miRTarBase - #MIRT571431 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RIF1   
Synonyms -
Description replication timing regulatory factor 1
Transcript NM_001177663   
Other Transcripts NM_001177664 , NM_001177665 , NM_018151   
Expression
Putative miRNA Targets on RIF1
3'UTR of RIF1
(miRNA target sites are highlighted)
>RIF1|NM_001177663|3'UTR
   1 TATTTTCAGAGAAAATTGAAGGTTTTTTTAAACATCACTGGATTTCTTGATTGAGGAAACAAGTTCTGAAATAATAGCAC
  81 AATTTCAAAGAAGAGACTCTTTGCAAAGTTGATAACATTTCAAACCCTGAAGGACAGTGACTTATTATGTAAGTTCAATT
 161 TTGTAAGTTCATTATGTAAGATCCTTTTTTTTTTCATAATATGTATTCTTGGCTGCTATGCGTGGTTTTTCAGGAAATTT
 241 AATTATCTTACTGAGATGTGAAAGCAAAACTAGTAACAGAACTTACATTTTATTTCATGCTTTCTTAAACCCGTGCATAT
 321 TCTGGTGAAACATGTAAAATACTTTAAGTAAAATTGAACATTTTTATTTGAATTTTTGCTGAACTGATAAAGGTGTTTAT
 401 ATTTTTGTTTGTTGGTTTGTTTAATTCATGTTTGTTGGGACTGAGGTTTAGGAAGTTTGTTACTGGTTAAAAACCTCAAA
 481 TGAAATGCGAAAGAATTTGAATTTTTCCTGCATATGTCAACTTTGGACAGCTTTCAAGAAAAATGAGAAAAGTTTCAACT
 561 TCTGGCGGTTAAAATATTAATGCAGAATTTACTAAGATTTTATTCATTTGCATTAGCAAATATTCATGCAGCAGCAGTTG
 641 ACTGAAAATTTATTCTTATGAGACGTATAGTATTCATTTTTAAATGCATGATTGTACATTATGTATAGACGACAATGTTT
 721 TTAATTTATAAATTTCATTCTTTGTTAATTGCATGGGTTTTTCTGCAGCTTATTGTGAATACCTTGGTTCTGTTCAATAG
 801 AAACATTTTGTATATATTAAATACTGAAATATCAGTATCGACGGTGGAAGTGCTTCATGGGCTTGCTGCACATATTTGTA
 881 GGATACTGTATCTGCAAATGCAACAACAAATAGTTTTGTACTTGGTTAACAGTCTTAGTTAAAACATGAGTTTATTTTCT
 961 AAAAGTATCCAGAATAAGTAAAATTATAGAAATAAGAAAATGTTACACAACTTTGCTGTTCATACCCTTACCTTCTTACT
1041 ACTTTTGGTTTGGAGGAGGGTATCACCACTAGAAAGTGTGCCTCCTTAAGATTTCTTAAAGGAAAGTTAGTTTCAGTATT
1121 TCACAGCAAGTTGGACTACAAAATCTAGAGTTGATCTGCTTTTTAAACCTTCATTTAAAAGCAAACTTGGAAGAAATTTG
1201 AAACTGATGTTTTTAATATATGTCTGTGTTGCCTAGGTTTTCTTTTTTTAAAGAGGTATGTAATTAAAACCTTTGTAAAA
1281 TTTGCCAACTAATATTAGTGCCTGACTTCCCATATTTGTTTCATCTTTTTAACTGACAGTATATCTCACTTCTTCTTTGA
1361 ATAGAATGAGTGAGTGATCTCAGTTTTCACATTTTATTCAGAAGCTAATCCCTACTTAGCAAGGCACACATTCTACAGCA
1441 AGTCATAGAAAGTTTAATCCTTGTGCCTCCTTAGCTCTCGTATATTCAGGGATCTCTATAAAAGTTGGTGTCTTTTTTCA
1521 TCATCATAAATTCATCATAATCACAGATATTTTTGGGTCTAAGATATTCATATACCAAGGATGGTTTTGTAAAGAATTCT
1601 GGGATCATTGAATTAAGGATTGTGGCTTGAAGTAACTAAAGAAAAATACTAATTTCCTTAAAAGGAATTATAATTATGAT
1681 TTACATTTTACATCATTAATTTCCCAAATTATATTTAACCGTAAGGAGGTGCACATGAGTTTTTAGCAAACAGGTATGAA
1761 TAAGCAGCTATGTATATGTGTTTGGGGCAGAGGGGAGCAGATTACTTTAACACACTTCAGAATTAAAATCAGTTCGTTTC
1841 ATGACTCTGTGCCTTAACGTTTGTGTGAACTAAACTTGCTGATTGAATGAAATTCTTGGGAAGCCGAACAGTAATAGCAG
1921 AAAATGTGACCAAATGAGTATCATGTACTTAAATCACTGAATTTTATATAAGCACAAGTATTAATTTTAAAAACATTATA
2001 GTTTAATAAAGCTGCATTTAAAAATATTTGGGAGCAAAGACAAGCATGCTAAATCTTCATTTTGCTATGGCTATAAGCAT
2081 ATATTTTTGGCAACTTATTTGCAATATTCTTGCCTTAAAGTTTCCTGCAAATTTCCCCCTTAGTAATTCCCGAATAGCAA
2161 AACATTAATATTCCATGATTAGCTCTACTGTGTTGTCTCACTATTAAAATGGAATTCGTTTTTTCAGATCTTTTCTAATG
2241 GTTAATAAAACAAATGTCAGATCATAATAACACTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAU------ACACGACGAu 5'
             ||| ::|||      | |||||:| 
Target 5' aagAAAATGTTACACAACTTTGCTGTTc 3'
994 - 1021 137.00 -9.30
2
miRNA  3' gugUUUG-GUAAUAC----ACGACGau 5'
             ||:: | | |||    ||||||  
Target 5' tggAAGTGCTTCATGGGCTTGCTGCac 3'
845 - 871 129.00 -9.10
3
miRNA  3' guGUUUGGUA-AUACACGACGau 5'
            :||  :|| | ||||:|||  
Target 5' ttTAATATATGTCTGTGTTGCct 3'
1212 - 1234 124.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31501087 9 COSMIC
COSN30491575 17 COSMIC
COSN5851325 19 COSMIC
COSN31601764 47 COSMIC
COSN30485171 51 COSMIC
COSN20068815 195 COSMIC
COSN20097248 195 COSMIC
COSN20097249 415 COSMIC
COSN19292270 486 COSMIC
COSN31545562 536 COSMIC
COSN31529717 651 COSMIC
COSN31513793 810 COSMIC
COSN21343941 2046 COSMIC
COSN24706932 2228 COSMIC
COSN23412339 2482 COSMIC
COSN5485535 2717 COSMIC
COSN27581061 3456 COSMIC
COSN9069067 3569 COSMIC
COSN29823639 4125 COSMIC
COSN21380610 4635 COSMIC
COSN9069068 5311 COSMIC
COSN174140 5399 COSMIC
COSN7109192 5573 COSMIC
COSN27803255 5761 COSMIC
COSN20794663 5858 COSMIC
COSN22746907 6299 COSMIC
COSN9863112 6586 COSMIC
COSN19473947 6777 COSMIC
COSN29714614 7033 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1483623576 2 dbSNP
rs774974911 3 dbSNP
rs1248786149 9 dbSNP
rs1368917903 12 dbSNP
rs1435426854 12 dbSNP
rs1177369966 16 dbSNP
rs1307716469 18 dbSNP
rs1466766667 23 dbSNP
rs748817850 23 dbSNP
rs771347211 23 dbSNP
rs759773579 30 dbSNP
rs767903969 35 dbSNP
rs1411207538 37 dbSNP
rs752854554 38 dbSNP
rs760870140 39 dbSNP
rs764364134 42 dbSNP
rs1296256658 52 dbSNP
rs1444816355 56 dbSNP
rs935517066 72 dbSNP
rs1413420319 75 dbSNP
rs1183708425 80 dbSNP
rs1471346091 82 dbSNP
rs1217489038 83 dbSNP
rs755903068 91 dbSNP
rs981791093 97 dbSNP
rs1242395608 98 dbSNP
rs529910872 100 dbSNP
rs753074693 100 dbSNP
rs1329776535 111 dbSNP
rs1290185714 117 dbSNP
rs1230281691 124 dbSNP
rs1348660420 127 dbSNP
rs1287846164 131 dbSNP
rs918019326 138 dbSNP
rs1185537726 142 dbSNP
rs1381635416 142 dbSNP
rs1465912588 144 dbSNP
rs934528461 144 dbSNP
rs1419891167 146 dbSNP
rs777604070 148 dbSNP
rs1456132113 149 dbSNP
rs949476809 151 dbSNP
rs1052799029 154 dbSNP
rs1475482297 155 dbSNP
rs192142053 159 dbSNP
rs16830067 161 dbSNP
rs947018747 162 dbSNP
rs528304599 164 dbSNP
rs1253708143 183 dbSNP
rs1269812533 185 dbSNP
rs138135559 185 dbSNP
rs34575263 185 dbSNP
rs563314069 185 dbSNP
rs1206701371 187 dbSNP
rs773930998 195 dbSNP
rs1402584246 196 dbSNP
rs1319164789 197 dbSNP
rs1358809739 199 dbSNP
