miRTarBase - #MIRT570464 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TLK1   
Synonyms PKU-beta
Description tousled like kinase 1
Transcript NM_001136554   
Other Transcripts NM_001136555 , NM_012290   
Expression
Putative miRNA Targets on TLK1
3'UTR of TLK1
(miRNA target sites are highlighted)
>TLK1|NM_001136554|3'UTR
   1 CTTTCCTCCAAGATTGGCATGATATCTTTGAATTTGCTTCCAGATGCACACTTAAGTTTGAGAGCATTTGAGTGTTTGTT
  81 TTCTTTTTCTTTTTTTTTTTTTTTTTTTTTTACACAAGACGTGGTTAAGAACTGTTTGTGAACTGAAGTTCCTCATAGTG
 161 TCATTTGTATGAGAGAGGATCATGGACAATGAATAAATGCACACTTCTGACTATAATTTTGAGCAGTGAAGGAAGGATGA
 241 CTGCCTGTTACACAGAAACAGGAATACCATGTTAAGATAGAGGAAAAAAATTTTGTTTATTTGGGGGAACACTGTAAATA
 321 ACGTTTATAATACTTAAATACATTTGGTTGTTACTAGAGAGTTCTAATATGAAGGGTAGTTTTTCATTATTTAAAAACAC
 401 ATGGAAAAATATGAGACATATTTCTAACATACGAACTATAGTGCCTGGATACATTCTTCAGCATTTGGCAGTTAATCTGC
 481 TGAAACCAAAGTAAGAACTGAATGACAGTGACAGTTGTGTTTTATAGTAATAGAATGTGAGAGTTAGAATCTTTGGACAA
 561 AGTTAGGCTTTGTCATTTGCCTATTCAGACTTTTACCAAGTTGTACCTCGAGATCACATGTCCGTTTTCTTTCACTGGTT
 641 ATATTAAAGGGAGAGCTATTATTTCTAAATACTTTACACCTTTGACAAAATGAGCTGCTTGTGTTGAAATCAGTTGAATT
 721 CACTAAATTATAATATTGCCAGTGTTTTCAACACGTTAGAATTGATAACAGGTATTTTTCTTTTGTTACCAGGCCTTGTT
 801 CATCAAAACAGGTGACAGTGAGTAACCAAATGCAGACCAGTTCTATGCAGGATAATGATAAATTCCCTTCTAGCTCTATT
 881 GTAAATTGTTGTACAGATGTCATATTTCAATTACTAAGTTTCAGCAGCTTATTCTTGTACAAATGTTTAAAATATGGCTT
 961 TTCTAATTGGATATTGTATTTTTTTTAAGTCTTCTTGAAGGCACTCTAATTGCTGCTAAATGATGTTGCTTCTTTGCTAA
1041 AAAATTAAATGACCTAGAAGGTGCAAGTTGACTGTACATCATAGATATTAAAAAGCAGACAGTCATTAACAATCAAGATG
1121 TAAAAGTGATCCATGTTGGACATAATTGAGTTTTTAAATCAGTTTATTGGGTTCTAGGGCTGTAGAACACATAGATACTA
1201 GATTTTTAATTTGTTCATGGTTATTCTACATTTCTAGAAAGTTCTTATCAGCAAGATGGTCCCATAAGCAAATTTCTTGT
1281 GGTTTGTACAGATTTGTTAAAATGTGAACGTTTTCTAACTGCCTCGTAGGGTAGAAACCAATATTTTTCAGGATGCTGTA
1361 TTTCACTCCTGTAAGGACTTTTTCTTTATTGTCACATTCATAATGCTGATACTTACATGTAAGTTGTTCATGTTGCAGAA
1441 AAAGGTTATACGTACCACGGATTCTCTTTAATATTGTACAGTTAAACTGTATTTCTGATGTTGCAAGCCATTTTGTTTTT
1521 TCATTGTACATAGACACATTGTCTCTTTAAAATGCTGCTGAAATTGTAGAGAGTATAGCCAAAACAGTAATAAACAATGA
1601 CAGTTAAAATGTAAAGACTATGAAAATTACATTGGAAGGGAGCTTTCAAGATGGTAGGATATTGACTAACTGAGCTCCTT
1681 CACTTAAAAATCAGCTGAATAAATTCCTTAAGTATACTTCAAGACAAGTGTAAATTGTTTCAAGCTGTTAAAGTTAAACC
1761 TAATAACCATTATCAAGGCAACTCCTGGGTAAGTAACACTTAGAACCATCAAGAGTGGTTTAAGGGGCTGGCTATACCCA
1841 TTCCTCTGTAGAGCACAGAGAAATCCTATTAAAAAAAAAATACTACATGGTAATGAAATCTTAGCATTGATTGAGTGCTT
