Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT607490 [miRNA, hsa-miR-122-5p :: HEBP2, target gene]
miRTarBase - #MIRT607490 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HEBP2   
Synonyms C6ORF34B, C6orf34, PP23, SOUL
Description heme binding protein 2
Transcript NM_014320   
Expression
Putative miRNA Targets on HEBP2
3'UTR of HEBP2
(miRNA target sites are highlighted)
>HEBP2|NM_014320|3'UTR
   1 GAAAAATGAAAGGAAGTTCTGCTGTCAGAGGCAAAACATCTGTTTATCATAGACATCAACATGACCTATAAGTAAAGTGC
  81 GTGTCTAGTGTCTTCTATTGAGAGTACTACTATTAATTAAGCTTATTTCCAATGTGCCTTTTTAATGCTTGAAGTTTTAT
 161 CTACATACACAGGTAACAGAGGACAGTAGTCTGTAAACATATAAATCGGTCATAACTATCGTGGTCTTTATTTCTGTGAG
 241 GATCTAGGGAAATTTCATGTCACTTCCCTCCTTCACTGCATCACAATCATATTCCCTTTTTTTTTTCTTGGATTTGTGTC
 321 AGTTGGATGATATCCCCTCCAGATAGTATCAATAAAATGTTAAAATT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :||:||   |||:|:||| 
Target 5' actGCATCACAATCATATTCCc 3'
275 - 296 131.00 -14.80
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||: :|| |||  ||||:| 
Target 5' gaAATTTCA-TGT--CACTTCc 3'
249 - 267 114.00 -15.10
3
miRNA  3' guuUGUGGU-AAC--AGUGUGAGGu 5'
             ::::|| |||  | |:|: || 
Target 5' tttGTGTCAGTTGGATGATATCCCc 3'
313 - 337 89.00 -6.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN17037456 20 COSMIC
COSN30170869 23 COSMIC
COSN26978588 29 COSMIC
COSN30170872 32 COSMIC
COSN28887884 81 COSMIC
COSN30521321 101 COSMIC
COSN22263047 110 COSMIC
COSN17037457 111 COSMIC
COSN5083984 244 COSMIC
COSN29005941 307 COSMIC
COSN28479138 851 COSMIC
COSN26390477 982 COSMIC
COSN26390478 984 COSMIC
COSN16582929 1314 COSMIC
COSN22890774 1417 COSMIC
COSN8398787 1490 COSMIC
COSN26833698 1659 COSMIC
COSN20434075 1703 COSMIC
COSN7691164 1901 COSMIC
COSN5622226 2018 COSMIC
COSN21575650 2223 COSMIC
COSN27925704 2242 COSMIC
COSN23829743 2534 COSMIC
COSN6305422 2621 COSMIC
COSN21474879 2734 COSMIC
COSN21252182 2913 COSMIC
COSN24434159 3002 COSMIC
COSN22397853 3215 COSMIC
COSN7784721 3606 COSMIC
COSN16434061 3745 COSMIC
COSN21083315 3899 COSMIC
COSN7691165 3903 COSMIC
COSN6305423 4203 COSMIC
COSN6305424 4475 COSMIC
COSN20829007 4533 COSMIC
COSN29812448 5068 COSMIC
COSN21985526 5461 COSMIC
COSN30222888 5522 COSMIC
COSN28418524 5757 COSMIC
COSN5622227 5972 COSMIC
COSN2143643 6236 COSMIC
COSN9494087 6328 COSMIC
COSN23551127 6441 COSMIC
COSN6305425 6481 COSMIC
COSN19481795 6570 COSMIC
COSN16378827 6587 COSMIC
COSN7784722 6688 COSMIC
COSN21495631 6728 COSMIC
COSN24133520 6814 COSMIC
COSN29221114 6973 COSMIC
COSN29963038 7107 COSMIC
COSN29852477 7260 COSMIC
COSN5622228 7820 COSMIC
COSN27161553 8226 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1053656 1 dbSNP
rs961134598 2 dbSNP
rs1259438398 7 dbSNP
rs766223284 8 dbSNP
rs751476963 17 dbSNP
rs1245128049 25 dbSNP
rs754979590 28 dbSNP
rs1162997008 29 dbSNP
rs781084643 31 dbSNP
rs45459099 36 dbSNP
rs1157296066 41 dbSNP
rs755690321 44 dbSNP
rs777528561 46 dbSNP
rs1299175669 49 dbSNP
rs748731164 50 dbSNP
rs770538268 51 dbSNP
rs1310349062 67 dbSNP
rs113558171 68 dbSNP
rs1428246410 73 dbSNP
rs1389919507 75 dbSNP
rs370272516 81 dbSNP
rs939028270 82 dbSNP
rs1003846018 86 dbSNP
rs1489334437 91 dbSNP
rs13778 98 dbSNP
rs1262708758 101 dbSNP
rs1438398997 101 dbSNP
rs376357189 105 dbSNP
rs75124161 108 dbSNP
rs1481975889 110 dbSNP
rs1273650304 118 dbSNP
rs1228592313 133 dbSNP
rs1358045705 134 dbSNP
rs1195963668 138 dbSNP
rs1243475580 146 dbSNP
rs762858858 154 dbSNP
rs534668911 162 dbSNP
rs182018516 164 dbSNP
rs1043888483 174 dbSNP
rs1304115768 175 dbSNP
rs1405295733 184 dbSNP
rs1005666848 185 dbSNP
rs1352037932 194 dbSNP
rs577826327 198 dbSNP
rs1388849808 200 dbSNP
rs1053657 208 dbSNP
rs1303418031 209 dbSNP
rs961421459 210 dbSNP
rs999575611 211 dbSNP
rs922850156 212 dbSNP
rs1279551593 214 dbSNP
rs563547137 216 dbSNP
rs1361970840 221 dbSNP
rs954314493 222 dbSNP
rs1287637490 255 dbSNP
rs985616177 256 dbSNP
rs1287330051 258 dbSNP
rs1323326111 258 dbSNP
rs1040454335 264 dbSNP
rs1329289730 265 dbSNP
rs901882171 267 dbSNP
rs144698153 268 dbSNP
rs1289673090 271 dbSNP
rs758904455 284 dbSNP
rs147885518 290 dbSNP
rs62432497 295 dbSNP
rs1329658588 297 dbSNP
rs1439085140 297 dbSNP
rs923573623 297 dbSNP
rs939039862 298 dbSNP
rs1056272495 303 dbSNP
rs1028688888 304 dbSNP
rs1218986625 308 dbSNP
rs1242787011 311 dbSNP
rs1472500818 312 dbSNP
rs1180691280 313 dbSNP
rs1191654623 315 dbSNP
rs1416548039 317 dbSNP
rs1445666002 319 dbSNP
rs1244733283 321 dbSNP
rs1158438946 332 dbSNP
rs1197807747 337 dbSNP
rs1465056592 345 dbSNP
rs1269561672 350 dbSNP
rs953958030 357 dbSNP
rs1012154189 361 dbSNP
rs769183849 370 dbSNP
rs1221409722 374 dbSNP
rs566014852 385 dbSNP
rs1343400175 386 dbSNP
rs549925972 387 dbSNP
rs1345341093 390 dbSNP
rs767070186 404 dbSNP
rs752350048 405 dbSNP
rs1318741606 408 dbSNP
rs1016785482 421 dbSNP
rs961191064 424 dbSNP
rs755861055 426 dbSNP
rs1176757318 436 dbSNP
rs779388027 445 dbSNP
rs1034756220 455 dbSNP
rs1262875387 456 dbSNP
rs960680344 457 dbSNP
rs1449775856 461 dbSNP
rs1006027304 468 dbSNP
rs1186221863 476 dbSNP
rs1464085327 484 dbSNP
rs76714857 487 dbSNP
rs1415972413 494 dbSNP
rs140440833 500 dbSNP
rs1278458883 502 dbSNP
rs1229647273 510 dbSNP
rs551363211 511 dbSNP
rs897106762 520 dbSNP