rs1446229068 200 dbSNP
rs1245689957 201 dbSNP
rs1315218418 202 dbSNP
rs368057276 203 dbSNP
rs1228282366 204 dbSNP
rs1287075407 206 dbSNP
rs1347901607 209 dbSNP
rs1224979229 215 dbSNP
rs745436640 219 dbSNP
rs771563374 222 dbSNP
rs777160053 223 dbSNP
rs1388560273 238 dbSNP
rs1259315966 239 dbSNP
rs530219610 243 dbSNP
rs1163315698 247 dbSNP
rs531728658 251 dbSNP
rs1181349617 257 dbSNP
rs1025463042 263 dbSNP
rs530386018 271 dbSNP
rs1366334525 272 dbSNP
rs549855959 274 dbSNP
rs1005058215 287 dbSNP
rs1362007988 297 dbSNP
rs1007973854 312 dbSNP
rs770149482 313 dbSNP
rs1268056094 318 dbSNP
rs1471163747 326 dbSNP
rs1159254502 331 dbSNP
rs550207708 340 dbSNP
rs1245469064 343 dbSNP
rs757332054 343 dbSNP
rs899262727 346 dbSNP
rs1175798669 361 dbSNP
rs1376436432 367 dbSNP
rs1389062685 378 dbSNP
rs550203060 381 dbSNP
rs963690087 385 dbSNP
rs979469434 394 dbSNP
rs1387904136 404 dbSNP
rs1012640394 406 dbSNP
rs1409659612 407 dbSNP
rs372957656 411 dbSNP
rs376249793 411 dbSNP
rs755320246 411 dbSNP
rs1338053034 412 dbSNP
rs2432955 415 dbSNP
rs746748006 415 dbSNP
rs780783661 423 dbSNP
rs763159344 427 dbSNP
rs957148698 435 dbSNP
rs529765452 456 dbSNP
rs1200850678 460 dbSNP
rs1036054359 467 dbSNP
rs745544269 475 dbSNP
rs918112356 479 dbSNP
rs184508579 489 dbSNP
rs974921156 490 dbSNP
rs1275845603 492 dbSNP
rs1235987605 493 dbSNP
rs1329872276 500 dbSNP
rs980884790 515 dbSNP
rs140024140 519 dbSNP
rs942042090 525 dbSNP
rs1038081222 536 dbSNP
rs1348257133 538 dbSNP
rs1305848593 540 dbSNP
rs1428730240 546 dbSNP
rs1423014469 548 dbSNP
rs1051983657 560 dbSNP
rs1174109706 562 dbSNP
rs1476965560 562 dbSNP
rs186974838 567 dbSNP
rs1439518061 568 dbSNP
rs1472980510 569 dbSNP
rs1254103257 575 dbSNP
rs897815157 581 dbSNP
rs548844203 582 dbSNP
rs1246166173 583 dbSNP
rs1437471365 584 dbSNP
rs1046964515 585 dbSNP
rs1452727749 589 dbSNP
rs1343490558 597 dbSNP
rs1263104551 611 dbSNP
rs1195716197 617 dbSNP
rs767675020 630 dbSNP
rs1395933286 647 dbSNP
rs1285948624 648 dbSNP
rs374948283 656 dbSNP
rs1166546141 660 dbSNP
rs1007982365 665 dbSNP
rs1410996944 666 dbSNP
rs1159756954 669 dbSNP
rs1017982961 679 dbSNP
rs752628350 692 dbSNP
rs1414194264 693 dbSNP
rs756101817 700 dbSNP
rs769166568 700 dbSNP
rs1469807830 704 dbSNP
rs1238336926 705 dbSNP
rs1000549955 706 dbSNP
rs1032451868 708 dbSNP
rs1329989595 708 dbSNP
rs956380622 710 dbSNP
rs1438096296 711 dbSNP
rs1305092029 712 dbSNP
rs1012321763 716 dbSNP
rs1209862489 731 dbSNP
rs1010272216 732 dbSNP
rs1265631915 733 dbSNP
rs906528964 735 dbSNP
rs1003955402 738 dbSNP
rs191706640 741 dbSNP
rs1227336927 757 dbSNP
rs1445506660 758 dbSNP
rs955969119 763 dbSNP
rs1320989250 769 dbSNP
rs970891666 770 dbSNP
rs988579900 784 dbSNP
rs980894653 788 dbSNP
rs1021395669 791 dbSNP
rs1414773653 796 dbSNP
rs926711230 798 dbSNP
rs963761519 800 dbSNP
rs1384929047 813 dbSNP
rs1189624329 815 dbSNP
rs1466627244 815 dbSNP
rs1246794150 817 dbSNP
rs1214416353 823 dbSNP
rs1196297194 833 dbSNP
rs1289127429 836 dbSNP
rs973497320 838 dbSNP
rs1298048702 840 dbSNP
rs141417607 840 dbSNP
rs369380829 841 dbSNP
rs73967547 843 dbSNP
rs534251600 844 dbSNP
rs554266148 847 dbSNP
rs749758080 848 dbSNP
rs1325612560 851 dbSNP
rs1422912237 857 dbSNP
rs1037989956 868 dbSNP
rs62169410 869 dbSNP
rs943893141 873 dbSNP
rs1475979597 875 dbSNP
rs545199212 876 dbSNP
rs866603218 879 dbSNP
rs1451757969 881 dbSNP
rs745591830 889 dbSNP
rs563011271 891 dbSNP
rs1186392046 898 dbSNP
rs1392927154 912 dbSNP
rs899652053 938 dbSNP
rs1247891422 940 dbSNP
rs1218820420 945 dbSNP
rs1490084096 946 dbSNP
rs1001046348 947 dbSNP
rs1274959456 955 dbSNP
rs1207007341 979 dbSNP
rs1339750125 986 dbSNP
rs1053538130 988 dbSNP
rs565025660 993 dbSNP
rs948258169 1001 dbSNP
rs1394647953 1007 dbSNP
rs575192106 1008 dbSNP
rs892159807 1011 dbSNP
rs745486196 1016 dbSNP
rs1308916036 1021 dbSNP
rs1293076574 1023 dbSNP
rs543781731 1026 dbSNP
rs1025232209 1028 dbSNP
rs560581322 1040 dbSNP
rs1227898998 1042 dbSNP
rs34662604 1043 dbSNP
rs1170209438 1044 dbSNP
rs139632537 1045 dbSNP
rs1427952423 1047 dbSNP
rs1479852776 1055 dbSNP
rs373558454 1055 dbSNP
rs546350240 1056 dbSNP
rs1052403599 1061 dbSNP
rs563758402 1063 dbSNP
rs779559988 1079 dbSNP
rs1250491191 1080 dbSNP
rs1002384564 1086 dbSNP
rs1210625767 1094 dbSNP
rs1034289490 1095 dbSNP
rs1215582335 1098 dbSNP
rs892490391 1099 dbSNP
rs1344907067 1105 dbSNP
rs184295204 1124 dbSNP
rs188938068 1125 dbSNP
rs1464533244 1129 dbSNP
rs1371528164 1132 dbSNP
rs968542543 1133 dbSNP
rs996420670 1138 dbSNP
rs1361385275 1140 dbSNP
rs1028714694 1141 dbSNP
rs954635181 1142 dbSNP
rs987244292 1144 dbSNP
rs973931651 1146 dbSNP
rs1447875534 1148 dbSNP
rs919316663 1151 dbSNP
rs569550791 1152 dbSNP
rs987410092 1157 dbSNP
rs912492647 1173 dbSNP
rs961742832 1176 dbSNP
rs1416270210 1185 dbSNP
rs943986532 1187 dbSNP
rs1039577464 1189 dbSNP
rs538573747 1191 dbSNP
rs1484138425 1203 dbSNP
rs921135296 1208 dbSNP
rs920847217 1209 dbSNP
rs1166342490 1210 dbSNP
rs1417949747 1216 dbSNP
rs1452496278 1222 dbSNP
rs1286694422 1225 dbSNP
rs773533396 1226 dbSNP
rs1241364097 1234 dbSNP
rs117748631 1238 dbSNP
rs1045651165 1243 dbSNP
rs928046076 1243 dbSNP
rs892173896 1244 dbSNP
rs1312077437 1250 dbSNP
rs1353384458 1253 dbSNP
rs1235029682 1255 dbSNP
rs939412473 1257 dbSNP
rs1293905087 1259 dbSNP
rs568437643 1262 dbSNP
rs1321966862 1263 dbSNP
rs1451045467 1267 dbSNP
rs534204835 1275 dbSNP
rs1164972106 1276 dbSNP