1921 TACGTGCTGCCTGCAAGTTTTCAGTTTTGTTGTTAGAGTTTTCGTCTTTATGAATGATAAAGTCCTATGTTCATAAAGTA
2001 ACATTTAAATTCCTGAACTAAAAGGAAATGCCTGTTGTGCTTAAAATTTTGGGGAGATACGAAGTGAATGTGTAAATCTA
2081 ACTTTGAGGTTCAGTAAGTTAAGTAGTATAGACCTAGAGATCACTGCTTTACCATTTTACTTTCAAATGAATGAGAGCGA
2161 CTGCTAGTGGCAGAACGCAGAAAAGGGGAAAAACAAGCCATGAAATGAAGTTGCTTTCCTGACCTGGGTTTAGGTCATCA
2241 TTTTAAAATCAAAGATGTGTAGGAGATGAATCAACTTATAGACCCATATTTTCCTTCTAAAAGTTTCCCAAAGAAATGTT
2321 ATAGATTTTGAATAACATGCCAGTGACCCAGCAGGTCCAAGATGGCTAACCAAGATGGCTAATTTAGCCACATTGAATAA
2401 CTTACTTTTACCCTCACATGGAAAGTTGGTATCTATTGCTAAATGATTTCAAGGTCACTCTGACAGTCTTTGACACTGTT
2481 TTTTTTAGGGTTTTATTGTTTTCTGGTCTCCTGGTGTCTGTCCTCAGAATTAAAGCATGTCCTGCATCCCTAAGATGATA
2561 GCCAAGGCCTCTCTTTTATTAAGAGTCAGCACTGATGTAGGGTAAAATCAACAGTTTTTGCATATGATTTTAAAATCTTT
2641 CTTTGATTTGAATTTGCTTTAGTGTGTGCATGTTGAGAGGAAGTAAGTGTAGAAACCACCCTAATTTGTAAGTTGGGAGT
2721 TGGAGATACTTGGTGGTTTTTCAAAAATAAAGACTCAATCTTTTTTTTTTTTTTAAACACTCACTACCATCTCCTTCTAA
2801 AACAACTCTGTCAGTTTAAATGGCATATAAAATGTGAACAAACACCTCATTACATGAAGTCAAAATGGTGAAGAGCTTCA
2881 GTGAAACATTTAAAGAGTATATTGTGTGTTGTTTTGCTGTTCATCATTACTTATTAAATGCAGTAATGTTGATTGCCAAA
2961 AAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||: | || ||||||| 
Target 5' aaggcACTCTAAT-TGCTGCTa 3'
998 - 1018 152.00 -12.40
2
miRNA  3' guGUUUG-GUAAUA---------CACGACGAu 5'
            :|:|| ||||:|          ||||||| 
Target 5' caTAGACACATTGTCTCTTTAAAATGCTGCTg 3'
1529 - 1560 148.00 -17.70
3
miRNA  3' guGUUUG-GUAAUACACGACGau 5'
            ::|:: | ||| |||||||  
Target 5' atTGAGTGCTTTACGTGCTGCct 3'
1910 - 1932 140.00 -10.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26998677 12 COSMIC
COSN30184033 12 COSMIC
COSN31493469 30 COSMIC
COSN26998687 49 COSMIC
COSN30179386 60 COSMIC
COSN6419138 78 COSMIC
COSN6419137 83 COSMIC
COSN2526095 87 COSMIC
COSN30560942 88 COSMIC
COSN6419136 89 COSMIC
COSN30499531 93 COSMIC
COSN30504751 94 COSMIC
COSN30573716 94 COSMIC
COSN31553476 96 COSMIC
COSN20074303 174 COSMIC
COSN26333442 186 COSMIC
COSN31603415 322 COSMIC
COSN31607165 322 COSMIC
COSN31522101 373 COSMIC
COSN26465016 436 COSMIC
COSN31513731 521 COSMIC
COSN22320374 547 COSMIC
COSN17738610 627 COSMIC
COSN31523842 675 COSMIC
COSN28758469 716 COSMIC
COSN9866527 772 COSMIC
COSN5127657 790 COSMIC
COSN31590766 801 COSMIC
COSN31565478 978 COSMIC
COSN31556547 1118 COSMIC
COSN16601805 1127 COSMIC
COSN31573110 1265 COSMIC
COSN31544256 1325 COSMIC
COSN31540593 1370 COSMIC
COSN9116017 1399 COSMIC