rs998183209 531 dbSNP
rs946971064 533 dbSNP
rs1380064457 545 dbSNP
rs1304645915 555 dbSNP
rs979623162 573 dbSNP
rs758958865 582 dbSNP
rs187270102 583 dbSNP
rs1208078748 601 dbSNP
rs1239229121 610 dbSNP
rs1166368240 613 dbSNP
rs1040884927 614 dbSNP
rs985733617 615 dbSNP
rs1022862379 616 dbSNP
rs1481968189 619 dbSNP
rs968257481 624 dbSNP
rs978211624 628 dbSNP
rs901916007 637 dbSNP
rs150494942 638 dbSNP
rs1050469010 653 dbSNP
rs939137609 662 dbSNP
rs1178509923 664 dbSNP
rs991778708 668 dbSNP
rs145380714 672 dbSNP
rs1226712066 675 dbSNP
rs1378918848 686 dbSNP
rs1292646615 687 dbSNP
rs1410321767 688 dbSNP
rs887738352 693 dbSNP
rs570264774 696 dbSNP
rs1016857665 720 dbSNP
rs1305975087 722 dbSNP
rs916279023 728 dbSNP
rs1166411912 739 dbSNP
rs947957983 739 dbSNP
rs1421598463 740 dbSNP
rs1159981273 745 dbSNP
rs1183619764 759 dbSNP
rs897012879 761 dbSNP
rs1473850284 766 dbSNP
rs1408237965 769 dbSNP
rs144585017 771 dbSNP
rs1488987625 772 dbSNP
rs1267478419 781 dbSNP
rs887580037 786 dbSNP
rs940536346 788 dbSNP
rs1230245608 791 dbSNP
rs1352264814 796 dbSNP
rs1286341607 800 dbSNP
rs1036643470 801 dbSNP
rs994001264 809 dbSNP
rs1407568060 816 dbSNP
rs1035236132 824 dbSNP
rs960503973 833 dbSNP
rs566170949 843 dbSNP
rs990934316 851 dbSNP
rs1023306010 852 dbSNP
rs1159274945 858 dbSNP
rs1330577722 859 dbSNP
rs1410438147 863 dbSNP
rs189372305 868 dbSNP
rs1374468639 870 dbSNP
rs549085183 872 dbSNP
rs149193321 878 dbSNP
rs546680857 881 dbSNP
rs60956469 895 dbSNP
rs924179247 899 dbSNP
rs557681763 909 dbSNP
rs1344605708 912 dbSNP
rs781352545 914 dbSNP
rs1327107122 917 dbSNP
rs1266217337 928 dbSNP
rs976291252 937 dbSNP
rs1022551739 938 dbSNP
rs1303119657 941 dbSNP
rs1384805507 942 dbSNP
rs923411524 943 dbSNP
rs1280847294 958 dbSNP
rs113110343 964 dbSNP
rs1050907372 976 dbSNP
rs180693569 977 dbSNP
rs1320760671 980 dbSNP
rs537394107 981 dbSNP
rs770053121 987 dbSNP
rs556963755 997 dbSNP
rs1385776088 1001 dbSNP
rs978282963 1007 dbSNP
rs374485937 1010 dbSNP
rs1379786800 1011 dbSNP
rs1277468530 1013 dbSNP
rs1174410254 1017 dbSNP
rs1459409775 1018 dbSNP
rs573810925 1020 dbSNP
rs1190735010 1022 dbSNP
rs1261127532 1026 dbSNP
rs991895770 1026 dbSNP
rs1204546498 1027 dbSNP
rs1246451544 1033 dbSNP
rs542816792 1035 dbSNP
rs1231847630 1042 dbSNP
rs1346817357 1048 dbSNP
rs1297942117 1049 dbSNP
rs1170384798 1050 dbSNP
rs916225267 1051 dbSNP
rs947738728 1053 dbSNP
rs994465584 1055 dbSNP
rs1034861071 1061 dbSNP
rs9484159 1063 dbSNP
rs1434543430 1066 dbSNP
rs1391139996 1084 dbSNP
rs1447874543 1091 dbSNP
rs185082277 1091 dbSNP
rs1393013812 1104 dbSNP
rs1023341154 1107 dbSNP
rs967712878 1108 dbSNP
rs940635401 1109 dbSNP
rs190085675 1117 dbSNP
rs1000475861 1118 dbSNP
rs765377026 1121 dbSNP
rs1208610017 1132 dbSNP
rs1330242562 1133 dbSNP
rs1275078583 1134 dbSNP
rs1206921173 1136 dbSNP
rs1030597241 1137 dbSNP
rs1269190121 1147 dbSNP
rs117323813 1149 dbSNP
rs1341723455 1162 dbSNP
rs901695657 1164 dbSNP
rs530409366 1165 dbSNP
rs544122689 1166 dbSNP
rs1371623721 1170 dbSNP
rs138948148 1171 dbSNP
rs923472451 1178 dbSNP
rs953668920 1179 dbSNP
rs118175368 1184 dbSNP
rs549124001 1185 dbSNP
rs575584704 1186 dbSNP
rs1196820700 1187 dbSNP
rs1252373251 1189 dbSNP
rs9321658 1195 dbSNP
rs1450222222 1198 dbSNP
rs904098305 1200 dbSNP
rs942063026 1201 dbSNP
rs1036381099 1202 dbSNP
rs1270716183 1202 dbSNP
rs1232091671 1203 dbSNP
rs61421233 1207 dbSNP
rs1290712128 1242 dbSNP
rs78332214 1244 dbSNP
rs1335524506 1246 dbSNP
rs1324500309 1249 dbSNP
rs1407287081 1251 dbSNP
rs1388735210 1252 dbSNP
rs1056774789 1259 dbSNP
rs896361534 1260 dbSNP
rs370680640 1270 dbSNP
rs796599062 1272 dbSNP
rs111548564 1273 dbSNP
rs1199201201 1275 dbSNP
rs903627411 1276 dbSNP
rs1403363026 1278 dbSNP
rs1000548918 1284 dbSNP
rs1452987606 1298 dbSNP
rs1030628358 1302 dbSNP
rs75513300 1303 dbSNP
rs1329180746 1307 dbSNP
rs73570989 1307 dbSNP
rs1030982711 1312 dbSNP
rs923070474 1316 dbSNP
rs1276392004 1319 dbSNP
rs553021158 1323 dbSNP
rs933147985 1330 dbSNP
rs1438975567 1331 dbSNP
rs1369053439 1334 dbSNP
rs9484160 1335 dbSNP
rs1325422893 1352 dbSNP
rs986310129 1355 dbSNP
rs1328216538 1370 dbSNP
rs536461825 1382 dbSNP
rs763896681 1385 dbSNP
rs1390890948 1393 dbSNP
rs73570991 1394 dbSNP
rs573063990 1402 dbSNP
rs942796510 1405 dbSNP
rs76617255 1411 dbSNP
rs1172952240 1425 dbSNP
rs145338405 1428 dbSNP
rs527863783 1431 dbSNP
rs919296887 1434 dbSNP
rs938680997 1435 dbSNP
rs183425412 1446 dbSNP
rs1446940064 1447 dbSNP
rs540894783 1476 dbSNP
rs34488286 1477 dbSNP
rs1260490115 1478 dbSNP
rs750812347 1485 dbSNP
rs947968980 1489 dbSNP
rs1044895254 1490 dbSNP
rs1471742284 1491 dbSNP
rs1006405171 1496 dbSNP
rs1365893496 1498 dbSNP
rs1287206973 1504 dbSNP
rs1419344942 1507 dbSNP
rs1296565563 1513 dbSNP
rs766775966 1514 dbSNP
rs9484161 1516 dbSNP
rs374019399 1517 dbSNP
rs1334685367 1528 dbSNP
rs186684591 1529 dbSNP
rs1373360471 1531 dbSNP
rs1172699577 1532 dbSNP
rs1339245981 1532 dbSNP
rs781229539 1534 dbSNP
rs985954625 1535 dbSNP
rs1353363724 1540 dbSNP
rs1474770438 1548 dbSNP
rs997578744 1549 dbSNP
rs1029967725 1550 dbSNP
rs1486592674 1553 dbSNP
rs1484935244 1558 dbSNP
rs942782263 1570 dbSNP
rs1205233114 1571 dbSNP
rs889383991 1573 dbSNP