rs1383077640 1280 dbSNP
rs1046065525 1289 dbSNP
rs1262670247 1290 dbSNP
rs1351697351 1293 dbSNP
rs906182277 1295 dbSNP
rs1484906803 1296 dbSNP
rs553937815 1306 dbSNP
rs577309569 1307 dbSNP
rs1486894239 1324 dbSNP
rs538454450 1338 dbSNP
rs899338712 1342 dbSNP
rs1366516878 1349 dbSNP
rs182073795 1349 dbSNP
rs1417937060 1350 dbSNP
rs994977710 1360 dbSNP
rs1156358838 1362 dbSNP
rs149711942 1363 dbSNP
rs774755225 1367 dbSNP
rs796885851 1368 dbSNP
rs1008645646 1370 dbSNP
rs1416404179 1375 dbSNP
rs987503328 1376 dbSNP
rs1372562492 1393 dbSNP
rs1162667881 1400 dbSNP
rs1449906448 1406 dbSNP
rs544063852 1409 dbSNP
rs1391807812 1411 dbSNP
rs1190888534 1414 dbSNP
rs1018926025 1419 dbSNP
rs1261062593 1422 dbSNP
rs1309206792 1426 dbSNP
rs1014718574 1427 dbSNP
rs1317633446 1428 dbSNP
rs961664312 1432 dbSNP
rs1289917576 1434 dbSNP
rs1233832929 1437 dbSNP
rs185390223 1442 dbSNP
rs1272316774 1446 dbSNP
rs190679010 1448 dbSNP
rs574047198 1455 dbSNP
rs1274504084 1458 dbSNP
rs767801494 1467 dbSNP
rs928109714 1470 dbSNP
rs1343233700 1475 dbSNP
rs989302523 1480 dbSNP
rs1252009536 1481 dbSNP
rs1372106259 1483 dbSNP
rs540232347 1498 dbSNP
rs1192605254 1509 dbSNP
rs6707098 1513 dbSNP
rs531044661 1514 dbSNP
rs946691514 1518 dbSNP
rs1353755023 1521 dbSNP
rs1460371970 1528 dbSNP
rs16830069 1529 dbSNP
rs1043726352 1531 dbSNP
rs4468813 1534 dbSNP
rs1194495246 1537 dbSNP
rs563039942 1544 dbSNP
rs931880321 1558 dbSNP
rs1257151763 1570 dbSNP
rs1440285832 1576 dbSNP
rs1225916643 1582 dbSNP
rs1343049320 1586 dbSNP
rs937628401 1590 dbSNP
rs1282096672 1595 dbSNP
rs118038958 1598 dbSNP
rs1301441970 1600 dbSNP
rs899392332 1605 dbSNP
rs1337223946 1613 dbSNP
rs1326599498 1621 dbSNP
rs995429010 1639 dbSNP
rs1235421773 1649 dbSNP
rs566379687 1650 dbSNP
rs760608168 1652 dbSNP
rs1306165928 1653 dbSNP
rs890285454 1657 dbSNP
rs771713077 1666 dbSNP
rs1008737031 1667 dbSNP
rs775016704 1668 dbSNP
rs1014644980 1669 dbSNP
rs1473032645 1672 dbSNP
rs1234856637 1678 dbSNP
rs1180084540 1693 dbSNP
rs1457768662 1695 dbSNP
rs13555 1720 dbSNP
rs1250698157 1721 dbSNP
rs753711092 1722 dbSNP
rs1261954678 1728 dbSNP
rs1228544277 1733 dbSNP
rs1018978202 1735 dbSNP
rs1193917296 1740 dbSNP
rs568782703 1757 dbSNP
rs974731630 1758 dbSNP
rs1028675832 1767 dbSNP
rs1312879361 1770 dbSNP
rs757081068 1771 dbSNP
rs533933124 1775 dbSNP
rs989787871 1784 dbSNP
rs994480523 1788 dbSNP
rs3898351 1801 dbSNP
rs1405333453 1802 dbSNP
rs1336155693 1803 dbSNP
rs547819427 1806 dbSNP
rs1410291426 1809 dbSNP
rs1027713753 1811 dbSNP
rs778654535 1814 dbSNP
rs1469821975 1816 dbSNP
rs945186685 1821 dbSNP
rs1369356305 1826 dbSNP
rs570833446 1827 dbSNP
rs750167818 1836 dbSNP
rs1323999578 1837 dbSNP
rs1208784700 1842 dbSNP
rs1396847421 1847 dbSNP
rs969109474 1848 dbSNP
rs1269901016 1849 dbSNP
rs539954181 1850 dbSNP
rs981868580 1854 dbSNP
rs1035317379 1859 dbSNP
rs556252740 1860 dbSNP
rs1432848431 1864 dbSNP
rs937680810 1866 dbSNP
rs1400326904 1868 dbSNP
rs1366504513 1870 dbSNP
rs1165831180 1878 dbSNP
rs1334791033 1881 dbSNP
rs113366298 1884 dbSNP
rs946784878 1889 dbSNP
rs1476674689 1895 dbSNP
rs568681942 1906 dbSNP
rs182311232 1907 dbSNP
rs371868746 1912 dbSNP
rs1451814939 1913 dbSNP
rs898814043 1916 dbSNP
rs930933311 1919 dbSNP
rs1271905546 1926 dbSNP
rs1469469668 1931 dbSNP
rs1358413796 1936 dbSNP
rs1275095496 1962 dbSNP
rs1216202684 1976 dbSNP
rs554400878 1979 dbSNP
rs1430156460 1980 dbSNP
rs1241166247 1981 dbSNP
rs886641893 1984 dbSNP
rs1188086071 1995 dbSNP
rs1423005381 1998 dbSNP
rs1365262939 2001 dbSNP
rs574432828 2002 dbSNP
rs147818647 2004 dbSNP
rs1424195441 2007 dbSNP
rs1412117975 2015 dbSNP
rs1474828694 2027 dbSNP
rs185057850 2028 dbSNP
rs1420110600 2033 dbSNP
rs1462086519 2034 dbSNP
rs1185398285 2038 dbSNP
rs1480451386 2039 dbSNP
rs370337138 2045 dbSNP
rs900570967 2047 dbSNP
rs1196753738 2050 dbSNP
rs996592170 2054 dbSNP
rs189817177 2056 dbSNP
rs1033041605 2068 dbSNP
rs1252263654 2074 dbSNP
rs1206448912 2075 dbSNP
rs1305665325 2078 dbSNP
rs1036214440 2080 dbSNP
rs545857207 2082 dbSNP
rs897684051 2086 dbSNP
rs1403270170 2094 dbSNP
rs957580021 2104 dbSNP
rs994575402 2106 dbSNP
rs1444863076 2107 dbSNP
rs773539282 2108 dbSNP
rs1353244563 2113 dbSNP
rs879779992 2114 dbSNP
rs1289793326 2117 dbSNP
rs181130012 2120 dbSNP
rs1430721041 2124 dbSNP
rs1173714114 2130 dbSNP
rs1020851492 2131 dbSNP
rs879164955 2134 dbSNP
rs966538475 2136 dbSNP
rs1479506498 2139 dbSNP
rs1232118259 2140 dbSNP
rs1204143579 2149 dbSNP
rs981919522 2150 dbSNP
rs1283076595 2152 dbSNP
rs139701810 2153 dbSNP
rs1217562567 2157 dbSNP
rs1308035902 2163 dbSNP
rs959181710 2173 dbSNP
rs1371547175 2174 dbSNP
rs990957347 2185 dbSNP
rs145119691 2188 dbSNP
rs1047957 2189 dbSNP
rs1185696727 2192 dbSNP
rs1334086890 2201 dbSNP
rs1468882628 2222 dbSNP
rs1047974275 2225 dbSNP
rs4474880 2228 dbSNP
rs944893251 2242 dbSNP
rs1184030244 2247 dbSNP
rs1446366499 2260 dbSNP
rs147600742 2265 dbSNP
rs1040489406 2267 dbSNP
rs778410616 2268 dbSNP
rs1482938629 2276 dbSNP
rs570787538 2277 dbSNP
rs1405946379 2278 dbSNP
rs749727699 2290 dbSNP
rs1306731549 2294 dbSNP
rs1402633747 2294 dbSNP
rs541035302 2296 dbSNP
rs1375205201 2298 dbSNP
rs549814863 2313 dbSNP
rs1452585508 2325 dbSNP
rs559842043 2326 dbSNP
rs1356699083 2327 dbSNP
rs893146104 2329 dbSNP
rs1344306874 2331 dbSNP
rs1163946824 2334 dbSNP
rs1446272356 2340 dbSNP
rs116721618 2341 dbSNP
rs1036307961 2344 dbSNP
rs552577718 2345 dbSNP
