miRTarBase - #MIRT571123 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UBE2H   
Synonyms E2-20K, GID3, UBC8, UBCH, UBCH2
Description ubiquitin conjugating enzyme E2 H
Transcript NM_003344   
Other Transcripts NM_182697   
Expression
Putative miRNA Targets on UBE2H
3'UTR of UBE2H
(miRNA target sites are highlighted)
>UBE2H|NM_003344|3'UTR
   1 TAGAAAAAGCACCTGCTTTTCAGAAAGACTATTATTTCCTAACCATGAGAAGCAGACTATAATATTCATATTTAAACAAA
  81 GCAATTTTTTTTATTACTAAACAAGGTTTTTATGAATAATAGCATTGATATATATATATTATATATCACCCTTTAGATCT
 161 TGATTTCTTGGTCATTTCTCAACCTGAGGTGCATAGCATATTCCCACATTCCATTTGGTAGCAATATGCGGTCTGAATGC
 241 ATGCATTCATGAGTCCATGTGGCCAAGTCAGCCTGTGTGCTACTGAACTGTCGAAGGAAATAGCCGCTCTGATAGGTAGA
 321 TGTGAGTAAAAAGAACAGGAAAAAATTGCTTCTTTTATTGGTTTCCAAAGAAACAAACCAAACCAACCAGCTCTTGGATG
 401 TGAAGATAAAATAGTGCTTTTTTGAAATGGAGAGGAAAAACTTGGGGAGGAAGAGGCCTGCTGTGGGGGCATCGGAGCCA
 481 GCCATGTAAGAATCAGAGCTGCTCCTTCCTGTGAATCCTAGGTGGCCCTATGTCTTCTGTGGAGTTACAGTATAAAGCAG
 561 GGAGCTAATTAAGAGTATTAAAACTTAAAACCATTTTTTGACTCTGATTTTAAGTACATTTTTATATGTCAGTTGCTGCC
 641 CTTCACACTACCAGGCCCTGCAGCCACAGTGTTCTGTTGGAGAAACTTGGGGAAGTGTTTTCTGAACCAGTTCTTTTTCT
 721 TGGGGTAGAGCGTGAAATCCAGACCTGTTTTTGAAAGGACAGCACAGGAGGAGAAAAGTGACTGGGACGATGCTTCCTCT
 801 CATCCAAAACACATGCAGAGTCACATCCTCATCCTAGTGTTTGGCAGTTTGAGACCGCTACCCTGAACTTAAGAGCTTTA
 881 AATATGAGGGTTGTGTTTCTGGGGGGGTTATTTTTTTGGTGTGTGTGTGTGTGTATTGTGCTTAGAAAGGTTGCAGATTT
 961 CATCTTCACCTACCAAGAGGCGGCCGCCTCCTTGGACAAGCCGCTCATGGACCATTAGACTTGAGAAGACGACCCACGTG
1041 GTGACTGCAAAGCCCTGGGTACTTGCCTTCATGTTCTGGTTTGGTTTTCCCTTTTTCTGCTGCTCTTGGCAGCAGCCTGG
1121 TCATCATCTGCTTGTGGGAGTGGGAAATGGGTATTTTAGACCCAACACAGGTTCTAAATTTAAAACAAATAATAATTGGA
1201 ACAAATAAAGGTTCTTGTACCCAGAGTGATTCTACATGGGAAAAACAAACCAGCTTTTTTCAGAGAGTGACCGAATAGGA
1281 AGAAGGGATTCAGAAATATGATGTAGTAGAACATGCCCTGCAGGAAGAAAATGTTTTCTCTCCTGCGTATGTTAAGAGGA
1361 AATCAGTTTAAAATGCCTGCTAATCAAATGTCGACTCAGCTAACCATATGTCCAGGTTGCTGCAGAGTTTCTTTCAAATC
1441 TGAGTGTTGCCTGCTGAACTCGGAGGGGAGTTTGGAGAAATTTTAGACAGCAGCTCTGTGTTCTTTTTTTGCCGCAGCCA
1521 ATAAGATAATAGCAGAATTAGCCAATCCTAAAACCTTCTAAAGACGATTTTTGAGCATCCCACTGGGATTATTTAATTTT
1601 TCTTTTTGACGTGTGTTTTTAGTTTAGAAGTGCTGTATTCCACAAGGTTTAAGTCAGTGAGGTTGGAAGATACCCTATCT
1681 TTTTTATTCAAAAAGCACAATCAATCTTTTGTTTGAAAATCTATATAAAGTACAACTTGCTTTTAGCATGATTATTTTCC
1761 TAAATAAAAAGACAAAGAATTTACTTACTTTATGTTAATTACGGGCATGAAGCAAAAGGTTTTCTTTAAAAAAAAAAAAA
1841 AGTGCAGTGATGTAGGGCTGTGGTTAGTTAACCGTACTGAGTTATCCATCTAGCATCTGTGGCTTGCTGGAAGGGTAGTA
1921 TTAACTATTTAACATGTAATGGTGTACTTCACTCTTACCTAGCACGCTGTCTTCTCATTGCTTTGGGGGAGGGAGGGTCT
2001 CTCTGCTGGCACTGTCTAACTTGCTTACCTGCTGACTTTGCAGTTTGCTTGTGCTATGACATTTATTGTAGGTGCTATTT
2081 AGGGTAGGCTTAAAGTGCTGGGTGGTGATTTGAGTTCAAACAATAAAAAATTGTATTTTTTCAATATTGTATAAACAATA
2161 GTGTTCTAATTACCTTAAAAAAAAATAATGACCAGTTAAGAATTGCTTTTGATCTTGTCAAAAAACTGAATAGACCCCAG
2241 TTTCGGGAAGGTGTGTGAGCAGTGCCATGACTCTGCCCCTTACCTAATCCCACATCTCTCTAATGATAAGACATTGGCTC
2321 GCCTCTGACCAGAGCCCCAGCACCAGAGAGCGGAAGATGCAGAATTGTCAAATGACCTGCTGGGGGAGGTTGTAGGAGTT
2401 TAGCAGATTTGAGTGTGGCTGCAGAGAGAGAGAGTGTGTGTATGTGTGCACATGTGTGAGAGTGTGAGCGAGAGTGTGTG
2481 TGTGTCCATCTAAGTGTGTGTGATGAAGGTGGGATAAGGCTCCTCTGTTAGTGCTGGAAGCTCCTGTAATTGCCGCATGG
2561 ATCCCACTGTGCCCTCTTGTTCTGTGCAAGTCTGTCCTGTCTGGGCACTAACCTTGGTCCCATGCATGTTTATGTTCTGG
2641 GTGGGGCTTTGCCTCTCCACTGGGAAACTGACTTTTGCTGGGTTGAACAGAGTCCCTTATGCTTTTTGTCCTCTCCCTGC
2721 GCCTGGGAGAGGTGGGAGTAGGAGCCCAAACACACAGGTACAGAAAGATCTGGAAGAAGGCCTGGCAGTGAATCCAAGGA
2801 CTCTGGGCCCCCAACAATAGATGGTAGCGTAAGTCTGGAGCAGCGGTGTTTCACCACCAAATGCCTTTCCAGGCTGCCCT
2881 TCCAACACTCAGGAGAGCATCCAGATCCCTGGGCAGAGGCTCTACATTCTTGGCTTTAGAGGTGGTGGCAGCGGCAGCAG
2961 GTCAGAGCCACTTCTGGCGGTTTCCCTCCCCTTTTTAGTGCCCATAGTTTTTGGATCCTCCCTTGAGTTTTACCAGCACA
3041 AGCCATTCTTTGCCCCTGTTCACATAACTGAGCTCAAGCTCTTGCCAAACACCAACAAGCAAGATGGTTGCAACCTGGCA
3121 ACATTGAATCCACCACCCTTGGGCTCCCTCTGGAAGCCCCAGCACCGGGGGGCTTTTGGGCACAGGGTCAGTGGTAGCCA