COSN5489127 1575 COSMIC
COSN25148702 1776 COSMIC
COSN20097357 1871 COSMIC
COSN7116429 2158 COSMIC
COSN19045670 2321 COSMIC
COSN6154244 2445 COSMIC
COSN6154243 2508 COSMIC
COSN22488206 2645 COSMIC
COSN20097354 2761 COSMIC
COSN28201952 2774 COSMIC
COSN20097351 2898 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1485859096 3 dbSNP
rs770590273 5 dbSNP
rs528720883 6 dbSNP
rs143671860 8 dbSNP
rs1351621326 13 dbSNP
rs370522079 16 dbSNP
rs752381858 17 dbSNP
rs377135024 22 dbSNP
rs763366151 24 dbSNP
rs1461866477 30 dbSNP
rs549181628 32 dbSNP
rs755305378 38 dbSNP
rs1325404455 43 dbSNP
rs1333505756 44 dbSNP
rs752108153 50 dbSNP
rs1440760925 53 dbSNP
rs1279779183 55 dbSNP
rs1351940884 57 dbSNP
rs1338687629 62 dbSNP
rs1230685623 70 dbSNP
rs1281009437 71 dbSNP
rs1271631135 72 dbSNP
rs1236182941 73 dbSNP
rs1345549778 74 dbSNP
rs1302219402 75 dbSNP
rs373053221 78 dbSNP
rs1336976141 81 dbSNP
rs1292586694 82 dbSNP
rs1436164872 83 dbSNP
rs371236744 83 dbSNP
rs374842264 84 dbSNP
rs773828470 85 dbSNP
rs1370452134 87 dbSNP
rs1174897310 88 dbSNP
rs200288621 89 dbSNP
rs1416935935 90 dbSNP
rs376529022 90 dbSNP
rs59775790 90 dbSNP
rs1173178884 92 dbSNP
rs1394168955 92 dbSNP
rs1408928791 92 dbSNP
rs1292247757 93 dbSNP
rs1366088523 93 dbSNP
rs1372071459 93 dbSNP
rs1338005468 94 dbSNP
rs1355249952 94 dbSNP
rs1195350832 95 dbSNP
rs531049938 95 dbSNP
rs879185309 95 dbSNP
rs1371320522 96 dbSNP
rs1424183242 96 dbSNP
rs546907050 97 dbSNP
rs563493455 97 dbSNP
rs1432270298 98 dbSNP
rs1470651629 99 dbSNP
rs1375602400 101 dbSNP
rs1397042690 102 dbSNP
rs1234620422 107 dbSNP
rs1336535284 108 dbSNP
rs1202013257 112 dbSNP
rs1227384342 112 dbSNP
rs1232096204 112 dbSNP
rs1249748937 112 dbSNP
rs1279967951 112 dbSNP
rs1298926225 112 dbSNP
rs1325241851 112 dbSNP
rs1344430452 112 dbSNP
rs1433679668 112 dbSNP
rs1446169099 112 dbSNP
rs1483691842 112 dbSNP
rs1491045210 112 dbSNP
rs368477472 112 dbSNP
rs386391818 112 dbSNP
rs71008739 112 dbSNP
rs746776408 112 dbSNP
rs747901998 112 dbSNP
rs771927834 112 dbSNP
rs1321818642 113 dbSNP
rs1381953772 113 dbSNP
rs1367974097 114 dbSNP
rs1438878636 114 dbSNP
rs1302731730 117 dbSNP
rs1179718403 120 dbSNP
rs1313038573 120 dbSNP
rs1034882813 121 dbSNP
rs1349704169 123 dbSNP
rs1258132637 127 dbSNP
rs1249893462 132 dbSNP
rs1467073396 132 dbSNP
rs1192511627 133 dbSNP
rs1267482234 138 dbSNP
rs1434348581 148 dbSNP
rs1213006547 155 dbSNP
rs139673955 157 dbSNP
rs1001624210 184 dbSNP