rs1211949840 2349 dbSNP
rs1223532250 2349 dbSNP
rs930532648 2349 dbSNP
rs1290046664 2358 dbSNP
rs1225111350 2363 dbSNP
rs1286361227 2364 dbSNP
rs1297089200 2365 dbSNP
rs1346809206 2365 dbSNP
rs554390360 2366 dbSNP
rs1049248887 2367 dbSNP
rs1303328941 2369 dbSNP
rs1426195182 2370 dbSNP
rs966591233 2378 dbSNP
rs570762566 2388 dbSNP
rs1462430920 2389 dbSNP
rs1374764556 2394 dbSNP
rs149020620 2401 dbSNP
rs1034876634 2407 dbSNP
rs755017936 2408 dbSNP
rs1267191264 2411 dbSNP
rs534060762 2413 dbSNP
rs990619363 2414 dbSNP
rs1009768357 2421 dbSNP
rs1253646195 2423 dbSNP
rs1225905766 2426 dbSNP
rs1181045392 2433 dbSNP
rs772430734 2437 dbSNP
rs1406381329 2438 dbSNP
rs143032252 2443 dbSNP
rs1322615815 2445 dbSNP
rs1391810796 2446 dbSNP
rs983054743 2447 dbSNP
rs908146923 2449 dbSNP
rs1471230901 2452 dbSNP
rs968151114 2459 dbSNP
rs944986358 2468 dbSNP
rs1481536533 2471 dbSNP
rs1179427310 2472 dbSNP
rs1394703003 2482 dbSNP
rs1308058820 2484 dbSNP
rs1438702110 2485 dbSNP
rs1175945399 2491 dbSNP
rs576727742 2492 dbSNP
rs372221252 2493 dbSNP
rs1040583177 2494 dbSNP
rs922161321 2498 dbSNP
rs1243163037 2500 dbSNP
rs1224861721 2503 dbSNP
rs1477999549 2505 dbSNP
rs932132001 2505 dbSNP
rs1028795750 2508 dbSNP
rs545823825 2518 dbSNP
rs1239364652 2526 dbSNP
rs1443759243 2528 dbSNP
rs1337243741 2542 dbSNP
rs1309448456 2544 dbSNP
rs1369830517 2552 dbSNP
rs1231685106 2554 dbSNP
rs574700880 2565 dbSNP
rs1305317414 2571 dbSNP
rs1054550068 2574 dbSNP
rs764034876 2575 dbSNP
rs946084761 2576 dbSNP
rs1404030887 2579 dbSNP
rs912553372 2582 dbSNP
rs1041769657 2583 dbSNP
rs907184497 2589 dbSNP
rs961403100 2591 dbSNP
rs1439564767 2592 dbSNP
rs971972101 2595 dbSNP
rs1459562555 2606 dbSNP
rs1003502712 2619 dbSNP
rs1205297806 2620 dbSNP
rs1452789126 2630 dbSNP
rs1352466340 2634 dbSNP
rs1277549651 2636 dbSNP
rs930443988 2639 dbSNP
rs1195779958 2640 dbSNP
rs1048905595 2642 dbSNP
rs1034929008 2644 dbSNP
rs1450397604 2644 dbSNP
rs1192077130 2645 dbSNP
rs1333607562 2646 dbSNP
rs894986430 2649 dbSNP
rs1387467861 2650 dbSNP
rs1157209131 2656 dbSNP
rs185523795 2657 dbSNP
rs1399265065 2669 dbSNP
rs1012453667 2670 dbSNP
rs1185898683 2671 dbSNP
rs1466696960 2673 dbSNP
rs1436190118 2675 dbSNP
rs1193359022 2676 dbSNP
rs1331409369 2679 dbSNP
rs937763146 2681 dbSNP
rs1056177808 2686 dbSNP
rs1215472153 2686 dbSNP
rs1359838551 2701 dbSNP
rs191466773 2702 dbSNP
rs151316425 2703 dbSNP
rs983148213 2704 dbSNP
rs760870092 2720 dbSNP
rs1431637085 2726 dbSNP
rs534878557 2728 dbSNP
rs1014564705 2730 dbSNP
rs527893077 2735 dbSNP
rs1341410695 2738 dbSNP
rs1219229570 2740 dbSNP
rs965679694 2743 dbSNP
rs976336684 2745 dbSNP
rs1467252139 2747 dbSNP
rs11898877 2749 dbSNP
rs564625462 2759 dbSNP
rs1476079321 2761 dbSNP
rs1239890724 2762 dbSNP
rs1028471130 2769 dbSNP
rs764046043 2771 dbSNP
rs1191528114 2780 dbSNP
rs990696983 2786 dbSNP
rs1270759994 2792 dbSNP
rs1375238014 2793 dbSNP
rs1220026826 2795 dbSNP
rs1478416828 2799 dbSNP
rs1321027146 2806 dbSNP
rs914735134 2818 dbSNP
rs1008303036 2819 dbSNP
rs1019749757 2826 dbSNP
rs1164915133 2828 dbSNP
rs776676553 2829 dbSNP
rs928301143 2842 dbSNP
rs961328485 2844 dbSNP
rs946137678 2846 dbSNP
rs1416505947 2849 dbSNP
rs761759258 2856 dbSNP
rs1434821401 2868 dbSNP
rs1349685571 2869 dbSNP
rs1459424319 2879 dbSNP
rs907237080 2881 dbSNP
rs541740180 2883 dbSNP
rs1026213207 2887 dbSNP
rs1480542438 2888 dbSNP
rs1431038834 2901 dbSNP
rs1056386442 2905 dbSNP
rs1391037394 2907 dbSNP
rs116687356 2909 dbSNP
rs1206470541 2915 dbSNP
rs926470888 2918 dbSNP
rs781004085 2919 dbSNP
rs937882805 2925 dbSNP
rs1315938719 2928 dbSNP
rs867252068 2928 dbSNP
rs188610361 2929 dbSNP
rs991833569 2930 dbSNP
rs1367260551 2933 dbSNP
rs1280516315 2937 dbSNP
rs917675943 2941 dbSNP
rs1398822102 2943 dbSNP
rs1342191190 2949 dbSNP
rs192281935 2954 dbSNP
rs1004626623 2955 dbSNP
rs1173436567 2964 dbSNP
rs1432252702 2964 dbSNP
rs1014618510 2971 dbSNP
rs1178803898 2972 dbSNP
rs1437717994 2975 dbSNP
rs936924182 2982 dbSNP
rs183506554 2983 dbSNP
rs4500942 2996 dbSNP
rs1257836648 2997 dbSNP
rs1208210690 3002 dbSNP
rs568217832 3003 dbSNP
rs1285389343 3004 dbSNP
rs545547882 3009 dbSNP
rs1375174986 3011 dbSNP
rs897262555 3037 dbSNP
rs1350258324 3039 dbSNP
rs1453991995 3040 dbSNP
rs1384292881 3041 dbSNP
rs1300631601 3053 dbSNP
rs994277485 3055 dbSNP
rs1203652580 3063 dbSNP
rs1264293362 3066 dbSNP
rs1488853876 3067 dbSNP
rs1026974989 3077 dbSNP
rs1187784783 3079 dbSNP
rs953788614 3087 dbSNP
rs186732999 3088 dbSNP
rs1379487259 3094 dbSNP
rs1184051636 3097 dbSNP
rs984723296 3110 dbSNP
rs1473915122 3116 dbSNP
rs564412857 3117 dbSNP
rs140622590 3120 dbSNP
rs145909161 3122 dbSNP
rs967532918 3123 dbSNP
rs1219112238 3127 dbSNP
rs1156516647 3131 dbSNP
rs1351880428 3137 dbSNP
rs748760871 3137 dbSNP
rs138401505 3138 dbSNP
rs1420099373 3144 dbSNP
rs1309926232 3148 dbSNP
rs1394998605 3152 dbSNP
rs71415140 3153 dbSNP
rs556226787 3156 dbSNP
rs945112645 3157 dbSNP
rs757872802 3161 dbSNP
rs1359595520 3170 dbSNP
rs920202229 3172 dbSNP
rs924966502 3175 dbSNP
rs576192707 3183 dbSNP
rs1164023774 3186 dbSNP
rs1423278492 3187 dbSNP
rs779499129 3189 dbSNP
rs1049970633 3196 dbSNP
rs1262918447 3200 dbSNP
rs1056171394 3205 dbSNP
rs890043153 3207 dbSNP
rs1335317220 3222 dbSNP
rs1264148670 3223 dbSNP
rs1244736575 3229 dbSNP
rs1307495984 3230 dbSNP
rs1237135648 3231 dbSNP
rs944159326 3232 dbSNP
rs915900060 3236 dbSNP
rs947986930 3237 dbSNP