3201 TCTTAGACACTGACATTTGGCTTTGTCGTCAATTTCATCACCCTCCTTGAGGTTACTGTGCAGTTTCAACCAGCATTTTA
3281 TCCTAGTGAGGTCATTATCAGGAGTTGCCATATCATCTCTCCAGTACCTAACATTTCTCATCCACTTCAAAAGCTGTTCT
3361 GACTGCCAGCTGGCTGATCTAAGCTCCTGAGGAATGTCTCCTCTCAAAGGAATTTTTCCCTCCAAAGGCCCCCTGAAGTC
3441 CTAGTTGGCATTGGCCTGGCACATGCTTTATGTTAGGCCTCCCGTTGGGATGGCTGAGAATCATGAAAGACAGATCCTCC
3521 GCTAGCCTCTGTGGGTCAAGTTTCTGGACACCAAGTCTCTGGGAACTAGTGTTTGATTTTAAATGGCATGTGGCCCTTCC
3601 TTGTTTCAGTGACTTAGAAAAGTAAAAGCCATTTAAAAAAGTTAGCAAGATTTTTTATCGACTTCCCAACTGGGCTTCCA
3681 GCCTTGTTGAATGAAATCATCTATCTCTGATTGGGCGCAACGAACTGCATTTCTTTGGACTTCTGAATCCATGTTTGTGC
3761 TTTCTCTGGCCCGTGAACACCTCGGCGATTCTGTTAGGGATGGGATGAGTGGGAGGAAGCCCTTTGAGAAGGGGGAGCCG
3841 GCCCTGTCATGCGCAGGTTTTCCACTCATCTGAGGAAGAGCCAGGGCTCTGAATTTAGCCTAACACTCATCTTGGCTGTG
3921 GGCTTGGGAAGAAATGGCCATTATTTACAGATTGTATTTGGTACATATTGTGTGATACTTGAAAAGATAAAAGGGACTGC
4001 CAGCCCCTAACTGAAATCTGAAGCTTTTTATCGCTTATTTTTCCTCGCCCTGTCTCCTCCCTTCCACCTTTCTCCTTGCA
4081 TTGTGATGATCTAGTAGGCACGTCTGTCAACAGGACACATGCCTCCTCTGACTATAACCTCTTAATAGTTGTGTATAATG
4161 AAAACTGTAAACTTTTTTAAATAAACGTGTATATACCTTGGCAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || || | ||||||| 
Target 5' gttttcCCTTTTTCTGCTGCTc 3'
1084 - 1105 156.00 -9.40
2
miRNA  3' guGUUUGGUAAUAC-------ACGACGau 5'
            | ||||| ||||       ||||||  
Target 5' agCTAACCA-TATGTCCAGGTTGCTGCag 3'
1398 - 1425 139.00 -15.30
3
miRNA  3' guGUUUGGU--AAUACACGACGAu 5'
            |||::||   |:|||||| || 
Target 5' gcCAAGTCAGCCTGTGTGCTACTg 3'
262 - 285 138.00 -17.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28200962 4 COSMIC
COSN30111681 23 COSMIC
COSN30161833 23 COSMIC
COSN30476870 44 COSMIC
COSN27000888 46 COSMIC
COSN30495280 68 COSMIC
COSN18731508 85 COSMIC
COSN18732056 90 COSMIC
COSN20104772 127 COSMIC
COSN28020081 128 COSMIC
COSN20075932 138 COSMIC
COSN32063921 196 COSMIC
COSN31534981 352 COSMIC
COSN25555049 438 COSMIC
COSN26537802 460 COSMIC
COSN31530833 482 COSMIC
COSN26392730 886 COSMIC
COSN20091693 1012 COSMIC
COSN28068724 1537 COSMIC
COSN26507439 1633 COSMIC
COSN26453660 1634 COSMIC
COSN18926819 1827 COSMIC
COSN21843020 1827 COSMIC
COSN18762645 1828 COSMIC
COSN8515430 1935 COSMIC
COSN21668006 1996 COSMIC
COSN25090983 2768 COSMIC
COSN51647 3114 COSMIC
COSN21127283 3458 COSMIC
COSN26158521 3579 COSMIC
COSN9828849 3733 COSMIC
COSN17313900 3970 COSMIC
COSN22110508 4047 COSMIC
COSN6350981 4057 COSMIC
COSN16275555 4119 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767802558 10 dbSNP
rs757732597 12 dbSNP
rs1166171402 13 dbSNP
rs752067435 14 dbSNP
rs764155773 15 dbSNP
rs763079793 21 dbSNP
rs372911460 25 dbSNP
rs577454973 35 dbSNP
rs532972084 39 dbSNP
rs776441841 51 dbSNP
rs1256408062 53 dbSNP
rs759110897 57 dbSNP
rs565590262 59 dbSNP
rs985404987 61 dbSNP
rs1157817147 65 dbSNP
rs8673 77 dbSNP
rs756890295 81 dbSNP
rs1196689809 82 dbSNP
rs750518315 84 dbSNP
rs1475457362 86 dbSNP
rs1187898605 92 dbSNP
rs570097907 93 dbSNP
rs966535967 93 dbSNP
rs1184347724 96 dbSNP
rs180947137 99 dbSNP
rs1420046156 102 dbSNP
rs1397182726 103 dbSNP
rs1404045946 106 dbSNP
rs1323495312 114 dbSNP
rs1327032824 120 dbSNP
rs1433067316 129 dbSNP
rs1021461454 132 dbSNP
rs1340188930 140 dbSNP
rs767224888 140 dbSNP
rs1463082911 147 dbSNP
rs1293623706 149 dbSNP
rs1263778876 150 dbSNP
rs576583143 156 dbSNP
rs893820472 157 dbSNP
rs1204642598 165 dbSNP
rs1207918603 166 dbSNP
rs1033627332 171 dbSNP
rs1348726324 178 dbSNP
rs188151314 182 dbSNP
rs1046591990 184 dbSNP
rs1188246264 189 dbSNP
rs1420403896 207 dbSNP
rs1472018236 229 dbSNP
rs1240096019 230 dbSNP
rs186460652 231 dbSNP
rs1381736151 237 dbSNP
rs1402504916 238 dbSNP
rs770446559 241 dbSNP
rs1296471738 243 dbSNP
rs1360000614 250 dbSNP
rs1415560736 254 dbSNP
rs1295350081 258 dbSNP