rs1484533231 204 dbSNP
rs1391527637 226 dbSNP
rs1460307315 227 dbSNP
rs971994781 237 dbSNP
rs1024465956 246 dbSNP
rs1368420133 249 dbSNP
rs532741148 250 dbSNP
rs1305137461 253 dbSNP
rs779861623 261 dbSNP
rs1223948888 264 dbSNP
rs1269752849 267 dbSNP
rs1332359630 272 dbSNP
rs1213016029 274 dbSNP
rs1265899698 286 dbSNP
rs1193569574 291 dbSNP
rs1489179873 291 dbSNP
rs1249458273 298 dbSNP
rs546005290 299 dbSNP
rs1183400768 301 dbSNP
rs533259607 320 dbSNP
rs1277451943 322 dbSNP
rs1164703950 323 dbSNP
rs567973913 323 dbSNP
rs1350905990 324 dbSNP
rs1048760649 330 dbSNP
rs374588951 331 dbSNP
rs1313962283 336 dbSNP
rs35914946 339 dbSNP
rs900164654 349 dbSNP
rs1039220265 353 dbSNP
rs1232383612 355 dbSNP
rs1333943845 355 dbSNP
rs1803497 355 dbSNP
rs386652677 355 dbSNP
rs1313437184 357 dbSNP
rs1323421672 362 dbSNP
rs944461926 364 dbSNP
rs1410394834 366 dbSNP
rs866615982 368 dbSNP
rs1157116399 370 dbSNP
rs866155912 371 dbSNP
rs1483071829 375 dbSNP
rs911741899 384 dbSNP
rs1042180933 387 dbSNP
rs945297801 389 dbSNP
rs1415229106 394 dbSNP
rs1426050215 397 dbSNP
rs1168905118 400 dbSNP
rs1389656642 405 dbSNP
rs1430424199 410 dbSNP
rs1310092034 411 dbSNP
rs1418680567 412 dbSNP
rs1447093152 413 dbSNP
rs779426819 415 dbSNP
rs1381305825 418 dbSNP
rs915127216 421 dbSNP
rs1296714350 426 dbSNP
rs989405906 432 dbSNP
rs1256782196 433 dbSNP
rs758214410 435 dbSNP
rs957639335 438 dbSNP
rs1346683871 440 dbSNP
rs1209916525 451 dbSNP
rs1238379116 453 dbSNP
rs570357786 459 dbSNP
rs1448587759 477 dbSNP
rs796682997 478 dbSNP
rs1281686815 496 dbSNP
rs550611352 499 dbSNP
rs1204202810 500 dbSNP
rs770437041 503 dbSNP
rs541208912 506 dbSNP
rs1294634101 514 dbSNP
rs1450243206 515 dbSNP
rs1170554247 516 dbSNP
rs1235625029 519 dbSNP
rs1354085281 528 dbSNP
rs1393558316 531 dbSNP
rs1414096003 534 dbSNP
rs1045326 541 dbSNP
rs1284162200 543 dbSNP
rs573779043 547 dbSNP
rs1360701301 548 dbSNP
rs750217351 549 dbSNP
rs1347373264 554 dbSNP
rs778610348 560 dbSNP
rs1456917541 562 dbSNP
rs1395249740 571 dbSNP
rs927297138 586 dbSNP
rs555562506 590 dbSNP
rs1280229889 592 dbSNP
rs1207214481 593 dbSNP
rs1314315239 593 dbSNP
rs543119421 598 dbSNP
rs1268117495 599 dbSNP
rs1412972231 604 dbSNP
rs1465728463 610 dbSNP
rs1187099665 618 dbSNP
rs971442147 623 dbSNP
rs1251254142 624 dbSNP
rs867376535 629 dbSNP
rs1477709393 635 dbSNP
rs1192003755 637 dbSNP
rs1240149769 639 dbSNP
rs1024495370 642 dbSNP
rs1158129664 643 dbSNP
rs1187501442 649 dbSNP