rs1303500004 3240 dbSNP
rs1041215533 3244 dbSNP
rs1388349033 3245 dbSNP
rs1354781963 3249 dbSNP
rs1210650553 3251 dbSNP
rs1278747016 3258 dbSNP
rs535506773 3260 dbSNP
rs887644592 3273 dbSNP
rs1476947919 3275 dbSNP
rs547791635 3276 dbSNP
rs1036091009 3279 dbSNP
rs1265707803 3280 dbSNP
rs1418065610 3284 dbSNP
rs79475359 3285 dbSNP
rs1481278466 3298 dbSNP
rs1259423569 3301 dbSNP
rs1196250894 3304 dbSNP
rs1316898195 3312 dbSNP
rs774963494 3312 dbSNP
rs1381785924 3314 dbSNP
rs772314308 3336 dbSNP
rs997265791 3342 dbSNP
rs1172807859 3343 dbSNP
rs775852455 3348 dbSNP
rs1329081143 3364 dbSNP
rs953071892 3365 dbSNP
rs1402425775 3368 dbSNP
rs1012276604 3371 dbSNP
rs1021845561 3372 dbSNP
rs967542751 3380 dbSNP
rs116471777 3382 dbSNP
rs541272659 3383 dbSNP
rs1013482682 3389 dbSNP
rs1376267442 3392 dbSNP
rs150054031 3392 dbSNP
rs1420171643 3394 dbSNP
rs960140478 3399 dbSNP
rs1177337877 3401 dbSNP
rs201171306 3402 dbSNP
rs1263234850 3403 dbSNP
rs772544857 3403 dbSNP
rs1342524787 3404 dbSNP
rs6742953 3404 dbSNP
rs1306943383 3405 dbSNP
rs1348853426 3405 dbSNP
rs76774828 3405 dbSNP
rs776040842 3405 dbSNP
rs977809169 3405 dbSNP
rs77836898 3407 dbSNP
rs1314380675 3409 dbSNP
rs1416376392 3412 dbSNP
rs866380322 3420 dbSNP
rs957694440 3421 dbSNP
rs1479989644 3422 dbSNP
rs1193604708 3423 dbSNP
rs1239566402 3429 dbSNP
rs1382559656 3431 dbSNP
rs985543325 3435 dbSNP
rs1439685847 3440 dbSNP
rs1457917555 3441 dbSNP
rs1189068777 3444 dbSNP
rs1440318951 3445 dbSNP
rs910912672 3445 dbSNP
rs577963860 3446 dbSNP
rs1041354346 3451 dbSNP
rs1434698015 3452 dbSNP
rs918755476 3455 dbSNP
rs1372463466 3457 dbSNP
rs1460483087 3459 dbSNP
rs1333417200 3461 dbSNP
rs1401171683 3462 dbSNP
rs543389404 3463 dbSNP
rs1455015314 3468 dbSNP
rs1338798670 3471 dbSNP
rs139583386 3477 dbSNP
rs1362833586 3487 dbSNP
rs1370115018 3490 dbSNP
rs915934640 3496 dbSNP
rs1415221238 3499 dbSNP
rs1295446084 3501 dbSNP
rs1001517836 3504 dbSNP
rs1221057429 3505 dbSNP
rs1056183588 3507 dbSNP
rs895851950 3508 dbSNP
rs1193376136 3509 dbSNP
rs1489098377 3510 dbSNP
rs1259396238 3515 dbSNP
rs1457867444 3517 dbSNP
rs563375142 3521 dbSNP
rs1490486237 3522 dbSNP
rs1291874285 3523 dbSNP
rs529271802 3524 dbSNP
rs1024889325 3531 dbSNP
rs1354265734 3531 dbSNP
rs73967548 3550 dbSNP
rs1049456782 3551 dbSNP
rs999774691 3556 dbSNP
rs768871440 3558 dbSNP
rs1350861015 3559 dbSNP
rs940542735 3569 dbSNP
rs1036183266 3570 dbSNP
rs1412433432 3572 dbSNP
rs79528435 3578 dbSNP
rs910871210 3592 dbSNP
rs1421088310 3603 dbSNP
rs200646743 3606 dbSNP
rs761812602 3606 dbSNP
rs997714257 3611 dbSNP
rs537649814 3616 dbSNP
rs552768395 3621 dbSNP
rs976961644 3623 dbSNP
rs563710437 3628 dbSNP
rs1461002447 3637 dbSNP
rs1451032783 3642 dbSNP
rs930098058 3645 dbSNP
rs1199401816 3646 dbSNP
rs759612060 3656 dbSNP
rs910072171 3675 dbSNP
rs765331666 3682 dbSNP
rs1218248495 3692 dbSNP
rs1368671735 3700 dbSNP
rs1277036542 3702 dbSNP
rs888788541 3706 dbSNP
rs1055920102 3712 dbSNP
rs1466688964 3718 dbSNP
rs1397542356 3724 dbSNP
rs1360366032 3738 dbSNP
rs751465564 3742 dbSNP
rs1011203003 3743 dbSNP
rs1414739537 3744 dbSNP
rs1427003409 3745 dbSNP
rs895819439 3754 dbSNP
rs1477643363 3758 dbSNP
rs1279403166 3762 dbSNP
rs182580668 3765 dbSNP
rs1232185021 3774 dbSNP
rs1287243364 3777 dbSNP
rs570705599 3787 dbSNP
rs967592933 3791 dbSNP
rs1256245976 3794 dbSNP
rs539780614 3795 dbSNP
rs6733645 3796 dbSNP
rs1221896569 3798 dbSNP
rs1035883423 3803 dbSNP
rs569638788 3814 dbSNP
rs992014848 3815 dbSNP
rs1449658359 3817 dbSNP
rs1373939311 3818 dbSNP
rs1023014822 3819 dbSNP
rs1448259584 3822 dbSNP
rs577547412 3826 dbSNP
rs1173543660 3828 dbSNP
rs751282196 3832 dbSNP
rs984111400 3833 dbSNP
rs529262166 3842 dbSNP
rs908538362 3845 dbSNP
rs11305290 3850 dbSNP
rs199700260 3850 dbSNP
rs869113392 3850 dbSNP
rs200541735 3851 dbSNP
rs1185927965 3854 dbSNP
rs965007242 3866 dbSNP
rs940638932 3867 dbSNP
rs1416114900 3870 dbSNP
rs1483690303 3871 dbSNP
rs971954683 3890 dbSNP
rs923142847 3893 dbSNP
rs976426272 3895 dbSNP
rs1347528502 3900 dbSNP
rs752120123 3902 dbSNP
rs1287208534 3905 dbSNP
rs1406141358 3906 dbSNP
rs1158740601 3907 dbSNP
rs1352202014 3914 dbSNP
rs1343741306 3917 dbSNP
rs1421908789 3932 dbSNP
rs1380745991 3936 dbSNP
rs1299300203 3939 dbSNP
rs933135436 3943 dbSNP
rs188286391 3948 dbSNP
rs372215743 3953 dbSNP
rs984421588 3953 dbSNP
rs865840758 3954 dbSNP
rs947053867 3965 dbSNP
rs937566534 3968 dbSNP
rs1485500934 3976 dbSNP
rs1264309130 3977 dbSNP
rs991944591 3979 dbSNP
rs1228520039 3982 dbSNP
rs1260606202 3984 dbSNP
rs1283138388 3985 dbSNP
rs1246167748 3990 dbSNP
rs1351153472 3995 dbSNP
rs1218564315 3998 dbSNP
rs1042771658 3999 dbSNP
rs1334142372 4005 dbSNP
rs1286593936 4008 dbSNP
rs879385240 4017 dbSNP
rs950026794 4019 dbSNP
rs767129473 4023 dbSNP
rs1397860345 4031 dbSNP
rs1293974880 4032 dbSNP
rs999147005 4035 dbSNP
rs1035933927 4036 dbSNP
rs1351674649 4037 dbSNP
rs935237161 4041 dbSNP
rs895978617 4052 dbSNP
rs902542057 4053 dbSNP
rs1196156319 4056 dbSNP
rs1023487399 4073 dbSNP
rs1261485421 4078 dbSNP
rs1210940090 4086 dbSNP
rs77016088 4115 dbSNP
rs1176763903 4117 dbSNP
rs555397814 4120 dbSNP
rs13387420 4126 dbSNP
rs752284507 4127 dbSNP
rs1375257970 4136 dbSNP
rs1325579329 4145 dbSNP
rs951116072 4148 dbSNP
rs1388443165 4151 dbSNP
rs1365464265 4154 dbSNP
rs984778447 4157 dbSNP
rs971964256 4169 dbSNP
rs1017190101 4189 dbSNP
rs1401129447 4194 dbSNP