rs1344589319 1576 dbSNP
rs1007773682 1581 dbSNP
rs1293652780 1583 dbSNP
rs1214085412 1584 dbSNP
rs1016447630 1591 dbSNP
rs1440634957 1593 dbSNP
rs368605390 1601 dbSNP
rs1416539618 1603 dbSNP
rs56866576 1611 dbSNP
rs370346764 1615 dbSNP
rs191989189 1616 dbSNP
rs1430089833 1621 dbSNP
rs1052599949 1642 dbSNP
rs1385698128 1643 dbSNP
rs1167816075 1645 dbSNP
rs1408907443 1650 dbSNP
rs748289045 1660 dbSNP
rs559563227 1665 dbSNP
rs528648809 1669 dbSNP
rs949664762 1672 dbSNP
rs551881548 1676 dbSNP
rs1474522897 1677 dbSNP
rs1157123681 1679 dbSNP
rs1365734423 1682 dbSNP
rs960099622 1683 dbSNP
rs73570992 1688 dbSNP
rs1183395423 1689 dbSNP
rs141605270 1703 dbSNP
rs947976241 1708 dbSNP
rs980623028 1709 dbSNP
rs1478863023 1710 dbSNP
rs116073029 1721 dbSNP
rs756327712 1731 dbSNP
rs1322472913 1740 dbSNP
rs1292097436 1741 dbSNP
rs549137929 1744 dbSNP
rs567571540 1753 dbSNP
rs1231468465 1755 dbSNP
rs1353485489 1761 dbSNP
rs936506204 1762 dbSNP
rs1292551682 1766 dbSNP
rs1052163707 1769 dbSNP
rs892223655 1770 dbSNP
rs536597585 1771 dbSNP
rs1376683801 1776 dbSNP
rs933060328 1784 dbSNP
rs116344492 1785 dbSNP
rs1030036719 1787 dbSNP
rs888752223 1791 dbSNP
rs1007845739 1794 dbSNP
rs954596786 1795 dbSNP
rs1016521141 1796 dbSNP
rs899357423 1798 dbSNP
rs1017426105 1806 dbSNP
rs1254917846 1820 dbSNP
rs1160526714 1822 dbSNP
rs79697354 1822 dbSNP
rs1421289558 1829 dbSNP
rs1026455275 1831 dbSNP
rs925364370 1835 dbSNP
rs1488936942 1839 dbSNP
rs1248601905 1840 dbSNP
rs1211933262 1842 dbSNP
rs375121208 1843 dbSNP
rs1272519887 1846 dbSNP
rs1228929664 1847 dbSNP
rs1318566514 1850 dbSNP
rs566701324 1851 dbSNP
rs183527227 1852 dbSNP
rs988086751 1856 dbSNP
rs1029011059 1859 dbSNP
rs150591777 1861 dbSNP
rs1175552528 1874 dbSNP
rs1321882190 1875 dbSNP
rs1455791877 1880 dbSNP
rs1376049388 1886 dbSNP
rs1470980149 1894 dbSNP
rs1158841168 1895 dbSNP
rs575207393 1901 dbSNP
rs1397138202 1902 dbSNP
rs1163021068 1906 dbSNP
rs1191956962 1907 dbSNP
rs1468120898 1925 dbSNP
rs905325173 1926 dbSNP
rs559489333 1927 dbSNP
rs1486811665 1930 dbSNP
rs1258856340 1931 dbSNP
rs1177854120 1932 dbSNP
rs1400246341 1935 dbSNP
rs1464488704 1936 dbSNP
rs187725877 1937 dbSNP
rs1312534501 1938 dbSNP
rs1300270157 1941 dbSNP
rs1305232195 1945 dbSNP
rs1231617214 1946 dbSNP
rs1369682251 1947 dbSNP
rs988396942 1952 dbSNP
rs770584853 1954 dbSNP
rs913696061 1955 dbSNP
rs933071341 1956 dbSNP
rs117736899 1964 dbSNP
rs1383346684 1970 dbSNP
rs1391675815 1973 dbSNP
rs1288743358 1975 dbSNP
rs1466916269 1975 dbSNP
rs35010997 1975 dbSNP
rs370167513 1975 dbSNP
rs375019520 1975 dbSNP
rs138626519 1976 dbSNP
rs1458544357 1977 dbSNP
rs1343138373 1989 dbSNP
rs745759812 1992 dbSNP
rs1037989918 1995 dbSNP
rs890145495 2000 dbSNP
rs899431147 2004 dbSNP
rs1263162498 2005 dbSNP
rs1317252231 2008 dbSNP
rs1007455151 2009 dbSNP
rs149303678 2020 dbSNP
rs1282178589 2031 dbSNP
rs745419805 2035 dbSNP
rs895951417 2043 dbSNP
rs771677307 2050 dbSNP
rs1228998463 2051 dbSNP
rs1023046218 2054 dbSNP
rs1295545723 2060 dbSNP
rs979001420 2068 dbSNP
rs1397115178 2073 dbSNP
rs1357854058 2078 dbSNP
rs76135222 2081 dbSNP
rs139647356 2082 dbSNP
rs1371431304 2100 dbSNP
rs1169850989 2123 dbSNP
rs1460565051 2135 dbSNP
rs1481515823 2139 dbSNP
rs1372576330 2142 dbSNP
rs563433884 2150 dbSNP
rs1475501345 2164 dbSNP
rs1259441247 2171 dbSNP
rs988201481 2174 dbSNP
rs1422927091 2177 dbSNP
rs1485194380 2178 dbSNP
rs917886755 2182 dbSNP
rs949394239 2192 dbSNP
rs1336956799 2193 dbSNP
rs1032951841 2194 dbSNP
rs926865916 2195 dbSNP
rs942331498 2196 dbSNP
rs1291923778 2197 dbSNP
rs957950160 2200 dbSNP
rs988039688 2201 dbSNP
rs913757839 2206 dbSNP
rs1331211256 2212 dbSNP
rs1389878376 2213 dbSNP
rs1395964900 2216 dbSNP
rs1363353599 2229 dbSNP
rs954563895 2231 dbSNP
rs1406352196 2233 dbSNP
rs987647678 2234 dbSNP
rs929017674 2238 dbSNP
rs192531647 2240 dbSNP
rs144762230 2242 dbSNP
rs1037391049 2245 dbSNP
rs920221700 2253 dbSNP
rs929556071 2261 dbSNP
rs1213795027 2266 dbSNP
rs1469400986 2273 dbSNP
rs1047968661 2276 dbSNP
rs1220587637 2279 dbSNP
rs1000138453 2281 dbSNP
rs1289278565 2288 dbSNP
rs532592832 2289 dbSNP
rs896011604 2292 dbSNP
rs760327618 2294 dbSNP
rs1326766024 2305 dbSNP
rs182290145 2308 dbSNP
rs1223430989 2320 dbSNP
rs1262642735 2325 dbSNP
rs1392336544 2333 dbSNP
rs955909598 2338 dbSNP
rs1460844945 2339 dbSNP
rs1009571916 2348 dbSNP
rs530093613 2349 dbSNP
rs1014406134 2350 dbSNP
rs1468365069 2352 dbSNP
rs1044929280 2355 dbSNP
rs1455249153 2359 dbSNP
rs776130325 2359 dbSNP
rs1420817114 2360 dbSNP
rs980730895 2362 dbSNP
rs1423691554 2363 dbSNP
rs546938002 2369 dbSNP
rs776361604 2370 dbSNP
rs1387396199 2371 dbSNP
rs1032981142 2379 dbSNP
rs1304496854 2383 dbSNP
rs566738408 2389 dbSNP
rs963946826 2391 dbSNP
rs973698757 2393 dbSNP
rs1302781649 2397 dbSNP
rs919392319 2405 dbSNP
rs929469751 2406 dbSNP
rs956030913 2407 dbSNP
rs1398775779 2417 dbSNP
rs1383972429 2424 dbSNP
rs761547240 2428 dbSNP
rs1359414596 2436 dbSNP
rs1392807542 2441 dbSNP
rs1192497143 2448 dbSNP
rs147482383 2455 dbSNP
rs552036527 2459 dbSNP
rs752007933 2460 dbSNP
rs1281476339 2465 dbSNP
rs1362616549 2475 dbSNP
rs1213391720 2476 dbSNP
rs569027756 2491 dbSNP
rs560946900 2493 dbSNP
rs1039089198 2495 dbSNP
rs904204723 2502 dbSNP