rs542858689 260 dbSNP
rs1312695796 263 dbSNP
rs929470994 264 dbSNP
rs897952570 266 dbSNP
rs1242265458 287 dbSNP
rs1283201805 292 dbSNP
rs1487684311 293 dbSNP
rs1454469048 296 dbSNP
rs181768691 305 dbSNP
rs74895800 306 dbSNP
rs79311060 307 dbSNP
rs1471421773 324 dbSNP
rs985124418 330 dbSNP
rs1157393508 332 dbSNP
rs1379694494 337 dbSNP
rs748440497 341 dbSNP
rs922519226 351 dbSNP
rs1400394130 352 dbSNP
rs1394036002 355 dbSNP
rs1333215442 357 dbSNP
rs1336152354 357 dbSNP
rs976659169 367 dbSNP
rs760124774 371 dbSNP
rs1158774402 373 dbSNP
rs1457137657 374 dbSNP
rs1384971772 380 dbSNP
rs1162085087 387 dbSNP
rs1446908255 389 dbSNP
rs966964892 391 dbSNP
rs1199557874 396 dbSNP
rs1251612841 397 dbSNP
rs1459370274 402 dbSNP
rs147040760 407 dbSNP
rs1454745464 413 dbSNP
rs1193177193 417 dbSNP
rs989551872 427 dbSNP
rs958097532 428 dbSNP
rs1465688724 430 dbSNP
rs10486 441 dbSNP
rs1396863690 443 dbSNP
rs1448806437 455 dbSNP
rs1264001924 464 dbSNP
rs1205907342 466 dbSNP
rs1376137383 468 dbSNP
rs1359029252 471 dbSNP
rs536796423 473 dbSNP
rs1247919438 474 dbSNP
rs537175593 475 dbSNP
rs577790293 481 dbSNP
rs1231982016 482 dbSNP
rs1269519498 485 dbSNP
rs185124277 498 dbSNP
rs1320428995 499 dbSNP
rs548444336 499 dbSNP
rs1327655739 505 dbSNP
rs1318455501 511 dbSNP
rs1469271984 511 dbSNP
rs1403912231 512 dbSNP
rs1265286082 517 dbSNP
rs1432677426 518 dbSNP
rs766890458 528 dbSNP
rs192975065 530 dbSNP
rs1426122158 541 dbSNP
rs1466973558 550 dbSNP
rs1363343607 555 dbSNP
rs1168326800 557 dbSNP
rs1399297391 560 dbSNP
rs1458307205 571 dbSNP
rs1301604370 580 dbSNP
rs1395398270 591 dbSNP
rs1295811398 592 dbSNP
rs1426941307 592 dbSNP
rs1025649064 600 dbSNP
rs1216437924 603 dbSNP
rs993739519 605 dbSNP
rs898019170 624 dbSNP
rs1224350435 626 dbSNP
rs1295085181 640 dbSNP
rs1264259554 647 dbSNP
rs1488194590 648 dbSNP
rs1205834923 651 dbSNP
rs1037857028 655 dbSNP
rs1476934074 658 dbSNP
rs1193251029 659 dbSNP
rs1422565098 687 dbSNP
rs1424241536 703 dbSNP
rs1386311538 704 dbSNP
rs1166831247 708 dbSNP
rs749502148 710 dbSNP
rs189473425 714 dbSNP
rs760875271 719 dbSNP
rs888192049 720 dbSNP
rs780036460 725 dbSNP
rs184791179 728 dbSNP
rs1361934751 732 dbSNP
rs1397676436 736 dbSNP
rs932308245 739 dbSNP
rs1356489974 744 dbSNP
rs1374822762 746 dbSNP
rs557857293 765 dbSNP
rs1230451661 771 dbSNP
rs370986974 772 dbSNP
rs535240967 782 dbSNP
rs1240414310 783 dbSNP
rs1288200988 786 dbSNP
rs1041372060 788 dbSNP
rs1216153120 790 dbSNP
rs945299459 793 dbSNP
rs1483438905 806 dbSNP
rs1183432869 807 dbSNP
rs1411388016 816 dbSNP
rs1423135437 824 dbSNP
rs1267046994 834 dbSNP
rs1159186205 838 dbSNP
rs1381565630 847 dbSNP
rs1417386488 856 dbSNP
rs751604516 857 dbSNP
rs1157670112 861 dbSNP
rs1359420479 864 dbSNP
rs1450604068 865 dbSNP
rs11548945 876 dbSNP
rs1225092404 879 dbSNP
rs547384311 883 dbSNP
rs532158713 884 dbSNP
rs1448076783 885 dbSNP
rs1312108380 888 dbSNP
rs1351600371 890 dbSNP
rs1239571831 897 dbSNP
rs1281283573 906 dbSNP
rs1212706494 908 dbSNP
rs1341426741 919 dbSNP
rs758300123 920 dbSNP
rs377267429 935 dbSNP
rs565392326 935 dbSNP
rs753293813 935 dbSNP
rs926715787 935 dbSNP
rs980781711 943 dbSNP
rs1343172559 972 dbSNP
rs1415778102 981 dbSNP
rs1358884648 982 dbSNP
rs191355093 985 dbSNP
rs752493037 986 dbSNP
rs1375396891 988 dbSNP
rs1350798273 989 dbSNP
rs113207763 997 dbSNP
rs1446727556 1002 dbSNP
rs994181524 1003 dbSNP
rs962319801 1004 dbSNP
rs1217631577 1007 dbSNP
rs566232442 1012 dbSNP
rs531953511 1013 dbSNP
rs1311385227 1018 dbSNP
rs1171395841 1028 dbSNP
rs1199081550 1030 dbSNP
rs1259886392 1032 dbSNP
rs1456346940 1035 dbSNP
rs1046691 1038 dbSNP
rs889249036 1045 dbSNP
rs1189083510 1047 dbSNP
rs762065660 1056 dbSNP
rs774199401 1068 dbSNP
rs1427362907 1070 dbSNP
rs1478342495 1071 dbSNP
rs1173215320 1073 dbSNP
rs1201830775 1076 dbSNP