rs1458720764 650 dbSNP
rs1330017178 651 dbSNP
rs1465799242 652 dbSNP
rs1276318822 655 dbSNP
rs757211200 658 dbSNP
rs1274712729 662 dbSNP
rs372426086 665 dbSNP
rs1330199173 667 dbSNP
rs1211154357 670 dbSNP
rs1288276207 675 dbSNP
rs1045327 678 dbSNP
rs1222390197 680 dbSNP
rs879922058 680 dbSNP
rs191506067 686 dbSNP
rs1412476921 704 dbSNP
rs1215678938 705 dbSNP
rs1473417978 709 dbSNP
rs1364441178 736 dbSNP
rs900196150 739 dbSNP
rs767573371 742 dbSNP
rs1324932192 747 dbSNP
rs539094642 754 dbSNP
rs1434893725 755 dbSNP
rs762993385 756 dbSNP
rs1283008909 765 dbSNP
rs1328254490 772 dbSNP
rs1229010757 779 dbSNP
rs1459928998 783 dbSNP
rs890164818 784 dbSNP
rs1349388308 793 dbSNP
rs1204732285 794 dbSNP
rs1170985084 801 dbSNP
rs1411622988 802 dbSNP
rs1483952299 806 dbSNP
rs561868051 814 dbSNP
rs1367872245 817 dbSNP
rs1167701336 826 dbSNP
rs1473069117 829 dbSNP
rs1454577866 837 dbSNP
rs1416803420 843 dbSNP
rs144707986 854 dbSNP
rs945246827 857 dbSNP
rs553286696 870 dbSNP
rs1254483794 872 dbSNP
rs1191418939 874 dbSNP
rs187891987 878 dbSNP
rs1054136070 891 dbSNP
rs937929790 892 dbSNP
rs751739832 895 dbSNP
rs1340440311 897 dbSNP
rs1309758625 902 dbSNP
rs1286420199 910 dbSNP
rs927298493 913 dbSNP
rs548059782 920 dbSNP
rs567724395 922 dbSNP
rs950113927 923 dbSNP
rs549562613 927 dbSNP
rs1198561208 928 dbSNP
rs983526274 935 dbSNP
rs750540007 937 dbSNP
rs1448418139 938 dbSNP
rs1305832344 942 dbSNP
rs763211206 955 dbSNP
rs1432442395 964 dbSNP
rs1171595273 965 dbSNP
rs373118282 974 dbSNP
rs530861825 974 dbSNP
rs1019969241 978 dbSNP
rs1444515031 980 dbSNP
rs1336794100 982 dbSNP
rs1363626784 983 dbSNP
rs1434531609 987 dbSNP
rs570205400 987 dbSNP
rs964968987 987 dbSNP
rs1231370381 992 dbSNP
rs1345463537 997 dbSNP
rs1201953688 1001 dbSNP
rs1464366790 1004 dbSNP
rs570208920 1006 dbSNP
rs1167952981 1013 dbSNP
rs1008484296 1019 dbSNP
rs1197740542 1022 dbSNP
rs1377839146 1023 dbSNP
rs1466928272 1026 dbSNP
rs1179006473 1029 dbSNP
rs1387145941 1029 dbSNP
rs1396675625 1032 dbSNP
rs376991744 1035 dbSNP
rs750060001 1035 dbSNP
rs890114002 1042 dbSNP
rs796559557 1045 dbSNP
rs1408010902 1051 dbSNP
rs528603667 1051 dbSNP
rs1020700547 1052 dbSNP
rs1178401636 1053 dbSNP
rs1331882914 1063 dbSNP
rs1479411580 1063 dbSNP
rs1286191142 1070 dbSNP
rs1328176115 1074 dbSNP
rs1009252798 1077 dbSNP
rs1269877914 1079 dbSNP
rs1250233357 1083 dbSNP
rs1208713182 1084 dbSNP
rs893668341 1087 dbSNP
rs1053596752 1092 dbSNP