rs1000490871 2510 dbSNP
rs1053049435 2510 dbSNP
rs1361313905 2511 dbSNP
rs1247079625 2512 dbSNP
rs891590920 2519 dbSNP
rs755428951 2523 dbSNP
rs1174884075 2524 dbSNP
rs1410079956 2529 dbSNP
rs1421021683 2555 dbSNP
rs1166720355 2556 dbSNP
rs1475381263 2557 dbSNP
rs148508290 2562 dbSNP
rs964461660 2564 dbSNP
rs973117103 2565 dbSNP
rs1002316482 2576 dbSNP
rs768083614 2577 dbSNP
rs1205482497 2582 dbSNP
rs1309402630 2582 dbSNP
rs554230853 2583 dbSNP
rs753210197 2588 dbSNP
rs376251970 2590 dbSNP
rs1293775252 2602 dbSNP
rs1034073640 2614 dbSNP
rs1353292991 2622 dbSNP
rs1182217156 2628 dbSNP
rs138105361 2633 dbSNP
rs533518914 2637 dbSNP
rs1167708327 2653 dbSNP
rs1464606938 2660 dbSNP
rs1163870247 2682 dbSNP
rs1406825205 2685 dbSNP
rs73570993 2687 dbSNP
rs1160668466 2694 dbSNP
rs919520961 2705 dbSNP
rs1345210989 2708 dbSNP
rs1474470298 2714 dbSNP
rs950324310 2720 dbSNP
rs1044544919 2732 dbSNP
rs1481746412 2734 dbSNP
rs1451898702 2740 dbSNP
rs1203938714 2746 dbSNP
rs906005817 2749 dbSNP
rs1273775333 2760 dbSNP
rs1235051583 2761 dbSNP
rs936120568 2767 dbSNP
rs950985544 2774 dbSNP
rs1054465486 2775 dbSNP
rs1453074840 2776 dbSNP
rs987632051 2777 dbSNP
rs79069424 2782 dbSNP
rs1010222356 2783 dbSNP
rs1030050154 2784 dbSNP
rs1225612328 2794 dbSNP
rs1285061789 2796 dbSNP
rs1311661033 2801 dbSNP
rs1328588817 2801 dbSNP
rs1460354539 2804 dbSNP
rs890398909 2806 dbSNP
rs1349747555 2808 dbSNP
rs545587466 2813 dbSNP
rs943074208 2824 dbSNP
rs558932917 2825 dbSNP
rs1462081803 2826 dbSNP
rs1178447005 2835 dbSNP
rs964533349 2845 dbSNP
rs1231469218 2848 dbSNP
rs1468294014 2849 dbSNP
rs1178567384 2853 dbSNP
rs186953770 2857 dbSNP
rs1264752837 2878 dbSNP
rs1216298736 2882 dbSNP
rs1318474612 2889 dbSNP
rs777852609 2891 dbSNP
rs1174251672 2895 dbSNP
rs1238960246 2898 dbSNP
rs1408236554 2899 dbSNP
rs1305002200 2900 dbSNP
rs935680973 2906 dbSNP
rs142751674 2908 dbSNP
rs753969644 2909 dbSNP
rs1053235324 2911 dbSNP
rs1289936940 2912 dbSNP
rs1470216095 2912 dbSNP
rs1327939918 2920 dbSNP
rs1333704068 2925 dbSNP
rs757540823 2926 dbSNP
rs1280353826 2928 dbSNP
rs1367045574 2929 dbSNP
rs1221737683 2937 dbSNP
rs1435585868 2941 dbSNP
rs1397048239 2944 dbSNP
rs1191861225 2947 dbSNP
rs891705542 2949 dbSNP
rs1265042895 2952 dbSNP
rs983155847 2954 dbSNP
rs151119978 2955 dbSNP
rs1486758511 2957 dbSNP
rs1198507688 2964 dbSNP
rs1271398980 2966 dbSNP
rs1045523410 2969 dbSNP
rs141081675 2980 dbSNP
rs540589017 2982 dbSNP
rs1206235232 2989 dbSNP
rs927503500 3000 dbSNP
rs1329967799 3001 dbSNP
rs1033778471 3012 dbSNP
rs936151805 3014 dbSNP
rs552591599 3016 dbSNP
rs769151479 3017 dbSNP
rs1297978605 3019 dbSNP
rs560465732 3021 dbSNP
rs1415737667 3024 dbSNP
rs1377523994 3026 dbSNP
rs371812267 3030 dbSNP
rs1373704561 3031 dbSNP
rs1172550210 3033 dbSNP
rs994846931 3039 dbSNP
rs778549005 3040 dbSNP
rs532347908 3045 dbSNP
rs950933833 3047 dbSNP
rs1485865533 3050 dbSNP
rs1259227505 3062 dbSNP
rs1198364909 3065 dbSNP
rs1054496600 3078 dbSNP
rs1343738850 3082 dbSNP
rs891889777 3085 dbSNP
rs1251392104 3087 dbSNP
rs1480728358 3092 dbSNP
rs946101019 3099 dbSNP
rs1228887324 3101 dbSNP
rs987738387 3105 dbSNP
rs1167242261 3106 dbSNP
rs1415834982 3107 dbSNP
rs1394153098 3108 dbSNP
rs1051105633 3113 dbSNP
rs1311356007 3114 dbSNP
rs59826401 3116 dbSNP
rs974857435 3117 dbSNP
rs1300004640 3121 dbSNP
rs1460490268 3124 dbSNP
rs1008854930 3128 dbSNP
rs1017530786 3132 dbSNP
rs1169840035 3133 dbSNP
rs568993302 3137 dbSNP
rs988481162 3143 dbSNP
rs1185064878 3144 dbSNP
rs1441487900 3148 dbSNP
rs1250741799 3151 dbSNP
rs1346216751 3156 dbSNP
rs531514367 3157 dbSNP
rs1456051406 3160 dbSNP
rs547905900 3171 dbSNP
rs1234425521 3183 dbSNP
rs1027872829 3189 dbSNP
rs1337512999 3194 dbSNP
rs1341973557 3195 dbSNP
rs1196770506 3211 dbSNP
rs1289562379 3213 dbSNP
rs1045636550 3228 dbSNP
rs950498116 3230 dbSNP
rs1336605075 3242 dbSNP
rs983571080 3244 dbSNP
rs1309399262 3246 dbSNP
rs905671003 3252 dbSNP
rs1219721105 3257 dbSNP
rs1399632763 3260 dbSNP
rs1270479433 3282 dbSNP
rs1461904635 3285 dbSNP
rs1490369250 3286 dbSNP
rs1396507086 3289 dbSNP
rs1024007881 3295 dbSNP
rs1472314116 3302 dbSNP
rs369854874 3303 dbSNP
rs567784786 3312 dbSNP
rs528122287 3320 dbSNP
rs1038651762 3325 dbSNP
rs927534920 3332 dbSNP
rs113977211 3339 dbSNP
rs990297849 3342 dbSNP
rs566207722 3344 dbSNP
rs1288295726 3347 dbSNP
rs780070060 3350 dbSNP
rs375885728 3351 dbSNP
rs912603584 3358 dbSNP
rs1262789213 3367 dbSNP
rs886450914 3373 dbSNP
rs140664111 3384 dbSNP
rs1376356749 3391 dbSNP
rs1304257740 3394 dbSNP
rs1366320188 3397 dbSNP
rs1009117344 3399 dbSNP
rs1019209480 3404 dbSNP
rs1404591818 3406 dbSNP
rs539006158 3406 dbSNP
rs116828119 3407 dbSNP
rs1417492659 3409 dbSNP
rs974929670 3410 dbSNP
rs575770198 3411 dbSNP
rs551383767 3415 dbSNP
rs1328741646 3425 dbSNP
rs900434085 3434 dbSNP
rs528569588 3435 dbSNP
rs1198775194 3442 dbSNP
rs1314808207 3443 dbSNP
rs1357720402 3444 dbSNP
rs1048893626 3447 dbSNP
rs114781560 3448 dbSNP
rs1353296275 3453 dbSNP
rs57919308 3462 dbSNP
rs1236651098 3472 dbSNP
rs1342921754 3484 dbSNP
rs971046161 3487 dbSNP
rs1435693645 3493 dbSNP
rs568599006 3506 dbSNP
rs981285265 3506 dbSNP
rs927211376 3513 dbSNP
rs937290785 3520 dbSNP