rs1480910123 1079 dbSNP
rs1398601439 1082 dbSNP
rs186509565 1083 dbSNP
rs1324799673 1109 dbSNP
rs996581620 1110 dbSNP
rs1434487867 1117 dbSNP
rs1274453785 1121 dbSNP
rs776346290 1123 dbSNP
rs1439419074 1127 dbSNP
rs900863350 1134 dbSNP
rs1040695499 1160 dbSNP
rs1315840008 1165 dbSNP
rs572191511 1171 dbSNP
rs184728432 1181 dbSNP
rs1290574676 1197 dbSNP
rs1320768631 1204 dbSNP
rs1452807167 1221 dbSNP
rs1218809727 1234 dbSNP
rs765867368 1254 dbSNP
rs1488392208 1262 dbSNP
rs945324774 1268 dbSNP
rs1421865438 1269 dbSNP
rs1477732532 1271 dbSNP
rs1164339674 1272 dbSNP
rs760116095 1273 dbSNP
rs1403654915 1278 dbSNP
rs1053595531 1280 dbSNP
rs1361282309 1301 dbSNP
rs1402004108 1303 dbSNP
rs1296595093 1304 dbSNP
rs545045455 1313 dbSNP
rs577970592 1320 dbSNP
rs1226504354 1331 dbSNP
rs34456570 1332 dbSNP
rs116483415 1338 dbSNP
rs1284689178 1338 dbSNP
rs7639 1346 dbSNP
rs1372182542 1347 dbSNP
rs1290318187 1358 dbSNP
rs1488340432 1362 dbSNP
rs772525187 1371 dbSNP
rs570010716 1377 dbSNP
rs1446754737 1381 dbSNP
rs1188741314 1384 dbSNP
rs113370448 1392 dbSNP
rs1472072207 1393 dbSNP
rs970820529 1397 dbSNP
rs1320068329 1406 dbSNP
rs1337974665 1412 dbSNP
rs1421653966 1415 dbSNP
rs141580529 1422 dbSNP
rs1360191200 1436 dbSNP
rs1396855776 1437 dbSNP
rs1342050883 1442 dbSNP
rs1469787025 1442 dbSNP
rs972085715 1445 dbSNP
rs962322020 1451 dbSNP
rs1403959911 1459 dbSNP
rs1016528024 1461 dbSNP
rs536468379 1462 dbSNP
rs1283410151 1467 dbSNP
rs1349443158 1470 dbSNP
rs748532277 1471 dbSNP
rs1281082892 1473 dbSNP
rs953539515 1478 dbSNP
rs565756430 1479 dbSNP
rs900917153 1480 dbSNP
rs1176806953 1481 dbSNP
rs1175767901 1484 dbSNP
rs1471031925 1487 dbSNP
rs1233291960 1488 dbSNP
rs1182876014 1489 dbSNP
rs1379801142 1490 dbSNP
rs1466687110 1491 dbSNP
rs1019732587 1494 dbSNP
rs1404071375 1502 dbSNP
rs1412611894 1503 dbSNP
rs1420414853 1508 dbSNP
rs1163467715 1510 dbSNP
rs569986338 1511 dbSNP
rs571111795 1513 dbSNP
rs547518566 1514 dbSNP
rs892088850 1520 dbSNP
rs1233444318 1526 dbSNP
rs1257450266 1530 dbSNP
rs531972013 1533 dbSNP
rs1343302084 1543 dbSNP
rs1203767274 1544 dbSNP
rs1315894699 1550 dbSNP
rs1053646733 1554 dbSNP
rs1225177558 1560 dbSNP
rs1353265167 1565 dbSNP
rs774625924 1566 dbSNP
rs1433904914 1567 dbSNP
rs1201278740 1572 dbSNP
rs1452498226 1573 dbSNP
rs936561829 1573 dbSNP
rs905060444 1580 dbSNP
rs1044905322 1581 dbSNP
rs1467057659 1596 dbSNP
rs769032875 1598 dbSNP
rs8485 1602 dbSNP
rs192484841 1610 dbSNP
rs972518969 1611 dbSNP
rs1338719007 1617 dbSNP
rs940721164 1618 dbSNP
rs550129839 1626 dbSNP
rs147871036 1641 dbSNP
rs188825374 1643 dbSNP
rs1217325690 1659 dbSNP
rs1251309895 1674 dbSNP
rs1488831958 1675 dbSNP
rs1402701552 1677 dbSNP
rs1380634914 1685 dbSNP
rs953590269 1704 dbSNP
rs533131726 1709 dbSNP
rs1244896153 1710 dbSNP
rs1182445125 1711 dbSNP
rs976268442 1721 dbSNP
rs1485253444 1723 dbSNP
rs755359812 1725 dbSNP
rs1457946885 1730 dbSNP
rs1294737880 1732 dbSNP
rs1363177491 1739 dbSNP
rs1403895347 1747 dbSNP
rs756153211 1749 dbSNP
rs1217463183 1750 dbSNP
rs1317177405 1758 dbSNP
rs1287131523 1770 dbSNP
rs1295471171 1771 dbSNP
rs1245719152 1777 dbSNP
rs1322798027 1777 dbSNP
rs1247663291 1780 dbSNP
rs1263687466 1783 dbSNP
rs1358834204 1788 dbSNP
rs1217605707 1789 dbSNP
rs1357842511 1791 dbSNP
rs1489128551 1791 dbSNP
rs1184609504 1794 dbSNP
rs989007668 1802 dbSNP
rs1424258270 1803 dbSNP
rs956173732 1812 dbSNP
rs966575914 1818 dbSNP
rs1019360916 1820 dbSNP
rs1423528972 1827 dbSNP
rs547607915 1828 dbSNP
rs561279003 1828 dbSNP
rs892143772 1828 dbSNP
rs1288615993 1841 dbSNP
rs1000778143 1842 dbSNP
rs1380356718 1842 dbSNP
rs1398243064 1842 dbSNP
rs879146791 1842 dbSNP
rs1288396487 1843 dbSNP
rs879232067 1851 dbSNP
rs1229442664 1853 dbSNP
rs1351716432 1864 dbSNP
rs1259873184 1872 dbSNP
rs201172057 1872 dbSNP