rs1179521656 1103 dbSNP
rs905068339 1105 dbSNP
rs551788072 1110 dbSNP
rs1366059088 1111 dbSNP
rs1456504336 1112 dbSNP
rs1292989479 1117 dbSNP
rs78923746 1117 dbSNP
rs1407025931 1119 dbSNP
rs559662368 1120 dbSNP
rs1306354753 1122 dbSNP
rs1349665737 1123 dbSNP
rs1228710260 1133 dbSNP
rs1290202153 1137 dbSNP
rs1319831680 1138 dbSNP
rs1282957152 1144 dbSNP
rs917250069 1151 dbSNP
rs983565747 1156 dbSNP
rs929348302 1157 dbSNP
rs1311808517 1165 dbSNP
rs1308024574 1171 dbSNP
rs1250523857 1180 dbSNP
rs376863245 1181 dbSNP
rs1482969503 1182 dbSNP
rs1225534301 1192 dbSNP
rs765588883 1198 dbSNP
rs973559471 1199 dbSNP
rs1164646586 1214 dbSNP
rs540943790 1224 dbSNP
rs1307271899 1231 dbSNP
rs1369152020 1242 dbSNP
rs529206366 1243 dbSNP
rs564098118 1246 dbSNP
rs1166953924 1247 dbSNP
rs543608403 1259 dbSNP
rs987682115 1263 dbSNP
rs777019626 1265 dbSNP
rs2723239 1270 dbSNP
rs1465396281 1276 dbSNP
rs1395405854 1279 dbSNP
rs557471910 1280 dbSNP
rs1313266193 1282 dbSNP
rs1323000984 1286 dbSNP
rs1020563126 1289 dbSNP
rs1273537505 1309 dbSNP
rs545379798 1310 dbSNP
rs762114247 1320 dbSNP
rs1345416664 1323 dbSNP
rs571737341 1325 dbSNP
rs553366691 1326 dbSNP
rs1032591156 1337 dbSNP
rs775186356 1341 dbSNP
rs1416732978 1351 dbSNP
rs534965444 1352 dbSNP
rs1186730140 1367 dbSNP
rs1182043467 1373 dbSNP
rs1389825670 1387 dbSNP
rs1172738343 1388 dbSNP
rs1430679359 1388 dbSNP
rs567950597 1396 dbSNP
rs1465298574 1406 dbSNP
rs1303421860 1408 dbSNP
rs555676940 1412 dbSNP
rs1046384406 1416 dbSNP
rs1199058973 1417 dbSNP
rs1432327950 1425 dbSNP
rs34259786 1444 dbSNP
rs1483164707 1448 dbSNP
rs771814657 1451 dbSNP
rs895834774 1452 dbSNP
rs867206095 1455 dbSNP
rs374505276 1458 dbSNP
rs570147160 1459 dbSNP
rs920656263 1460 dbSNP
rs1209852012 1461 dbSNP
rs1257157395 1469 dbSNP
rs1463023190 1478 dbSNP
rs1803496 1479 dbSNP
rs1247514941 1491 dbSNP
rs1038184634 1506 dbSNP
rs551929742 1507 dbSNP
rs563235560 1509 dbSNP
rs943590512 1510 dbSNP
rs1432438897 1514 dbSNP
rs1291436275 1515 dbSNP
rs1408267710 1519 dbSNP
rs910693139 1523 dbSNP
rs1319753953 1530 dbSNP
rs987711556 1535 dbSNP
rs1395226390 1538 dbSNP
rs954929021 1540 dbSNP
rs369908626 1542 dbSNP
rs1366454781 1543 dbSNP
rs539959137 1543 dbSNP
rs987727889 1545 dbSNP
rs541771207 1548 dbSNP
rs958032846 1561 dbSNP
rs1385420422 1566 dbSNP
rs764742735 1574 dbSNP
rs112273474 1597 dbSNP
rs1290198574 1605 dbSNP
rs528310879 1606 dbSNP
rs1451221903 1610 dbSNP
rs1218019331 1611 dbSNP