rs1448677420 3523 dbSNP
rs1193794399 3525 dbSNP
rs1173845415 3532 dbSNP
rs1436120002 3533 dbSNP
rs1422434358 3535 dbSNP
rs1171420943 3539 dbSNP
rs571076979 3541 dbSNP
rs1476027812 3544 dbSNP
rs1242373727 3545 dbSNP
rs1442516842 3549 dbSNP
rs1038195047 3573 dbSNP
rs1488154718 3582 dbSNP
rs1258533961 3598 dbSNP
rs574936774 3599 dbSNP
rs375595067 3601 dbSNP
rs1440851763 3603 dbSNP
rs769550457 3605 dbSNP
rs540724416 3606 dbSNP
rs192664013 3615 dbSNP
rs1033951190 3619 dbSNP
rs1156896961 3633 dbSNP
rs1340019113 3634 dbSNP
rs1279996007 3636 dbSNP
rs1216617624 3641 dbSNP
rs886398797 3660 dbSNP
rs185007643 3664 dbSNP
rs1040431677 3667 dbSNP
rs1387153273 3679 dbSNP
rs990329364 3682 dbSNP
rs375535149 3683 dbSNP
rs1383324130 3691 dbSNP
rs1357000721 3692 dbSNP
rs1336641700 3697 dbSNP
rs900740206 3704 dbSNP
rs1426471871 3711 dbSNP
rs1381094821 3721 dbSNP
rs913437575 3723 dbSNP
rs1169122111 3728 dbSNP
rs537347499 3732 dbSNP
rs1316106414 3739 dbSNP
rs986927462 3740 dbSNP
rs912624401 3743 dbSNP
rs375848925 3771 dbSNP
rs1258497120 3774 dbSNP
rs1039745728 3782 dbSNP
rs1352212630 3788 dbSNP
rs957785245 3791 dbSNP
rs763063600 3792 dbSNP
rs1205373446 3793 dbSNP
rs557681056 3797 dbSNP
rs1209322780 3805 dbSNP
rs919890573 3812 dbSNP
rs767881534 3818 dbSNP
rs1049447965 3827 dbSNP
rs1293678723 3834 dbSNP
rs1229775167 3836 dbSNP
rs545808824 3837 dbSNP
rs1442348264 3842 dbSNP
rs981069305 3844 dbSNP
rs372533815 3847 dbSNP
rs1243458933 3857 dbSNP
rs926973889 3865 dbSNP
rs1395808325 3871 dbSNP
rs1005107918 3877 dbSNP
rs1422413638 3888 dbSNP
rs1179905723 3896 dbSNP
rs1177997413 3900 dbSNP
rs1413398354 3900 dbSNP
rs1441691086 3907 dbSNP
rs753154814 3920 dbSNP
rs958633612 3927 dbSNP
rs974407394 3930 dbSNP
rs766368001 3938 dbSNP
rs1001202837 3951 dbSNP
rs763282123 3954 dbSNP
rs1033985682 3955 dbSNP
rs189681337 3961 dbSNP
rs929805106 3965 dbSNP
rs879711209 3968 dbSNP
rs1404563269 3972 dbSNP
rs761203510 3973 dbSNP
rs764130864 3975 dbSNP
rs531424220 3977 dbSNP
rs751597206 3983 dbSNP
rs1378582674 3989 dbSNP
rs756007442 3991 dbSNP
rs1445339065 3992 dbSNP
rs1020938342 3994 dbSNP
rs1040386447 3997 dbSNP
rs1456773720 3999 dbSNP
rs967600480 4008 dbSNP
rs900515351 4009 dbSNP
rs1160221125 4018 dbSNP
rs1373037187 4034 dbSNP
rs1378652291 4035 dbSNP
rs1390530458 4036 dbSNP
rs796219694 4037 dbSNP
rs987389055 4039 dbSNP
rs547944620 4045 dbSNP
rs1192844314 4049 dbSNP
rs1487415445 4054 dbSNP
rs1055119285 4060 dbSNP
rs1337067672 4061 dbSNP
rs912712582 4073 dbSNP
rs1228501191 4074 dbSNP
rs567673284 4075 dbSNP
rs193036156 4081 dbSNP
rs1238846992 4087 dbSNP
rs1347970416 4094 dbSNP
rs1321342244 4100 dbSNP
rs975485244 4113 dbSNP
rs527431797 4114 dbSNP
rs1385609041 4126 dbSNP
rs1256425498 4134 dbSNP
rs1480182458 4140 dbSNP
rs1289845821 4145 dbSNP
rs919963366 4154 dbSNP
rs1194330934 4158 dbSNP
rs369651922 4160 dbSNP
rs1473013261 4168 dbSNP
rs570388852 4169 dbSNP
rs1002604778 4172 dbSNP
rs1033988171 4179 dbSNP
rs1173971087 4180 dbSNP
rs907794036 4186 dbSNP
rs1481739613 4187 dbSNP
rs757406717 4188 dbSNP
rs1045976582 4189 dbSNP
rs1027311436 4198 dbSNP
rs539389889 4205 dbSNP
rs1260677588 4214 dbSNP
rs907013161 4217 dbSNP
rs1483341459 4218 dbSNP
rs112296135 4219 dbSNP
rs77105080 4222 dbSNP
rs1312141524 4224 dbSNP
rs1296887847 4228 dbSNP
rs184361129 4251 dbSNP
rs1220888003 4253 dbSNP
rs944744721 4261 dbSNP
rs750614589 4265 dbSNP
rs1302006389 4271 dbSNP
rs1343078975 4273 dbSNP
rs1297880803 4282 dbSNP
rs1415641221 4297 dbSNP
rs976591561 4299 dbSNP
rs376494995 4300 dbSNP
rs921916623 4301 dbSNP
rs114256098 4306 dbSNP
rs1171295852 4309 dbSNP
rs1478715398 4313 dbSNP
rs1019919824 4314 dbSNP
rs903452190 4321 dbSNP
rs1224995739 4336 dbSNP
rs1252811501 4338 dbSNP
rs1257770201 4339 dbSNP
rs74758167 4342 dbSNP
rs768751981 4345 dbSNP
rs575076620 4350 dbSNP
rs1201056620 4353 dbSNP
rs975517986 4355 dbSNP
rs1027058322 4356 dbSNP
rs952796233 4369 dbSNP
rs1490852623 4381 dbSNP
rs1277969546 4384 dbSNP
rs1234240024 4386 dbSNP
rs1342539382 4388 dbSNP
rs1310809056 4392 dbSNP
rs1395593918 4417 dbSNP
rs1397286710 4421 dbSNP
rs983203902 4422 dbSNP
rs907392574 4426 dbSNP
rs1419452134 4436 dbSNP
rs1002552197 4442 dbSNP
rs534321058 4444 dbSNP
rs1458204320 4445 dbSNP
rs1427222950 4449 dbSNP
rs1034524958 4450 dbSNP
rs1184959461 4458 dbSNP
rs894261680 4463 dbSNP
rs995579643 4464 dbSNP
rs538279746 4474 dbSNP
rs1363208054 4478 dbSNP
rs780555834 4479 dbSNP
rs747764500 4485 dbSNP
rs1406220002 4486 dbSNP
rs554219217 4487 dbSNP
rs145350635 4489 dbSNP
rs757096054 4492 dbSNP
rs1210853475 4496 dbSNP
rs981317818 4506 dbSNP
rs1380387945 4517 dbSNP
rs546145100 4520 dbSNP
rs116657299 4521 dbSNP
rs1377836750 4528 dbSNP
rs751428136 4529 dbSNP
rs1311591914 4532 dbSNP
rs965210533 4534 dbSNP
rs1374643449 4543 dbSNP
rs976158709 4554 dbSNP
rs922003639 4559 dbSNP
rs1289834362 4563 dbSNP
rs937158703 4564 dbSNP
rs1161186276 4565 dbSNP
rs1361797725 4567 dbSNP
rs932124501 4575 dbSNP
rs1159955804 4576 dbSNP
rs77182459 4583 dbSNP
rs914602213 4584 dbSNP
rs1041968388 4587 dbSNP
rs1265710126 4592 dbSNP
rs1485188140 4598 dbSNP
rs541720455 4604 dbSNP
rs866717151 4611 dbSNP
rs947135133 4616 dbSNP
rs1288395127 4626 dbSNP
rs907348749 4627 dbSNP
rs7759712 4630 dbSNP
rs1278949429 4632 dbSNP
