNP
rs1184649927 3203 dbSNP
rs995481978 3209 dbSNP
rs1475098138 3211 dbSNP
rs534945353 3214 dbSNP
rs1165874114 3217 dbSNP
rs898511256 3219 dbSNP
rs1460475109 3220 dbSNP
rs1297665158 3222 dbSNP
rs1397391241 3222 dbSNP
rs1482931977 3225 dbSNP
rs1037467568 3235 dbSNP
rs940101554 3236 dbSNP
rs933670774 3241 dbSNP
rs920930402 3242 dbSNP
rs1232488848 3243 dbSNP
rs1483836741 3250 dbSNP
rs1293457055 3253 dbSNP
rs775610937 3257 dbSNP
rs1221124395 3261 dbSNP
rs975197012 3262 dbSNP
rs1323161547 3272 dbSNP
rs1224863895 3280 dbSNP
rs962455790 3282 dbSNP
rs1339539856 3289 dbSNP
rs1207857055 3290 dbSNP
rs1256059463 3291 dbSNP
rs891245275 3295 dbSNP
rs1281511036 3301 dbSNP
rs1051266100 3302 dbSNP
rs1260121647 3305 dbSNP
rs1288576438 3307 dbSNP
rs1170063111 3309 dbSNP
rs1373697509 3313 dbSNP
rs1463615393 3314 dbSNP
rs1170374541 3321 dbSNP
rs1373563389 3323 dbSNP
rs605644 3332 dbSNP
rs1313250931 3342 dbSNP
rs1381161968 3356 dbSNP
rs921478341 3361 dbSNP
rs990381760 3364 dbSNP
rs866174501 3370 dbSNP
rs594844 3371 dbSNP
rs1026552301 3372 dbSNP
rs1013772405 3386 dbSNP
rs1301065751 3399 dbSNP
rs796138921 3400 dbSNP
rs1485126922 3401 dbSNP
rs1468285959 3404 dbSNP
rs1391013382 3405 dbSNP
rs960733410 3409 dbSNP
rs1033632383 3410 dbSNP
rs1191842660 3415 dbSNP
rs1394617784 3425 dbSNP
rs1472354540 3428 dbSNP
rs1002247817 3431 dbSNP
rs538834611 3433 dbSNP
rs1174236070 3440 dbSNP
rs1043965500 3441 dbSNP
rs977528046 3442 dbSNP
rs1190008148 3446 dbSNP
rs867795125 3447 dbSNP
rs971161378 3449 dbSNP
rs865918849 3450 dbSNP
rs1424803538 3453 dbSNP
rs916991955 3457 dbSNP
rs1009432276 3461 dbSNP
rs991288762 3462 dbSNP
rs1436898766 3463 dbSNP
rs958542581 3466 dbSNP
rs1300617715 3471 dbSNP
rs1369657311 3472 dbSNP
rs1256044263 3481 dbSNP
rs1304083573 3483 dbSNP
rs778681053 3490 dbSNP
rs1215530952 3495 dbSNP
rs1466639626 3497 dbSNP
rs192829548 3498 dbSNP
rs1268139893 3513 dbSNP
rs1261472607 3519 dbSNP
rs1051050520 3521 dbSNP
rs1207576954 3522 dbSNP
rs1252422075 3531 dbSNP
rs1454779030 3534 dbSNP
rs1348046981 3537 dbSNP
rs6701589 3539 dbSNP
rs1417024046 3544 dbSNP
rs1427185361 3544 dbSNP
rs1158081450 3548 dbSNP
rs1345634587 3552 dbSNP
rs549995601 3558 dbSNP
rs920936715 3566 dbSNP
rs187985541 3567 dbSNP
rs1312824507 3568 dbSNP
rs573577806 3570 dbSNP
rs184449632 3571 dbSNP
rs1371829345 3576 dbSNP
rs150568091 3579 dbSNP
rs10646470 3583 dbSNP
rs201411638 3583 dbSNP
rs376482928 3583 dbSNP
rs55954923 3583 dbSNP
rs66489112 3583 dbSNP
rs1365860252 3584 dbSNP
rs1468917776 3585 dbSNP
rs200666197 3586 dbSNP
rs868563065 3589 dbSNP
rs1231305803 3590 dbSNP
rs56245295 3590 dbSNP
rs1491077474 3591 dbSNP
rs1176589059 3592 dbSNP
rs12119403 3592 dbSNP
rs571584368 3592 dbSNP
rs58963069 3592 dbSNP
rs1335709377 3593 dbSNP
rs1230307697 3597 dbSNP
rs1051132715 3598 dbSNP
rs11400295 3598 dbSNP
rs1270927021 3598 dbSNP
rs71703231 3598 dbSNP
rs1185553616 3599 dbSNP
rs909603255 3599 dbSNP
rs373920740 3600 dbSNP
rs1164677776 3606 dbSNP
rs1416746228 3615 dbSNP
rs950937508 3618 dbSNP
rs900027733 3621 dbSNP
rs1372960130 3627 dbSNP
rs116998259 3634 dbSNP
rs936241312 3636 dbSNP
rs1458725813 3642 dbSNP
rs1368324187 3644 dbSNP
rs924898474 3645 dbSNP
rs992404811 3647 dbSNP
rs1268657179 3649 dbSNP
rs960905847 3653 dbSNP
rs1215249138 3663 dbSNP
rs746098271 3694 dbSNP
rs1275200381 3697 dbSNP
rs1033659819 3698 dbSNP
rs949762552 3704 dbSNP
rs1208725587 3705 dbSNP