rs535216282 4198 dbSNP
rs192825927 4201 dbSNP
rs1336779247 4211 dbSNP
rs1464313791 4231 dbSNP
rs1360331254 4234 dbSNP
rs865898757 4235 dbSNP
rs757747653 4236 dbSNP
rs933169506 4236 dbSNP
rs991631561 4238 dbSNP
rs1193596878 4241 dbSNP
rs917309267 4241 dbSNP
rs985952566 4247 dbSNP
rs1196355119 4249 dbSNP
rs950119991 4250 dbSNP
rs1256338336 4251 dbSNP
rs1235079212 4254 dbSNP
rs1374231643 4259 dbSNP
rs910363038 4265 dbSNP
rs577900196 4269 dbSNP
rs143008107 4270 dbSNP
rs947180859 4272 dbSNP
rs755633657 4274 dbSNP
rs924610992 4282 dbSNP
rs1309674755 4286 dbSNP
rs563642173 4287 dbSNP
rs867679376 4288 dbSNP
rs893734727 4291 dbSNP
rs1280652958 4298 dbSNP
rs1467866902 4306 dbSNP
rs1057394167 4309 dbSNP
rs1440912945 4319 dbSNP
rs1239463120 4324 dbSNP
rs942503223 4330 dbSNP
rs1436744177 4340 dbSNP
rs1256374255 4352 dbSNP
rs1201824257 4374 dbSNP
rs1342542058 4385 dbSNP
rs1039537370 4390 dbSNP
rs1240778267 4391 dbSNP
rs573659346 4392 dbSNP
rs1311523152 4393 dbSNP
rs1236915448 4398 dbSNP
rs1335284590 4401 dbSNP
rs997929065 4405 dbSNP
rs1013574645 4410 dbSNP
rs1179564253 4416 dbSNP
rs1374014753 4418 dbSNP
rs1023158970 4422 dbSNP
rs369704542 4423 dbSNP
rs1005628482 4426 dbSNP
rs1017575731 4427 dbSNP
rs185254195 4431 dbSNP
rs1013145407 4432 dbSNP
rs76114911 4442 dbSNP
rs1256498119 4451 dbSNP
rs79959972 4453 dbSNP
rs977437468 4457 dbSNP
rs1030678231 4468 dbSNP
rs954677614 4470 dbSNP
rs1204485004 4478 dbSNP
rs1349976854 4482 dbSNP
rs1284916081 4491 dbSNP
rs564095674 4505 dbSNP
rs1353844068 4513 dbSNP
rs1331693150 4514 dbSNP
rs747334626 4518 dbSNP
rs1230830186 4519 dbSNP
rs1276490646 4520 dbSNP
rs190166620 4529 dbSNP
rs193230080 4530 dbSNP
rs924315538 4533 dbSNP
rs1256226889 4534 dbSNP
rs1474006602 4536 dbSNP
rs934332125 4537 dbSNP
rs1193979496 4550 dbSNP
rs1478644477 4550 dbSNP
rs1260785899 4554 dbSNP
rs1214972014 4562 dbSNP
rs1039674689 4565 dbSNP
rs933818035 4566 dbSNP
rs1332796595 4567 dbSNP
rs377479594 4573 dbSNP
rs1046815054 4578 dbSNP
rs545610832 4581 dbSNP
rs1252614259 4585 dbSNP
rs1271134659 4590 dbSNP
rs916883673 4593 dbSNP
rs949039144 4594 dbSNP
rs117739583 4595 dbSNP
rs528885241 4597 dbSNP
rs1459380501 4604 dbSNP
rs1393105398 4614 dbSNP
rs1170881048 4617 dbSNP
rs1466917988 4622 dbSNP
rs894162379 4627 dbSNP
rs1475356110 4628 dbSNP
rs1478303745 4629 dbSNP
rs773200814 4630 dbSNP
rs1196671150 4632 dbSNP
rs1420818129 4637 dbSNP
rs1005636693 4638 dbSNP
rs1466746566 4643 dbSNP
rs571530956 4646 dbSNP
rs548749168 4652 dbSNP
rs1037096772 4655 dbSNP
rs971503074 4660 dbSNP
rs1346184796 4662 dbSNP
rs184811366 4664 dbSNP
rs998210410 4667 dbSNP
rs1369599948 4670 dbSNP
rs1389594121 4675 dbSNP
rs1331523919 4677 dbSNP
rs1448494560 4695 dbSNP
rs1352451459 4698 dbSNP
rs1169337513 4703 dbSNP
rs1029686234 4711 dbSNP
rs1325245845 4715 dbSNP
rs770842990 4727 dbSNP
rs990666032 4733 dbSNP
rs1453792113 4734 dbSNP
rs1394524750 4735 dbSNP
rs954182306 4741 dbSNP
rs1481670332 4746 dbSNP
rs1231353190 4754 dbSNP
rs1007509422 4757 dbSNP
rs1017902699 4771 dbSNP
rs1204101962 4774 dbSNP
rs1443299424 4779 dbSNP
rs1281245094 4784 dbSNP
rs1232741342 4786 dbSNP
rs1347842396 4792 dbSNP
rs1276238321 4797 dbSNP
rs188005088 4799 dbSNP
rs978566698 4808 dbSNP
rs530924450 4810 dbSNP
rs924368017 4814 dbSNP
rs1448373852 4815 dbSNP
rs955798854 4818 dbSNP
rs1360679124 4821 dbSNP
rs992986633 4824 dbSNP
rs916958423 4826 dbSNP
rs1433999162 4829 dbSNP
rs557849903 4832 dbSNP
rs1380782475 4835 dbSNP
rs180923783 4836 dbSNP
rs1420885335 4842 dbSNP
rs3815851 4844 dbSNP
rs1176825831 4848 dbSNP
rs910102206 4849 dbSNP
rs1260017508 4857 dbSNP
rs1291033180 4859 dbSNP
rs772775413 4864 dbSNP
rs1446844841 4866 dbSNP
rs941546214 4870 dbSNP
rs1192058171 4874 dbSNP
rs1037191381 4876 dbSNP
rs908396644 4878 dbSNP
rs1237302247 4879 dbSNP
rs767095463 4884 dbSNP
rs1193726593 4888 dbSNP
rs1367423887 4893 dbSNP
rs1456060543 4899 dbSNP
rs1228504527 4900 dbSNP
rs1380952018 4901 dbSNP
rs16830085 4904 dbSNP
rs1413895109 4913 dbSNP
rs1360930626 4914 dbSNP
rs894105894 4916 dbSNP
rs1391105448 4918 dbSNP
rs557224034 4919 dbSNP
rs1418868898 4924 dbSNP
rs1158531619 4926 dbSNP
rs1343508284 4926 dbSNP
rs1406149342 4927 dbSNP
rs574043026 4931 dbSNP
rs74714825 4933 dbSNP
rs907482664 4935 dbSNP
rs1475047326 4937 dbSNP
rs1342318018 4939 dbSNP
rs553128038 4947 dbSNP
rs1474619297 4949 dbSNP
rs1188795145 4964 dbSNP
rs541150645 4973 dbSNP
rs763689332 4977 dbSNP
rs1031825097 4990 dbSNP
rs753344916 5008 dbSNP
rs145031042 5011 dbSNP
rs904410627 5012 dbSNP
rs1018111273 5013 dbSNP
rs1000098846 5014 dbSNP
rs758836253 5018 dbSNP
rs1279935080 5021 dbSNP
rs1350329222 5021 dbSNP
rs1361252337 5027 dbSNP
rs1294066480 5032 dbSNP
rs545141346 5033 dbSNP
rs976095443 5042 dbSNP
rs955852105 5044 dbSNP
rs1288661646 5049 dbSNP
rs1488885501 5057 dbSNP
rs1210879554 5060 dbSNP
rs745912568 5060 dbSNP
rs992600852 5062 dbSNP
rs1261588210 5063 dbSNP
rs908364439 5068 dbSNP
rs535957246 5077 dbSNP
rs1318207584 5082 dbSNP
rs533118431 5084 dbSNP
rs1224905837 5085 dbSNP
rs915673702 5086 dbSNP
rs780572608 5091 dbSNP
rs980147706 5094 dbSNP
rs1443032964 5096 dbSNP
rs1373279441 5105 dbSNP
rs1324014953 5111 dbSNP
rs909540618 5116 dbSNP
rs1438801006 5117 dbSNP
rs1300141314 5125 dbSNP
rs1045352599 5132 dbSNP
rs1372880224 5142 dbSNP
rs1177404365 5143 dbSNP
rs56874864 5144 dbSNP
rs1392692032 5146 dbSNP
rs1362265857 5151 dbSNP
rs1192520771 5155 dbSNP
rs1420227335 5162 dbSNP