rs1444358454 4632 dbSNP
rs7759714 4634 dbSNP
rs772386724 4636 dbSNP
rs547110316 4654 dbSNP
rs757982299 4656 dbSNP
rs1048507151 4662 dbSNP
rs886792993 4668 dbSNP
rs1004093492 4669 dbSNP
rs1417386386 4670 dbSNP
rs1379169112 4673 dbSNP
rs1019550102 4679 dbSNP
rs1479306734 4687 dbSNP
rs564172363 4692 dbSNP
rs1376376324 4702 dbSNP
rs965322527 4708 dbSNP
rs1488806358 4716 dbSNP
rs1265704131 4719 dbSNP
rs779445297 4722 dbSNP
rs1214713070 4731 dbSNP
rs1488054789 4733 dbSNP
rs1008934648 4737 dbSNP
rs1019860197 4752 dbSNP
rs775874261 4754 dbSNP
rs1347066455 4759 dbSNP
rs900030007 4760 dbSNP
rs761150325 4769 dbSNP
rs1340881062 4770 dbSNP
rs1344032353 4771 dbSNP
rs1027130223 4779 dbSNP
rs952907666 4788 dbSNP
rs1397751968 4793 dbSNP
rs1344195802 4795 dbSNP
rs1334267748 4796 dbSNP
rs1451615947 4798 dbSNP
rs982851621 4803 dbSNP
rs558105692 4810 dbSNP
rs1172504879 4814 dbSNP
rs1478388956 4815 dbSNP
rs990261189 4817 dbSNP
rs571827429 4827 dbSNP
rs532797468 4829 dbSNP
rs1238220508 4831 dbSNP
rs967352350 4834 dbSNP
rs977429355 4837 dbSNP
rs544894943 4842 dbSNP
rs1202973865 4844 dbSNP
rs928890575 4853 dbSNP
rs938972287 4855 dbSNP
rs1312595556 4860 dbSNP
rs1360893816 4860 dbSNP
rs1284386449 4864 dbSNP
rs928544940 4870 dbSNP
rs958587162 4875 dbSNP
rs1338181993 4876 dbSNP
rs1335424971 4889 dbSNP
rs764641822 4902 dbSNP
rs554937523 4905 dbSNP
rs569546448 4908 dbSNP
rs1283727353 4909 dbSNP
rs916096126 4913 dbSNP
rs931033720 4916 dbSNP
rs538579402 4917 dbSNP
rs548883019 4921 dbSNP
rs1048175560 4925 dbSNP
rs886740628 4927 dbSNP
rs1003874096 4936 dbSNP
rs568697482 4942 dbSNP
rs1245280530 4944 dbSNP
rs1179289785 4961 dbSNP
rs1458173554 4969 dbSNP
rs1259885213 4980 dbSNP
rs753856919 5006 dbSNP
rs914373772 5024 dbSNP
rs866749847 5025 dbSNP
rs1182070561 5029 dbSNP
rs1290225066 5034 dbSNP
rs1229695237 5037 dbSNP
rs947133988 5038 dbSNP
rs1041463435 5045 dbSNP
rs924294874 5049 dbSNP
rs1398433209 5054 dbSNP
rs1160676226 5055 dbSNP
rs1313781625 5062 dbSNP
rs1389328519 5063 dbSNP
rs1379827810 5069 dbSNP
rs1329868726 5070 dbSNP
rs574392962 5074 dbSNP
rs746462974 5079 dbSNP
rs1403842870 5081 dbSNP
rs943704769 5098 dbSNP
rs1334465499 5100 dbSNP
rs1441583174 5100 dbSNP
rs761884772 5111 dbSNP
rs1028544893 5137 dbSNP
rs1175403042 5140 dbSNP
rs1360674581 5141 dbSNP
rs78892261 5144 dbSNP
rs1279154144 5158 dbSNP
rs1021670160 5165 dbSNP
rs967476847 5182 dbSNP
rs1290557172 5184 dbSNP
rs1240292050 5188 dbSNP
rs114690163 5194 dbSNP
rs1289019903 5198 dbSNP
rs534678124 5204 dbSNP
rs1202264950 5232 dbSNP
rs1306382574 5233 dbSNP
rs1265451998 5236 dbSNP
rs577227134 5240 dbSNP
rs1210446166 5241 dbSNP
rs1231977376 5242 dbSNP
rs1434731587 5252 dbSNP
rs137961709 5257 dbSNP
rs1299022335 5261 dbSNP
rs1015662500 5263 dbSNP
rs189137403 5264 dbSNP
rs971167325 5265 dbSNP
rs1418466217 5270 dbSNP
rs916024825 5278 dbSNP
rs1192756297 5282 dbSNP
rs149037650 5286 dbSNP
rs1003512995 5306 dbSNP
rs1033617500 5311 dbSNP
rs908288762 5320 dbSNP
rs148892091 5324 dbSNP
rs750605431 5328 dbSNP
rs958618489 5348 dbSNP
rs1304009168 5353 dbSNP
rs758722383 5359 dbSNP
rs1174183131 5360 dbSNP
rs7746523 5365 dbSNP
rs1402091616 5372 dbSNP
rs1414798732 5384 dbSNP
rs914428378 5408 dbSNP
rs1358816236 5410 dbSNP
rs968562367 5413 dbSNP
rs377735007 5419 dbSNP
rs1466598196 5428 dbSNP
rs1327881407 5440 dbSNP
rs977603228 5448 dbSNP
rs182025825 5461 dbSNP
rs1428341302 5479 dbSNP
rs1194065146 5480 dbSNP
rs893594931 5483 dbSNP
rs1259203242 5484 dbSNP
rs183589693 5485 dbSNP
rs943743412 5486 dbSNP
rs1344949807 5489 dbSNP
rs1222295210 5493 dbSNP
rs1204075920 5505 dbSNP
rs75248139 5506 dbSNP
rs189590325 5507 dbSNP
rs777074185 5511 dbSNP
rs1323372932 5514 dbSNP
rs1259151308 5518 dbSNP
rs1220800334 5521 dbSNP
rs867922855 5530 dbSNP
rs1048639912 5544 dbSNP
rs888637916 5545 dbSNP
rs1396746853 5546 dbSNP
rs1035631572 5550 dbSNP
rs781122057 5553 dbSNP
rs4521611 5557 dbSNP
rs1468196251 5561 dbSNP
rs1405201290 5564 dbSNP
rs1401809633 5573 dbSNP
rs1271242220 5574 dbSNP
rs960071956 5577 dbSNP
rs1192006500 5578 dbSNP
rs992117733 5585 dbSNP
rs1023209691 5594 dbSNP
rs367903765 5599 dbSNP
rs1251996004 5608 dbSNP
rs560169085 5609 dbSNP
rs908738261 5614 dbSNP
rs1003544549 5621 dbSNP
rs1337851677 5622 dbSNP
rs1033650160 5659 dbSNP
rs939721482 5665 dbSNP
rs868232264 5666 dbSNP
rs1379317567 5679 dbSNP
rs796165431 5685 dbSNP
rs6570233 5702 dbSNP
rs755601935 5710 dbSNP
rs563611783 5711 dbSNP
rs1431922113 5713 dbSNP
rs1394083343 5714 dbSNP
rs181198853 5721 dbSNP
rs893706947 5723 dbSNP
rs528872048 5725 dbSNP
rs1443451883 5732 dbSNP
rs186403426 5742 dbSNP
rs1181037703 5743 dbSNP
rs1436521428 5750 dbSNP
rs568738102 5773 dbSNP
rs1250266399 5778 dbSNP
rs6570234 5787 dbSNP
rs902373958 5797 dbSNP
rs1289822647 5798 dbSNP
rs191222628 5807 dbSNP
rs1035786857 5809 dbSNP
rs1311475462 5826 dbSNP
rs1241100338 5827 dbSNP
rs1333864856 5833 dbSNP
rs1268850939 5836 dbSNP
rs932288632 5837 dbSNP
rs1230216835 5842 dbSNP
rs895923226 5845 dbSNP
rs984809634 5851 dbSNP
rs1274888281 5853 dbSNP
rs570956226 5861 dbSNP
rs1012916107 5862 dbSNP
rs1285994928 5863 dbSNP
rs1159865255 5864 dbSNP
rs1469071977 5865 dbSNP
rs1219655388 5870 dbSNP
rs910151047 5873 dbSNP
rs1268752945 5876 dbSNP
rs1023410669 5879 dbSNP