rs570625426 1873 dbSNP
rs878952624 1874 dbSNP
rs949253716 1874 dbSNP
rs1178665595 1877 dbSNP
rs1036462342 1889 dbSNP
rs940743665 1890 dbSNP
rs1157930623 1897 dbSNP
rs1360096275 1902 dbSNP
rs1361422214 1915 dbSNP
rs1335276981 1934 dbSNP
rs777876527 1937 dbSNP
rs1448193204 1948 dbSNP
rs909237289 1965 dbSNP
rs1371297939 1966 dbSNP
rs1223420830 1969 dbSNP
rs984786193 1970 dbSNP
rs1312528602 1971 dbSNP
rs1014187914 1978 dbSNP
rs1386928158 1985 dbSNP
rs1261048203 1990 dbSNP
rs932255662 1991 dbSNP
rs895711235 1994 dbSNP
rs1047626609 2003 dbSNP
rs922216725 2005 dbSNP
rs1239407750 2006 dbSNP
rs976699222 2007 dbSNP
rs1165373306 2011 dbSNP
rs993316634 2014 dbSNP
rs527900932 2016 dbSNP
rs766675253 2018 dbSNP
rs1435252153 2023 dbSNP
rs899003201 2031 dbSNP
rs1174666166 2036 dbSNP
rs756586016 2040 dbSNP
rs1416722684 2041 dbSNP
rs1187788101 2047 dbSNP
rs1352839165 2048 dbSNP
rs1488381279 2053 dbSNP
rs144974645 2054 dbSNP
rs758460210 2055 dbSNP
rs1221949896 2059 dbSNP
rs1281067615 2061 dbSNP
rs545491234 2072 dbSNP
rs941408626 2075 dbSNP
rs369663535 2076 dbSNP
rs1219152322 2100 dbSNP
rs913360342 2106 dbSNP
rs1435534267 2107 dbSNP
rs1203263753 2111 dbSNP
rs1219867485 2113 dbSNP
rs1489955130 2131 dbSNP
rs1294451135 2132 dbSNP
rs868678410 2133 dbSNP
rs868080394 2135 dbSNP
rs1196838553 2149 dbSNP
rs911228392 2156 dbSNP
rs1429017108 2158 dbSNP
rs1050167835 2173 dbSNP
rs3734927 2177 dbSNP
rs1418055628 2186 dbSNP
rs200582735 2186 dbSNP
rs55634556 2186 dbSNP
rs987935562 2186 dbSNP
rs1222899810 2187 dbSNP
rs1403275074 2189 dbSNP
rs956455772 2191 dbSNP
rs1032003721 2195 dbSNP
rs559906496 2205 dbSNP
rs933966612 2208 dbSNP
rs922871434 2211 dbSNP
rs1337306831 2217 dbSNP
rs183364465 2226 dbSNP
rs956224607 2233 dbSNP
rs926078078 2236 dbSNP
rs978535413 2240 dbSNP
rs1282871800 2244 dbSNP
rs896348671 2245 dbSNP
rs576373098 2247 dbSNP
rs554928328 2250 dbSNP
rs1005008999 2251 dbSNP
rs1240751769 2252 dbSNP
rs1293931462 2258 dbSNP
rs1475336375 2260 dbSNP
rs1461377313 2267 dbSNP
rs970186794 2278 dbSNP
rs1022645190 2281 dbSNP
rs1422891619 2288 dbSNP
rs536408348 2296 dbSNP
rs921902258 2299 dbSNP
rs752652598 2302 dbSNP
rs1361467651 2308 dbSNP
rs778643030 2308 dbSNP
rs1319990787 2311 dbSNP
rs1477861000 2314 dbSNP
rs1428046192 2318 dbSNP
rs375967509 2320 dbSNP
rs898118189 2321 dbSNP
rs565891572 2323 dbSNP
rs1243207445 2336 dbSNP
rs993368872 2345 dbSNP
rs899013038 2351 dbSNP
rs142632543 2352 dbSNP
rs151092864 2374 dbSNP
rs1446845917 2376 dbSNP
rs1005653735 2377 dbSNP
rs1201140298 2381 dbSNP
rs1245551760 2383 dbSNP
rs1442832541 2386 dbSNP
rs1183011843 2391 dbSNP
rs889896589 2392 dbSNP
rs988932915 2407 dbSNP
rs551737282 2428 dbSNP
rs1262635272 2430 dbSNP
rs34351192 2433 dbSNP
rs1274789692 2435 dbSNP
rs60708125 2435 dbSNP
rs74762368 2435 dbSNP
rs76057357 2435 dbSNP
rs1221873283 2437 dbSNP
rs1313654717 2438 dbSNP
rs1347649217 2442 dbSNP
rs1377014905 2442 dbSNP
rs957503638 2442 dbSNP
rs1301651507 2443 dbSNP
rs530577367 2443 dbSNP
rs1390614251 2446 dbSNP
rs370279268 2446 dbSNP
rs1350369598 2452 dbSNP
rs934017562 2452 dbSNP
rs925038362 2454 dbSNP
rs1460337360 2457 dbSNP
rs979129792 2458 dbSNP
rs1238803811 2459 dbSNP
rs1370998461 2462 dbSNP
rs1179888320 2463 dbSNP
rs1421015707 2463 dbSNP
rs571283764 2464 dbSNP
rs1363492955 2469 dbSNP
rs969094818 2470 dbSNP
rs559493987 2473 dbSNP
rs1336068924 2475 dbSNP
rs1468115566 2475 dbSNP
rs1053371327 2476 dbSNP
rs1013528329 2477 dbSNP
rs1392664212 2478 dbSNP
rs960906367 2486 dbSNP
rs1404664914 2493 dbSNP
rs2727501 2496 dbSNP
rs1285508621 2498 dbSNP
rs1470718401 2499 dbSNP
rs753450243 2503 dbSNP
rs1377848025 2507 dbSNP
rs1223419806 2511 dbSNP
rs1180726780 2516 dbSNP
rs191538256 2520 dbSNP
rs1481647702 2525 dbSNP
rs979308652 2526 dbSNP
rs1249952892 2529 dbSNP
rs1452334436 2540 dbSNP