rs1279303394 3707 dbSNP
rs1189135635 3712 dbSNP
rs781450871 3712 dbSNP
rs759793645 3717 dbSNP
rs555811526 3721 dbSNP
rs561689769 3726 dbSNP
rs1188625114 3738 dbSNP
rs958468861 3740 dbSNP
rs1444829463 3752 dbSNP
rs920413347 3756 dbSNP
rs757319086 3757 dbSNP
rs973267756 3759 dbSNP
rs751652443 3761 dbSNP
rs764755069 3768 dbSNP
rs751179054 3770 dbSNP
rs1355212784 3777 dbSNP
rs545322521 3778 dbSNP
rs961984133 3780 dbSNP
rs1230366422 3783 dbSNP
rs192466729 3785 dbSNP
rs1296842985 3786 dbSNP
rs998107351 3788 dbSNP
rs146839536 3789 dbSNP
rs955569877 3790 dbSNP
rs1325771374 3791 dbSNP
rs1281957733 3794 dbSNP
rs1446061755 3802 dbSNP
rs149829747 3804 dbSNP
rs573411138 3809 dbSNP
rs941066834 3810 dbSNP
rs1193513567 3812 dbSNP
rs553317327 3817 dbSNP
rs538063712 3821 dbSNP
rs1162010838 3836 dbSNP
rs996866752 3840 dbSNP
rs1391300782 3845 dbSNP
rs1407799563 3851 dbSNP
rs539862366 3852 dbSNP
rs1474137786 3853 dbSNP
rs572555832 3854 dbSNP
rs1331593886 3857 dbSNP
rs1235409599 3864 dbSNP
rs992262738 3866 dbSNP
rs1000776142 3868 dbSNP
rs577245930 3869 dbSNP
rs1269661008 3870 dbSNP
rs903402960 3873 dbSNP
rs1042376257 3874 dbSNP
rs78349248 3877 dbSNP
rs776663514 3879 dbSNP
rs1212539043 3884 dbSNP
rs949725687 3887 dbSNP
rs916883533 3889 dbSNP
rs1363566429 3890 dbSNP
rs558806579 3891 dbSNP
rs1473138201 3892 dbSNP
rs1161598024 3894 dbSNP
rs1415970656 3901 dbSNP
rs981411807 3915 dbSNP
rs1266371396 3916 dbSNP
rs937065828 3919 dbSNP
rs1163901857 3924 dbSNP
rs1206994661 3933 dbSNP
rs1388423418 3940 dbSNP
rs1326796663 3942 dbSNP
rs968113392 3943 dbSNP
rs1410211898 3945 dbSNP
rs539357489 3957 dbSNP
rs1289772569 3961 dbSNP
rs1332204118 3962 dbSNP
rs920382138 3972 dbSNP
rs1243701792 3977 dbSNP
rs1483290787 3978 dbSNP
rs1265484477 3982 dbSNP
rs201702599 3994 dbSNP
rs973193794 3994 dbSNP
rs1250479417 3996 dbSNP
rs1483549799 3998 dbSNP
rs592189 4001 dbSNP
rs956738926 4006 dbSNP
rs10557370 4008 dbSNP
rs796482411 4008 dbSNP
rs1347046095 4010 dbSNP
rs997992681 4016 dbSNP
rs899655841 4020 dbSNP
rs1166015651 4025 dbSNP
rs907754823 4028 dbSNP
rs1369887027 4035 dbSNP
rs987811104 4038 dbSNP
rs954672570 4039 dbSNP
rs1353372861 4040 dbSNP
rs1395069003 4054 dbSNP
rs556717618 4062 dbSNP
rs1313021637 4064 dbSNP
rs1341700420 4064 dbSNP
rs1224620441 4071 dbSNP
rs1273355995 4072 dbSNP
rs1301574091 4073 dbSNP
rs1207966969 4077 dbSNP
rs1278598946 4081 dbSNP
rs536316985 4086 dbSNP
rs975416030 4097 dbSNP
rs1047135802 4100 dbSNP
rs567786210 4101 dbSNP
rs1258535915 4116 dbSNP
rs1426749803 4118 dbSNP
rs1192547982 4119 dbSNP
rs964060230 4120 dbSNP
rs1390938940 4126 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BT474
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1395167. RNA binding protein: AGO. Condition:BT474 AGO HITS-CLIP Replicate 2 ...

- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||:||| |   :|||||| 
Target 5' aucACGCCACU---GCACUCCa 3'
17 - 35
Article - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al.
- Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
CLIP-seq Support 1 for dataset GSM1395167
Method / RBP HITS-CLIP / AGO
Cell line / Condition BT474 / BT474 AGO HITS-CLIP Replicate 2
Location of target site ENST00000367311.3 | 3UTR | CUUGCAGUGAGCCGAGAUCACGCCACUGCACUCCAGCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24906430 / GSE57855
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1