rs940242916 5881 dbSNP
rs1452120609 5888 dbSNP
rs1267104717 5890 dbSNP
rs1037204853 5893 dbSNP
rs906677461 5899 dbSNP
rs1192364605 5904 dbSNP
rs1288285732 5904 dbSNP
rs539966319 5910 dbSNP
rs939472731 5911 dbSNP
rs1203418864 5912 dbSNP
rs556368748 5921 dbSNP
rs1240208076 5926 dbSNP
rs1278855613 5937 dbSNP
rs1233793651 5947 dbSNP
rs1055114943 5952 dbSNP
rs112334216 5954 dbSNP
rs1010873954 5963 dbSNP
rs6930305 5968 dbSNP
rs774322626 5972 dbSNP
rs113628183 5975 dbSNP
rs540098783 5979 dbSNP
rs1391532263 5982 dbSNP
rs375710132 5987 dbSNP
rs1467974358 5988 dbSNP
rs1427639763 5995 dbSNP
rs1400709118 5997 dbSNP
rs1478282553 6002 dbSNP
rs1316815622 6003 dbSNP
rs922367261 6004 dbSNP
rs932418342 6008 dbSNP
rs985133298 6027 dbSNP
rs914905351 6030 dbSNP
rs1031535693 6031 dbSNP
rs1436302264 6034 dbSNP
rs747438461 6045 dbSNP
rs1042289007 6048 dbSNP
rs1271564494 6050 dbSNP
rs1428111089 6060 dbSNP
rs1242083077 6068 dbSNP
rs1266757053 6069 dbSNP
rs1325358158 6069 dbSNP
rs181613959 6071 dbSNP
rs201361606 6074 dbSNP
rs1471259104 6080 dbSNP
rs923743613 6082 dbSNP
rs1176226966 6083 dbSNP
rs1466443102 6091 dbSNP
rs1204526475 6094 dbSNP
rs939179884 6095 dbSNP
rs1028064540 6097 dbSNP
rs369175077 6109 dbSNP
rs895882474 6113 dbSNP
rs1466168531 6125 dbSNP
rs1013447183 6128 dbSNP
rs983824677 6131 dbSNP
rs1202870591 6137 dbSNP
rs1318320850 6143 dbSNP
rs769012133 6155 dbSNP
rs1242245463 6161 dbSNP
rs940294286 6166 dbSNP
rs1338294003 6170 dbSNP
rs1284298629 6177 dbSNP
rs1443075218 6180 dbSNP
rs973388128 6182 dbSNP
rs148187645 6185 dbSNP
rs777137215 6189 dbSNP
rs1369169944 6190 dbSNP
rs111869985 6201 dbSNP
rs1156845893 6207 dbSNP
rs6570235 6225 dbSNP
rs1458164813 6226 dbSNP
rs1327191877 6230 dbSNP
rs879375612 6247 dbSNP
rs1414741698 6248 dbSNP
rs1404346270 6250 dbSNP
rs1393991806 6251 dbSNP
rs961654369 6255 dbSNP
rs895252422 6256 dbSNP
rs1165592565 6278 dbSNP
rs946751719 6285 dbSNP
rs1383369897 6290 dbSNP
rs147428688 6294 dbSNP
rs1340602157 6302 dbSNP
rs1458102852 6306 dbSNP
rs548479144 6309 dbSNP
rs1202117059 6315 dbSNP
rs985634745 6322 dbSNP
rs1285833762 6328 dbSNP
rs116512951 6329 dbSNP
rs1247625305 6329 dbSNP
rs563343634 6333 dbSNP
rs1313668783 6335 dbSNP
rs1241513931 6337 dbSNP
rs1376117836 6347 dbSNP
rs765316579 6348 dbSNP
rs1053005046 6352 dbSNP
rs967696485 6353 dbSNP
rs773201790 6355 dbSNP
rs1305171677 6356 dbSNP
rs1422912019 6359 dbSNP
rs977761608 6362 dbSNP
rs1262348668 6363 dbSNP
rs901037181 6380 dbSNP
rs998033792 6386 dbSNP
rs1410038264 6392 dbSNP
rs1028139619 6396 dbSNP
rs186279684 6402 dbSNP
rs953782132 6403 dbSNP
rs1056287396 6406 dbSNP
rs1257155611 6410 dbSNP
rs1489682273 6415 dbSNP
rs916412624 6415 dbSNP
rs1290443476 6418 dbSNP
rs1216642204 6421 dbSNP
rs1319306317 6423 dbSNP
rs542606101 6427 dbSNP
rs191004755 6435 dbSNP
rs1005682010 6440 dbSNP
rs553819035 6440 dbSNP
rs60072617 6440 dbSNP
rs74700922 6441 dbSNP
rs757184205 6446 dbSNP
rs111362614 6447 dbSNP
rs1455380734 6455 dbSNP
rs1467880511 6460 dbSNP
rs1263751524 6462 dbSNP
rs1399985954 6472 dbSNP
rs1303739463 6474 dbSNP
rs571063152 6480 dbSNP
rs143579739 6481 dbSNP
rs1479265177 6482 dbSNP
rs1267708769 6483 dbSNP
rs1390403142 6502 dbSNP
rs1186640587 6516 dbSNP
rs897401065 6522 dbSNP
rs960919137 6524 dbSNP
rs548617159 6533 dbSNP
rs4895522 6546 dbSNP
rs1313257218 6552 dbSNP
rs1265408799 6566 dbSNP
rs147485101 6569 dbSNP
rs1044195556 6570 dbSNP
rs1006608352 6572 dbSNP
rs1359975317 6586 dbSNP
rs139287064 6589 dbSNP
rs935316920 6593 dbSNP
rs4896354 6595 dbSNP
rs1178387141 6597 dbSNP
rs1256298070 6599 dbSNP
rs867464970 6609 dbSNP
rs1428232825 6610 dbSNP
rs1170724396 6613 dbSNP
rs1429856862 6620 dbSNP
rs565725287 6639 dbSNP
rs777316920 6645 dbSNP
rs1462190295 6650 dbSNP
rs534952082 6653 dbSNP
rs748857211 6663 dbSNP
rs779719032 6664 dbSNP
rs1203266275 6675 dbSNP
rs1323262099 6676 dbSNP
rs1229898705 6679 dbSNP
rs1252195168 6679 dbSNP
rs757918389 6681 dbSNP
rs756897246 6683 dbSNP
rs183526565 6688 dbSNP
rs369281772 6691 dbSNP
rs1199390239 6695 dbSNP
rs577787860 6696 dbSNP
rs1005342431 6697 dbSNP
rs916376153 6712 dbSNP
rs186718186 6717 dbSNP
rs1463221709 6718 dbSNP
rs558733328 6718 dbSNP
rs1370958626 6722 dbSNP
rs961123449 6731 dbSNP
rs1444709553 6733 dbSNP
rs1162222732 6745 dbSNP
rs1387694042 6747 dbSNP
rs1182306226 6759 dbSNP
rs1177266167 6761 dbSNP
rs993810742 6764 dbSNP
rs1034606839 6770 dbSNP
rs1197878413 6774 dbSNP
rs1372854703 6775 dbSNP
rs573731995 6776 dbSNP
rs1166301145 6778 dbSNP
rs1371925941 6780 dbSNP
rs1361695473 6792 dbSNP
rs941448329 6797 dbSNP
rs1381882693 6800 dbSNP
rs1301952295 6808 dbSNP
rs991024486 6811 dbSNP
rs1392886276 6819 dbSNP
rs1363360751 6830 dbSNP
rs1393966162 6832 dbSNP
rs1297235876 6835 dbSNP
rs1037007700 6839 dbSNP
rs916785949 6845 dbSNP
rs1366901484 6846 dbSNP
rs968602605 6847 dbSNP
rs897180853 6849 dbSNP
rs979568824 6850 dbSNP
rs924035043 6853 dbSNP
rs1365406308 6867 dbSNP
rs935406145 6868 dbSNP
rs542741236 6870 dbSNP
rs1364862135 6871 dbSNP
rs934221954 6875 dbSNP
rs1417703100 6879 dbSNP
rs1250151851 6884 dbSNP
rs1388383825 6885 dbSNP
rs769016502 6897 dbSNP
rs1490889617 6898 dbSNP
rs1306699230 6906 dbSNP
rs1221810442 6911 dbSNP
rs569457574 6922 dbSNP
rs1261235617 6923 dbSNP