rs1201877814 2542 dbSNP
rs567590764 2555 dbSNP
rs996232703 2557 dbSNP
rs1373621160 2573 dbSNP
rs915671435 2576 dbSNP
rs1248925033 2582 dbSNP
rs992535880 2594 dbSNP
rs900527614 2599 dbSNP
rs1386930222 2605 dbSNP
rs1458631147 2607 dbSNP
rs1344017374 2622 dbSNP
rs1040757464 2624 dbSNP
rs1242558736 2626 dbSNP
rs1279260391 2640 dbSNP
rs868708066 2653 dbSNP
rs188040887 2659 dbSNP
rs1347317090 2661 dbSNP
rs1256808949 2675 dbSNP
rs1250774513 2681 dbSNP
rs1357214666 2687 dbSNP
rs1225002920 2688 dbSNP
rs1267088476 2690 dbSNP
rs142900242 2694 dbSNP
rs780622261 2696 dbSNP
rs971959376 2700 dbSNP
rs1314875307 2702 dbSNP
rs1430161900 2705 dbSNP
rs1190951232 2708 dbSNP
rs913484643 2711 dbSNP
rs1447357121 2713 dbSNP
rs12535722 2721 dbSNP
rs1165050346 2727 dbSNP
rs1334040625 2744 dbSNP
rs1454114186 2747 dbSNP
rs1299113594 2751 dbSNP
rs936193781 2753 dbSNP
rs749883400 2758 dbSNP
rs1381013623 2760 dbSNP
rs1295585680 2763 dbSNP
rs926095327 2765 dbSNP
rs751135389 2766 dbSNP
rs1289708809 2775 dbSNP
rs1358942057 2798 dbSNP
rs551732336 2807 dbSNP
rs1261034893 2809 dbSNP
rs1486757745 2810 dbSNP
rs1203308445 2814 dbSNP
rs1261002064 2820 dbSNP
rs947777524 2823 dbSNP
rs1184863459 2825 dbSNP
rs766989548 2826 dbSNP
rs73159698 2828 dbSNP
rs998235557 2829 dbSNP
rs182528989 2833 dbSNP
rs1452139436 2840 dbSNP
rs562859302 2844 dbSNP
rs960367332 2845 dbSNP
rs563165739 2848 dbSNP
rs12535728 2858 dbSNP
rs369832488 2861 dbSNP
rs1312926368 2864 dbSNP
rs1382138433 2883 dbSNP
rs983343372 2885 dbSNP
rs1182363654 2887 dbSNP
rs1444191422 2896 dbSNP
rs1318469481 2903 dbSNP
rs1236674470 2905 dbSNP
rs755349247 2913 dbSNP
rs1259961102 2922 dbSNP
rs1461661844 2924 dbSNP
rs754202867 2928 dbSNP
rs767057478 2934 dbSNP
rs761248085 2938 dbSNP
rs377295522 2942 dbSNP
rs767635745 2943 dbSNP
rs1205497937 2952 dbSNP
rs951870256 2953 dbSNP
rs563145239 2960 dbSNP
rs1177397717 2967 dbSNP
rs904804129 2974 dbSNP
rs574089366 2978 dbSNP
rs1043297477 2979 dbSNP
rs561126042 2985 dbSNP
rs1324690756 2986 dbSNP
rs1405433794 2987 dbSNP
rs1443070738 2995 dbSNP
rs35008319 2997 dbSNP
rs1300090772 3004 dbSNP
rs948942474 3007 dbSNP
rs916075075 3014 dbSNP
rs1223435062 3015 dbSNP
rs1287815468 3020 dbSNP
rs1287424471 3021 dbSNP
rs774915867 3022 dbSNP
rs1324077065 3024 dbSNP
rs1225270998 3025 dbSNP
rs938395791 3033 dbSNP
rs1018996252 3042 dbSNP
rs918942683 3044 dbSNP
rs1204552587 3049 dbSNP
rs1234143209 3061 dbSNP
rs971676542 3064 dbSNP
rs189854572 3075 dbSNP
rs1312815271 3078 dbSNP
rs1481661992 3078 dbSNP
rs1174862392 3091 dbSNP
rs1429260530 3104 dbSNP
rs1411035389 3113 dbSNP
rs762157462 3126 dbSNP
rs891773926 3133 dbSNP
rs1053313001 3137 dbSNP
rs936246183 3142 dbSNP
rs768959790 3143 dbSNP
rs1406599917 3146 dbSNP
rs572419010 3150 dbSNP
rs553912674 3154 dbSNP
rs1366767497 3163 dbSNP
rs953341485 3166 dbSNP
rs947864659 3167 dbSNP
rs1030129737 3169 dbSNP
rs1292101299 3172 dbSNP
rs1490936238 3173 dbSNP
rs3832460 3173 dbSNP
rs1197649838 3183 dbSNP
rs1268634810 3184 dbSNP
rs1475995115 3197 dbSNP
rs866225688 3198 dbSNP
rs1386701618 3208 dbSNP
rs1300369307 3210 dbSNP
rs1417457138 3211 dbSNP
rs1409501633 3214 dbSNP
rs538488935 3220 dbSNP
rs998288029 3226 dbSNP
rs1420692590 3227 dbSNP
rs1367632051 3232 dbSNP
rs901227060 3237 dbSNP
rs1162201252 3239 dbSNP
rs1031746179 3243 dbSNP
rs763318726 3246 dbSNP
rs1300986368 3251 dbSNP
rs185296904 3256 dbSNP
rs556004723 3261 dbSNP
rs1271923212 3262 dbSNP
rs1359213693 3285 dbSNP
rs904522528 3285 dbSNP
rs1315164554 3287 dbSNP
rs1361100464 3292 dbSNP
rs1219816839 3298 dbSNP
rs939031162 3304 dbSNP
rs1448005572 3308 dbSNP
rs763186889 3312 dbSNP
rs775607380 3315 dbSNP
rs774387654 3322 dbSNP
rs1240920312 3329 dbSNP
rs34198617 3337 dbSNP
rs1475388696 3340 dbSNP
rs1043738328 3341 dbSNP
rs948966353 3348 dbSNP
rs770093401 3350 dbSNP
rs983395535 3365 dbSNP