rs1302257103 5163 dbSNP
rs1193722862 5169 dbSNP
rs1252179607 5169 dbSNP
rs934919039 5170 dbSNP
rs1053817067 5171 dbSNP
rs1236363920 5172 dbSNP
rs751894478 5179 dbSNP
rs563570981 5181 dbSNP
rs1335059765 5186 dbSNP
rs934118198 5189 dbSNP
rs138817656 5214 dbSNP
rs1303835965 5218 dbSNP
rs889842544 5218 dbSNP
rs1437105120 5221 dbSNP
rs942728576 5233 dbSNP
rs1354937592 5237 dbSNP
rs1439704035 5249 dbSNP
rs1365047110 5259 dbSNP
rs1179211341 5263 dbSNP
rs747340831 5264 dbSNP
rs149342204 5266 dbSNP
rs1212691839 5271 dbSNP
rs1484585464 5273 dbSNP
rs1279432525 5290 dbSNP
rs903855118 5292 dbSNP
rs1481965616 5297 dbSNP
rs1201695617 5303 dbSNP
rs1000149557 5310 dbSNP
rs1351473941 5312 dbSNP
rs900608894 5319 dbSNP
rs1237118442 5326 dbSNP
rs1031561317 5327 dbSNP
rs3821323 5345 dbSNP
rs528092485 5352 dbSNP
rs1416970697 5358 dbSNP
rs1419886152 5362 dbSNP
rs1353959780 5365 dbSNP
rs1030324808 5367 dbSNP
rs950729161 5368 dbSNP
rs1176466490 5384 dbSNP
rs982717809 5394 dbSNP
rs1381924623 5400 dbSNP
rs1440097741 5413 dbSNP
rs551149455 5419 dbSNP
rs148515958 5421 dbSNP
rs1024072223 5422 dbSNP
rs555533849 5430 dbSNP
rs185280331 5433 dbSNP
rs1173200276 5436 dbSNP
rs1448700580 5437 dbSNP
rs567606761 5439 dbSNP
rs147442219 5445 dbSNP
rs1444817025 5451 dbSNP
rs1350090341 5452 dbSNP
rs1273974197 5458 dbSNP
rs553653718 5471 dbSNP
rs962343601 5479 dbSNP
rs1353939753 5480 dbSNP
rs369881653 5482 dbSNP
rs529074026 5482 dbSNP
rs762875302 5482 dbSNP
rs934321919 5485 dbSNP
rs972964538 5488 dbSNP
rs1316880799 5489 dbSNP
rs1381095951 5497 dbSNP
rs1394591419 5502 dbSNP
rs748366472 5507 dbSNP
rs1386593081 5515 dbSNP
rs1299754485 5519 dbSNP
rs573104542 5535 dbSNP
rs1234655548 5536 dbSNP
rs1168333856 5542 dbSNP
rs947557506 5546 dbSNP
rs1240244414 5563 dbSNP
rs1192388426 5569 dbSNP
rs545392619 5571 dbSNP
rs777842433 5573 dbSNP
rs189876665 5575 dbSNP
rs575852684 5581 dbSNP
rs886407960 5599 dbSNP
rs1215479471 5601 dbSNP
rs903863658 5603 dbSNP
rs1458016870 5611 dbSNP
rs935280438 5618 dbSNP
rs1053042800 5620 dbSNP
rs1297324500 5621 dbSNP
rs759716836 5633 dbSNP
rs1327377246 5634 dbSNP
rs1438230603 5636 dbSNP
rs1393218154 5637 dbSNP
rs868387072 5640 dbSNP
rs181430799 5649 dbSNP
rs563507916 5650 dbSNP
rs1434828569 5655 dbSNP
rs1417151196 5663 dbSNP
rs1015485813 5665 dbSNP
rs1454711119 5665 dbSNP
rs891691424 5669 dbSNP
rs529101429 5675 dbSNP
rs1014161676 5676 dbSNP
rs11549865 5683 dbSNP
rs1422932795 5692 dbSNP
rs200185082 5693 dbSNP
rs530043511 5694 dbSNP
rs995464542 5694 dbSNP
rs969902436 5695 dbSNP
rs139659406 5696 dbSNP
rs905691820 5704 dbSNP
rs928397386 5713 dbSNP
rs559607489 5718 dbSNP
rs955705906 5723 dbSNP
rs1306301677 5727 dbSNP
rs145235963 5727 dbSNP
rs1231389201 5729 dbSNP
rs1369618781 5730 dbSNP
rs563986406 5734 dbSNP
rs1444005690 5736 dbSNP
rs1292118730 5737 dbSNP
rs1352542946 5738 dbSNP
rs1327984249 5739 dbSNP
rs1435238840 5746 dbSNP
rs551010546 5752 dbSNP
rs1452591267 5756 dbSNP
rs1424615589 5766 dbSNP
rs1177992662 5768 dbSNP
rs993771311 5769 dbSNP
rs1471302686 5777 dbSNP
rs564616840 5783 dbSNP
rs774293015 5785 dbSNP
rs530555769 5788 dbSNP
rs550278575 5791 dbSNP
rs1204822210 5792 dbSNP
rs987050810 5793 dbSNP
rs1486222379 5798 dbSNP
rs911415572 5802 dbSNP
rs922092755 5803 dbSNP
rs1387847006 5807 dbSNP
rs1278136757 5811 dbSNP
rs867560593 5812 dbSNP
rs147155061 5815 dbSNP
rs1051819064 5816 dbSNP
rs1370793864 5827 dbSNP
rs1045390 5832 dbSNP
rs537007272 5834 dbSNP
rs1045391 5836 dbSNP
rs1415096206 5836 dbSNP
rs1128380 5843 dbSNP
rs376783666 5845 dbSNP
rs536854123 5845 dbSNP
rs1434098668 5848 dbSNP
rs565340069 5848 dbSNP
rs1358617208 5852 dbSNP
rs1159984861 5864 dbSNP
rs1220454012 5865 dbSNP
rs1406016315 5866 dbSNP
rs899195729 5868 dbSNP
rs979515991 5871 dbSNP
rs995378093 5874 dbSNP
rs1186425043 5877 dbSNP
rs117758972 5880 dbSNP
rs1199976756 5882 dbSNP
rs1242172671 5883 dbSNP
rs969828637 5886 dbSNP
rs1262424222 5887 dbSNP
rs1002676562 5893 dbSNP
rs1336663774 5896 dbSNP
rs1476852975 5896 dbSNP
rs1291253577 5898 dbSNP
rs548217969 5899 dbSNP
rs751335301 5900 dbSNP
rs1424474682 5901 dbSNP
rs112181069 5902 dbSNP
rs397761955 5902 dbSNP
rs71309005 5902 dbSNP
rs78505190 5902 dbSNP
rs34202895 5903 dbSNP
rs1423459245 5908 dbSNP
rs1158691193 5923 dbSNP
rs1462229767 5927 dbSNP
rs1163019655 5931 dbSNP
rs1420438732 5932 dbSNP
rs1351923883 5937 dbSNP
rs1052466667 5941 dbSNP
rs1262958092 5945 dbSNP
rs917908628 5946 dbSNP
rs1298085805 5947 dbSNP
rs1359214266 5954 dbSNP
rs1246946976 5962 dbSNP
rs1021702125 5965 dbSNP
rs543704476 5971 dbSNP
rs1279534066 5973 dbSNP
rs1243742600 5985 dbSNP
rs1307866592 5989 dbSNP
rs1045641059 6012 dbSNP
rs1227324923 6015 dbSNP
rs1310137238 6018 dbSNP
rs139523535 6025 dbSNP
rs1222980694 6028 dbSNP
rs1285103241 6038 dbSNP
rs1001281662 6040 dbSNP
rs1457666989 6043 dbSNP
rs111383294 6052 dbSNP
rs575792981 6054 dbSNP
rs538307740 6055 dbSNP
rs1242764845 6059 dbSNP
rs771957768 6063 dbSNP
rs1193660990 6071 dbSNP
rs1180269230 6077 dbSNP
rs1250679935 6078 dbSNP
rs1208886394 6085 dbSNP
rs1480830255 6093 dbSNP
rs1252924578 6094 dbSNP
rs1416275018 6096 dbSNP
rs1424713952 6102 dbSNP
rs1304101197 6103 dbSNP
rs1235068077 6109 dbSNP
rs1373301031 6114 dbSNP
rs1299446048 6121 dbSNP
rs1025286744 6122 dbSNP
rs571038871 6124 dbSNP
rs1397616549 6133 dbSNP
rs574111858 6140 dbSNP
rs1460808197 6143 dbSNP
rs1370440027 6154 dbSNP
rs1174818070 6156 dbSNP
rs78166003 6158 dbSNP
rs1018489764 6169 dbSNP