rs923235861 6928 dbSNP
rs1240991609 6929 dbSNP
rs890079011 6941 dbSNP
rs1007467615 6942 dbSNP
rs538022163 6950 dbSNP
rs4896355 6951 dbSNP
rs562038442 6951 dbSNP
rs1343076481 6953 dbSNP
rs889651693 6955 dbSNP
rs1386400714 6963 dbSNP
rs941203744 6964 dbSNP
rs144253282 6975 dbSNP
rs148715243 6976 dbSNP
rs776886733 6977 dbSNP
rs992053421 6995 dbSNP
rs1267000764 6998 dbSNP
rs1192279850 6999 dbSNP
rs748654287 7001 dbSNP
rs1261524006 7004 dbSNP
rs1206831495 7006 dbSNP
rs143953768 7020 dbSNP
rs1034682057 7023 dbSNP
rs896152946 7035 dbSNP
rs1223875184 7044 dbSNP
rs1325297349 7048 dbSNP
rs1280973578 7049 dbSNP
rs1190858894 7066 dbSNP
rs549913160 7069 dbSNP
rs1391668610 7073 dbSNP
rs1012476190 7074 dbSNP
rs984603166 7080 dbSNP
rs1024293430 7098 dbSNP
rs1319669519 7107 dbSNP
rs1429924067 7108 dbSNP
rs1162387437 7110 dbSNP
rs1388516237 7118 dbSNP
rs968301700 7122 dbSNP
rs980028280 7124 dbSNP
rs1347594150 7126 dbSNP
rs1459438195 7145 dbSNP
rs909061053 7153 dbSNP
rs1361071767 7191 dbSNP
rs1031130420 7205 dbSNP
rs1175993515 7207 dbSNP
rs1475825716 7207 dbSNP
rs1243950834 7210 dbSNP
rs1432660257 7217 dbSNP
rs1445262936 7219 dbSNP
rs1247308564 7224 dbSNP
rs1204141294 7225 dbSNP
rs1462480468 7227 dbSNP
rs1218307565 7232 dbSNP
rs1260963880 7232 dbSNP
rs957014494 7239 dbSNP
rs1339597766 7243 dbSNP
rs1271475090 7259 dbSNP
rs976159618 7267 dbSNP
rs923307884 7284 dbSNP
rs190931687 7285 dbSNP
rs1366217133 7292 dbSNP
rs1454994366 7293 dbSNP
rs985405022 7294 dbSNP
rs911146202 7296 dbSNP
rs1333878177 7299 dbSNP
rs941246809 7307 dbSNP
rs1421889865 7308 dbSNP
rs1038616843 7316 dbSNP
rs529384306 7323 dbSNP
rs1475125719 7324 dbSNP
rs1389545217 7330 dbSNP
rs929766401 7331 dbSNP
rs1056123360 7332 dbSNP
rs115769506 7333 dbSNP
rs1011879688 7336 dbSNP
rs1209134629 7340 dbSNP
rs1438083391 7341 dbSNP
rs763062570 7345 dbSNP
rs531175268 7346 dbSNP
rs565764310 7348 dbSNP
rs118123952 7357 dbSNP
rs748652820 7365 dbSNP
rs1001090673 7366 dbSNP
rs1381164753 7367 dbSNP
rs1284026211 7377 dbSNP
rs1443347520 7380 dbSNP
rs1356564403 7381 dbSNP
rs1327091622 7388 dbSNP
rs770204528 7398 dbSNP
rs774669640 7399 dbSNP
rs1463907079 7400 dbSNP
rs904048125 7411 dbSNP
rs1446420924 7418 dbSNP
rs1210979951 7420 dbSNP
rs1411488801 7427 dbSNP
rs1031621501 7433 dbSNP
rs866691230 7434 dbSNP
rs551668018 7440 dbSNP
rs1234336715 7448 dbSNP
rs182642284 7469 dbSNP
rs188090506 7470 dbSNP
rs557240791 7476 dbSNP
rs767313506 7482 dbSNP
rs573871684 7486 dbSNP
rs953417250 7487 dbSNP
rs986539045 7491 dbSNP
rs752485313 7505 dbSNP
rs1455512817 7506 dbSNP
rs941306830 7508 dbSNP
rs1322365141 7510 dbSNP
rs1023322437 7516 dbSNP
rs969696338 7517 dbSNP
rs1305072344 7519 dbSNP
rs536390354 7521 dbSNP
rs1237825199 7527 dbSNP
rs1348108597 7539 dbSNP
rs1164008998 7542 dbSNP
rs760650007 7550 dbSNP
rs1409926499 7551 dbSNP
rs1156622443 7561 dbSNP
rs1016067253 7564 dbSNP
rs770364628 7566 dbSNP
rs113354298 7567 dbSNP
rs1056196297 7569 dbSNP
rs140669443 7577 dbSNP
rs1381556140 7606 dbSNP
rs918664716 7606 dbSNP
rs1228998141 7611 dbSNP
rs1282627405 7611 dbSNP
rs1306303641 7613 dbSNP
rs572820636 7617 dbSNP
rs1324619053 7619 dbSNP
rs1285412323 7628 dbSNP
rs1341081262 7632 dbSNP
rs1403272772 7636 dbSNP
rs987194252 7640 dbSNP
rs1045137823 7641 dbSNP
rs1431420804 7645 dbSNP
rs1346870955 7656 dbSNP
rs1156736310 7657 dbSNP
rs1456505204 7658 dbSNP
rs942931409 7662 dbSNP
rs903510637 7666 dbSNP
rs1269231782 7676 dbSNP
rs925420920 7679 dbSNP
rs1186547240 7681 dbSNP
rs1423896708 7681 dbSNP
rs1001566165 7682 dbSNP
rs1209044858 7683 dbSNP
rs544645951 7687 dbSNP
rs1484005820 7699 dbSNP
rs1052686165 7700 dbSNP
rs1265313157 7707 dbSNP
rs192707077 7717 dbSNP
rs1296445195 7725 dbSNP
rs1471607993 7727 dbSNP
rs753778179 7728 dbSNP
rs1045104907 7730 dbSNP
rs1364076811 7737 dbSNP
rs1161247613 7739 dbSNP
rs904862086 7747 dbSNP
rs1006111273 7758 dbSNP
rs375626714 7758 dbSNP
rs1412503940 7760 dbSNP
rs1464252706 7765 dbSNP
rs961995183 7767 dbSNP
rs993312789 7770 dbSNP
rs1429757695 7771 dbSNP
rs1030194544 7779 dbSNP
rs997698884 7789 dbSNP
rs1445724903 7794 dbSNP
rs1030463619 7798 dbSNP
rs953449212 7799 dbSNP
rs1199071148 7800 dbSNP
rs1331910277 7807 dbSNP
rs955615430 7810 dbSNP
rs986922161 7816 dbSNP
rs911172470 7818 dbSNP
rs373951890 7819 dbSNP
rs1007634332 7820 dbSNP
rs1297736361 7822 dbSNP
rs1016714840 7827 dbSNP
rs925533924 7828 dbSNP
rs1394061430 7831 dbSNP
rs370050705 7835 dbSNP
rs935606780 7835 dbSNP
rs1298403509 7851 dbSNP
rs1412265957 7855 dbSNP
rs1463135380 7866 dbSNP
rs553846032 7875 dbSNP
rs1167363861 7877 dbSNP
rs1425900556 7883 dbSNP
rs1289502401 7885 dbSNP
rs368586663 7886 dbSNP
rs1053018762 7887 dbSNP
rs1244164306 7889 dbSNP
rs1281086852 7899 dbSNP
rs1482175392 7911 dbSNP
rs1274044670 7933 dbSNP
rs963392639 7950 dbSNP
rs1360128020 7951 dbSNP
rs1267126834 7957 dbSNP
rs12208658 7958 dbSNP
rs578220143 7962 dbSNP
rs1339657580 7965 dbSNP
rs1307391508 7969 dbSNP
rs1250479076 7974 dbSNP
rs543695408 7982 dbSNP
rs1348216063 7983 dbSNP
rs1306914459 7987 dbSNP
rs1405026155 7987 dbSNP
rs1183649417 7988 dbSNP
rs114723001 7990 dbSNP
rs1364773794 7991 dbSNP
rs529424963 7992 dbSNP
rs560624870 7992 dbSNP
rs778417350 7993 dbSNP
rs1251325305 7996 dbSNP
rs750032771 7996 dbSNP
rs12