rs951923845 3367 dbSNP
rs1320180421 3368 dbSNP
rs1343311293 3370 dbSNP
rs1426889280 3380 dbSNP
rs182046716 3381 dbSNP
rs191909038 3388 dbSNP
rs1384437612 3389 dbSNP
rs1243314147 3391 dbSNP
rs1283278685 3392 dbSNP
rs1217693958 3394 dbSNP
rs1490118213 3398 dbSNP
rs1289377167 3401 dbSNP
rs938447988 3403 dbSNP
rs1211525985 3406 dbSNP
rs1464791703 3409 dbSNP
rs548608662 3418 dbSNP
rs534216932 3420 dbSNP
rs964539263 3421 dbSNP
rs1224622080 3423 dbSNP
rs1019466750 3427 dbSNP
rs1471292883 3429 dbSNP
rs1160041825 3434 dbSNP
rs746067263 3447 dbSNP
rs1456628665 3449 dbSNP
rs1337388130 3459 dbSNP
rs891829362 3463 dbSNP
rs1449895715 3466 dbSNP
rs1031616403 3482 dbSNP
rs1000445191 3483 dbSNP
rs1443932960 3484 dbSNP
rs1278086249 3492 dbSNP
rs1328973610 3496 dbSNP
rs1224653452 3500 dbSNP
rs1265580918 3504 dbSNP
rs114701215 3519 dbSNP
rs1044589866 3520 dbSNP
rs1179834174 3522 dbSNP
rs948901568 3523 dbSNP
rs1439707036 3536 dbSNP
rs1180002790 3537 dbSNP
rs1249346047 3543 dbSNP
rs941725437 3544 dbSNP
rs908842753 3552 dbSNP
rs548218672 3553 dbSNP
rs986453975 3559 dbSNP
rs551918313 3565 dbSNP
rs895959557 3566 dbSNP
rs1056627165 3578 dbSNP
rs1171418135 3581 dbSNP
rs781464558 3583 dbSNP
rs1167914340 3584 dbSNP
rs1326520574 3587 dbSNP
rs1350216938 3591 dbSNP
rs953296512 3592 dbSNP
rs923109890 3593 dbSNP
rs907562939 3599 dbSNP
rs1047425961 3609 dbSNP
rs533384312 3617 dbSNP
rs1460517376 3628 dbSNP
rs375787997 3635 dbSNP
rs1251902729 3646 dbSNP
rs956510220 3649 dbSNP
rs1194615273 3650 dbSNP
rs1341644407 3656 dbSNP
rs1194268799 3657 dbSNP
rs550805806 3659 dbSNP
rs998943613 3660 dbSNP
rs969133239 3681 dbSNP
rs1270788118 3683 dbSNP
rs1480251679 3689 dbSNP
rs1198143844 3698 dbSNP
rs1021588380 3699 dbSNP
rs1373146947 3699 dbSNP
rs78609921 3700 dbSNP
rs1166303466 3703 dbSNP
rs550275454 3714 dbSNP
rs529452943 3716 dbSNP
rs1272203007 3717 dbSNP
rs544921436 3720 dbSNP
rs911715597 3721 dbSNP
rs113582844 3722 dbSNP
rs1386703954 3729 dbSNP
rs1194067369 3733 dbSNP
rs1225273042 3741 dbSNP
rs1328253790 3741 dbSNP
rs1319363649 3752 dbSNP
rs748096421 3755 dbSNP
rs1225028001 3756 dbSNP
rs1222466903 3757 dbSNP
rs1293661633 3759 dbSNP
rs1487419467 3768 dbSNP
rs577672553 3772 dbSNP
rs1262400108 3783 dbSNP
rs1430257222 3784 dbSNP
rs1186077517 3786 dbSNP
rs1273368226 3787 dbSNP
rs1389015386 3793 dbSNP
rs540661352 3797 dbSNP
rs1165146310 3799 dbSNP
rs1031668708 3800 dbSNP
rs778856100 3800 dbSNP
rs572356737 3809 dbSNP
rs1457761673 3811 dbSNP
rs1332096384 3813 dbSNP
rs12690 3816 dbSNP
rs867300473 3833 dbSNP
rs541125143 3836 dbSNP
rs1036528570 3839 dbSNP
rs941749255 3840 dbSNP
rs1013138286 3852 dbSNP
rs895998572 3853 dbSNP
rs1261124681 3864 dbSNP
rs775343481 3865 dbSNP
rs1469431917 3881 dbSNP
rs1486767470 3883 dbSNP
rs908887970 3892 dbSNP
rs1461410418 3893 dbSNP
rs1174605112 3896 dbSNP
rs148641662 3915 dbSNP
rs931625162 3922 dbSNP
rs1160210812 3923 dbSNP
rs559298492 3926 dbSNP
rs556179721 3928 dbSNP
rs1179536860 3936 dbSNP
rs886181059 3953 dbSNP
rs1047474989 3957 dbSNP
rs1406874578 3971 dbSNP
rs1454689479 3981 dbSNP
rs1459049617 3997 dbSNP
rs923206101 4004 dbSNP
rs1202483714 4005 dbSNP
rs975997009 4014 dbSNP
rs956562332 4015 dbSNP
rs920230098 4018 dbSNP
rs1280279157 4019 dbSNP
rs1226491260 4021 dbSNP
rs1219495729 4032 dbSNP
rs1324216332 4033 dbSNP
rs537538269 4035 dbSNP
rs1235249530 4038 dbSNP
rs1482693370 4042 dbSNP
rs1039392378 4045 dbSNP
rs143970097 4046 dbSNP
rs755815959 4047 dbSNP
rs1182056460 4051 dbSNP
rs1430546623 4052 dbSNP
rs1445149998 4058 dbSNP
rs1379782804 4059 dbSNP
rs750048847 4064 dbSNP
rs1358664545 4066 dbSNP
rs3734926 4068 dbSNP
rs114013518 4069 dbSNP
rs1035936197 4074 dbSNP
rs1352074370 4075 dbSNP
rs1407713839 4079 dbSNP
rs577643648 4080 dbSNP
rs1345998213 4086 dbSNP
rs1220889848 4089 dbSNP
rs868290314 4090 dbSNP