rs149659088 6175 dbSNP
rs1299352583 6189 dbSNP
rs1345192860 6196 dbSNP
rs73005906 6202 dbSNP
rs117915085 6204 dbSNP
rs1380856404 6211 dbSNP
rs117481182 6212 dbSNP
rs1213004793 6220 dbSNP
rs1350135938 6220 dbSNP
rs1308255424 6226 dbSNP
rs564507425 6231 dbSNP
rs1232773676 6233 dbSNP
rs764119444 6235 dbSNP
rs988223656 6237 dbSNP
rs4592848 6238 dbSNP
rs1408314593 6246 dbSNP
rs949378441 6254 dbSNP
rs1284878149 6256 dbSNP
rs1441879070 6259 dbSNP
rs1208144385 6266 dbSNP
rs1373064761 6266 dbSNP
rs1035922126 6272 dbSNP
rs1453884646 6275 dbSNP
rs891661644 6275 dbSNP
rs1239339234 6277 dbSNP
rs1461921436 6280 dbSNP
rs1010399658 6292 dbSNP
rs1258042879 6293 dbSNP
rs550217173 6294 dbSNP
rs1178317809 6305 dbSNP
rs1046061663 6310 dbSNP
rs1484676591 6321 dbSNP
rs1199902819 6324 dbSNP
rs761340771 6324 dbSNP
rs754737461 6326 dbSNP
rs1351497808 6330 dbSNP
rs145448624 6332 dbSNP
rs1226857404 6333 dbSNP
rs1038195693 6341 dbSNP
rs747012751 6341 dbSNP
rs974422998 6342 dbSNP
rs1294332007 6351 dbSNP
rs148832856 6355 dbSNP
rs1028686065 6358 dbSNP
rs1159608619 6364 dbSNP
rs144505282 6375 dbSNP
rs1485155987 6377 dbSNP
rs987756198 6379 dbSNP
rs186883386 6384 dbSNP
rs755365451 6385 dbSNP
rs1173301808 6387 dbSNP
rs1456413914 6388 dbSNP
rs1418275088 6391 dbSNP
rs929766159 6394 dbSNP
rs1474120533 6399 dbSNP
rs1046777128 6401 dbSNP
rs1412740339 6407 dbSNP
rs191731380 6417 dbSNP
rs948035177 6426 dbSNP
rs1330284551 6428 dbSNP
rs1045028044 6429 dbSNP
rs1448759965 6430 dbSNP
rs1274066067 6436 dbSNP
rs1235486479 6437 dbSNP
rs1354698686 6438 dbSNP
rs753001549 6456 dbSNP
rs1007870525 6457 dbSNP
rs1018956005 6461 dbSNP
rs1228873012 6466 dbSNP
rs756333568 6467 dbSNP
rs1433738502 6468 dbSNP
rs146637145 6470 dbSNP
rs776330149 6474 dbSNP
rs1032552548 6475 dbSNP
rs938594698 6475 dbSNP
rs1280808263 6482 dbSNP
rs1168422836 6484 dbSNP
rs1476374763 6485 dbSNP
rs183266582 6486 dbSNP
rs1324384863 6488 dbSNP
rs1186699596 6489 dbSNP
rs186508389 6491 dbSNP
rs1025017583 6500 dbSNP
rs1459332133 6501 dbSNP
rs1182953642 6511 dbSNP
rs971152614 6515 dbSNP
rs1289663140 6516 dbSNP
rs1196860042 6520 dbSNP
rs1342021849 6520 dbSNP
rs555091629 6521 dbSNP
rs1296081364 6522 dbSNP
rs1246530027 6529 dbSNP
rs141328648 6536 dbSNP
rs1010080296 6537 dbSNP
rs536038058 6543 dbSNP
rs1193487055 6545 dbSNP
rs1430722645 6549 dbSNP
rs1371107647 6550 dbSNP
rs1469873180 6552 dbSNP
rs1169468198 6554 dbSNP
rs749347416 6557 dbSNP
rs757335715 6559 dbSNP
rs1329351357 6560 dbSNP
rs926604090 6561 dbSNP
rs1329265527 6562 dbSNP
rs1330375253 6563 dbSNP
rs937282770 6566 dbSNP
rs1395835491 6568 dbSNP
rs1434133770 6568 dbSNP
rs1276547955 6572 dbSNP
rs1346181997 6574 dbSNP
rs1193099280 6583 dbSNP
rs973958185 6589 dbSNP
rs778753259 6600 dbSNP
rs553167824 6601 dbSNP
rs55895154 6603 dbSNP
rs1256290560 6606 dbSNP
rs1320230698 6609 dbSNP
rs954398220 6615 dbSNP
rs1273034641 6621 dbSNP
rs1205147839 6632 dbSNP
rs1196668395 6635 dbSNP
rs1281894219 6639 dbSNP
rs1009521714 6642 dbSNP
rs1366412354 6645 dbSNP
rs544878064 6653 dbSNP
rs962491157 6657 dbSNP
rs1450253708 6664 dbSNP
rs1348417975 6667 dbSNP
rs1307328195 6668 dbSNP
rs890852594 6669 dbSNP
rs920787411 6674 dbSNP
rs372312662 6680 dbSNP
rs969434012 6681 dbSNP
rs1224339931 6685 dbSNP
rs943772159 6689 dbSNP
rs189674251 6702 dbSNP
rs1473767877 6703 dbSNP
rs368578281 6708 dbSNP
rs1480451066 6709 dbSNP
rs1169719618 6716 dbSNP
rs990050772 6736 dbSNP
rs1239745014 6737 dbSNP
rs899500097 6743 dbSNP
rs1420896173 6747 dbSNP
rs1476189045 6748 dbSNP
rs145117760 6753 dbSNP
rs772045661 6754 dbSNP
rs779054817 6757 dbSNP
rs945978013 6757 dbSNP
rs1032562457 6767 dbSNP
rs1233694016 6769 dbSNP
rs1357241656 6773 dbSNP
rs1042882444 6777 dbSNP
rs75942488 6778 dbSNP
rs904391110 6780 dbSNP
rs778376081 6801 dbSNP
rs1459057393 6806 dbSNP
rs1410187142 6807 dbSNP
rs1158825363 6811 dbSNP
rs1304822884 6813 dbSNP
rs1009712258 6814 dbSNP
rs1366087294 6816 dbSNP
rs1399369663 6817 dbSNP
rs148318449 6819 dbSNP
rs890089872 6820 dbSNP
rs182339141 6823 dbSNP
rs981245169 6828 dbSNP
rs1463228509 6830 dbSNP
rs115072828 6833 dbSNP
rs371755115 6834 dbSNP
rs1310470138 6850 dbSNP
rs556507323 6851 dbSNP
rs919820878 6852 dbSNP
rs532775091 6857 dbSNP
rs761271769 6858 dbSNP
rs1386677856 6862 dbSNP
rs1488234785 6868 dbSNP
rs1462242349 6871 dbSNP
rs1352043834 6874 dbSNP
rs1163292245 6885 dbSNP
rs1215171276 6888 dbSNP
rs1423790253 6891 dbSNP
rs912368978 6893 dbSNP
rs1027774090 6894 dbSNP
rs1260393222 6898 dbSNP
rs1419588979 6904 dbSNP
rs969570266 6910 dbSNP
rs980784731 6920 dbSNP
rs943844280 6922 dbSNP
rs1367549155 6926 dbSNP
rs1039854846 6928 dbSNP
rs1489336750 6933 dbSNP
rs1471632136 6934 dbSNP
rs1165203912 6940 dbSNP
rs1220710812 6944 dbSNP
rs1307956376 6953 dbSNP
rs1276729531 6954 dbSNP
rs368829239 6954 dbSNP
rs5835367 6954 dbSNP
rs796514768 6954 dbSNP
rs201907961 6955 dbSNP
rs920940227 6956 dbSNP
rs1370145529 6957 dbSNP
rs936281089 6961 dbSNP
rs988139658 6971 dbSNP
rs1382136288 6975 dbSNP
rs1419006528 6975 dbSNP
rs539327497 6977 dbSNP
rs552856558 6984 dbSNP
rs1427243270 6985 dbSNP
rs1389086301 6986 dbSNP
rs1010218231 6994 dbSNP
rs1333697047 6995 dbSNP
rs371767111 6996 dbSNP
rs925735119 6997 dbSNP
rs1046582084 6999 dbSNP
rs376792989 7001 dbSNP
rs931809083 7016 dbSNP
rs775211958 7020 dbSNP
rs187752577 7022 dbSNP
rs1203010336 7025 dbSNP
rs1033690940 7029 dbSNP
rs963367467 7032 dbSNP
rs1274068814 7039 dbSNP
rs1234212642 7046 dbSNP