rs1357562496 4091 dbSNP
rs1275882438 4093 dbSNP
rs1311177280 4094 dbSNP
rs898000508 4096 dbSNP
rs1204744351 4097 dbSNP
rs1036506643 4101 dbSNP
rs1204834495 4102 dbSNP
rs955839768 4106 dbSNP
rs1006395103 4110 dbSNP
rs3832459 4121 dbSNP
rs397703605 4121 dbSNP
rs978789869 4123 dbSNP
rs887562843 4124 dbSNP
rs1050578737 4125 dbSNP
rs1368904648 4126 dbSNP
rs1429355264 4129 dbSNP
rs1406929893 4134 dbSNP
rs968701495 4139 dbSNP
rs1156624627 4141 dbSNP
rs187073064 4143 dbSNP
rs1438522261 4148 dbSNP
rs1273051003 4153 dbSNP
rs922926352 4158 dbSNP
rs1022949680 4169 dbSNP
rs539982910 4178 dbSNP
rs1339548761 4187 dbSNP
rs181814695 4189 dbSNP
rs923788733 4192 dbSNP
rs73159696 4202 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || || | ||||||| 
Target 5' ------CCUUUUUCUGCUGCU- 3'
1 - 15
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000355621.3 | 3UTR | CCUUUUUCUGCUGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38974 Chronic obstructive pulmonary disease 0.438 1.4e-2 0.535 2.9e-3 25 Click to see details
GSE27834 Pluripotent stem cells -0.539 1.6e-2 -0.550 1.4e-2 16 Click to see details
GSE21032 Prostate cancer 0.193 4.0e-2 0.156 8.0e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.347 6.7e-2 -0.226 1.7e-1 20 Click to see details
GSE19350 CNS germ cell tumors 0.427 8.3e-2 0.615 1.7e-2 12 Click to see details
GSE21687 Ependynoma primary tumors 0.134 1.5e-1 0.153 1.1e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.173 2.0e-1 0.129 2.7e-1 25 Click to see details
GSE21849 B cell lymphoma 0.132 2.5e-1 0.203 1.5e-1 29 Click to see details
GSE38226 Liver fibrosis 0.147 2.6e-1 0.193 2.0e-1 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.149 2.7e-1 0.543 6.7e-3 20 Click to see details
GSE14794 Lymphoblastoid cells -0.061 2.8e-1 -0.012 4.6e-1 90 Click to see details
GSE42095 Differentiated embryonic stem cells -0.11 3.1e-1 -0.082 3.5e-1 23 Click to see details
GSE28544 Breast cancer -0.088 3.4e-1 -0.206 1.7e-1 24 Click to see details
GSE19783 ER- ER- breast cancer -0.04 3.6e-1 -0.022 4.2e-1 79 Click to see details
GSE32688 Pancreatic cancer -0.064 3.6e-1 0.092 3.1e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.038 4.3e-1 0.002 5.0e-1 24 Click to see details
GSE17498 Multiple myeloma -0.015 4.6e-1 0.116 2.4e-1 40 Click to see details
GSE17306 Multiple myeloma -0.006 4.8e-1 -0.150 1.5e-1 49 Click to see details
GSE19536 Breast cancer 0.001 5.0e-1 -0.011 4.6e-1 100 Click to see details
GSE28260 Renal cortex and medulla 0.001 5.0e-1 0.093 3.8e-1 13 Click to see details
GSE28260 Renal cortex and medulla 0.001 5.0e-1 0.093 3.8e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.469 0 -0.560 0 32 Click to see details
BRCA 0.247 0.01 0.195 0.04 84 Click to see details
KIRP -0.332 0.03 -0.376 0.02 32 Click to see details
THCA -0.235 0.04 -0.324 0.01 59 Click to see details
LIHC -0.251 0.04 -0.280 0.03 49 Click to see details
LUAD 0.402 0.1 0.385 0.11 12 Click to see details
KICH 0.251 0.11 0.209 0.16 25 Click to see details
CHOL -0.368 0.16 -0.283 0.23 9 Click to see details
PAAD -0.295 0.35 -0.400 0.3 4 Click to see details
UCEC -0.08 0.37 -0.107 0.33 19 Click to see details
HNSC 0.049 0.38 -0.002 0.49 42 Click to see details
BLCA 0.076 0.38 0.143 0.29 18 Click to see details
CESC 0.334 0.39 0.500 0.33 3 Click to see details
PCPG 0.313 0.4 0.500 0.33 3 Click to see details
LUSC -0.04 0.41 -0.062 0.36 38 Click to see details
ESCA -0.076 0.41 -0.345 0.15 11 Click to see details
COAD -0.081 0.42 -0.524 0.09 8 Click to see details
PRAD -0.007 0.48 -0.028 0.42 50 Click to see details
KIRC 0.001 0.5 0.011 0.46 68 Click to see details
KIRC 0.001 0.5 0.011 0.46 68 Click to see details
KIRC 0.001 0.5 0.011 0.46 68 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1