rs1245246340 1612 dbSNP
rs1387219188 1613 dbSNP
rs1191955253 1615 dbSNP
rs1032123753 1622 dbSNP
rs1471456342 1635 dbSNP
rs1024368095 1637 dbSNP
rs1158344182 1651 dbSNP
rs778753651 1667 dbSNP
rs958941432 1668 dbSNP
rs1024786094 1694 dbSNP
rs1034396551 1696 dbSNP
rs1348752521 1699 dbSNP
rs1436778847 1701 dbSNP
rs1013529355 1709 dbSNP
rs1006210270 1716 dbSNP
rs1347783137 1727 dbSNP
rs1226937231 1747 dbSNP
rs886987421 1749 dbSNP
rs1351995095 1756 dbSNP
rs1047770826 1758 dbSNP
rs1287859371 1759 dbSNP
rs1451063579 1760 dbSNP
rs993546716 1762 dbSNP
rs899158827 1777 dbSNP
rs757015214 1779 dbSNP
rs943436978 1780 dbSNP
rs566048319 1781 dbSNP
rs1186117903 1784 dbSNP
rs888665009 1791 dbSNP
rs1412459159 1793 dbSNP
rs910733089 1799 dbSNP
rs1165154020 1803 dbSNP
rs182987435 1804 dbSNP
rs1368301127 1812 dbSNP
rs529130892 1814 dbSNP
rs201288592 1818 dbSNP
rs559533522 1819 dbSNP
rs933577183 1822 dbSNP
rs1336690341 1823 dbSNP
rs1445023897 1827 dbSNP
rs994273364 1828 dbSNP
rs914119245 1832 dbSNP
rs1355739286 1833 dbSNP
rs901362292 1836 dbSNP
rs1041178184 1841 dbSNP
rs1294298624 1848 dbSNP
rs1188466196 1849 dbSNP
rs1340274779 1856 dbSNP
rs1204228487 1868 dbSNP
rs62168972 1869 dbSNP
rs62168971 1871 dbSNP
rs549702381 1880 dbSNP
rs1236826687 1881 dbSNP
rs397731608 1881 dbSNP
rs5836317 1881 dbSNP
rs796395003 1881 dbSNP
rs1387976988 1883 dbSNP
rs969521636 1887 dbSNP
rs1168790587 1890 dbSNP
rs546121480 1891 dbSNP
rs578040424 1900 dbSNP
rs1397678287 1907 dbSNP
rs1214394244 1911 dbSNP
rs1053488548 1918 dbSNP
rs1279156165 1922 dbSNP
rs1024818716 1923 dbSNP
rs1199691928 1923 dbSNP
rs1332848969 1924 dbSNP
rs777603339 1924 dbSNP
rs991960176 1928 dbSNP
rs951186711 1929 dbSNP
rs1337121360 1936 dbSNP
rs1263544931 1937 dbSNP
rs936327211 1955 dbSNP
rs1317211756 1956 dbSNP
rs1243982444 1961 dbSNP
rs923813145 1963 dbSNP
rs7595815 1964 dbSNP
rs563817257 1979 dbSNP
rs374109331 1987 dbSNP
rs1363976351 1990 dbSNP
rs917784024 1992 dbSNP
rs568784153 1993 dbSNP
rs1277888360 1994 dbSNP
rs552946883 1998 dbSNP
rs1461684931 2002 dbSNP
rs1205436600 2007 dbSNP
rs1442443482 2008 dbSNP
rs958854440 2013 dbSNP
rs1161903907 2018 dbSNP
rs541855506 2020 dbSNP
rs1448294860 2025 dbSNP
rs574239944 2030 dbSNP
rs899194065 2034 dbSNP
rs952734799 2037 dbSNP
rs1016649150 2039 dbSNP
rs1172961537 2046 dbSNP
rs1171165395 2050 dbSNP
rs1402169948 2057 dbSNP
rs556057104 2060 dbSNP
rs537223514 2061 dbSNP
rs1194519265 2066 dbSNP
rs1434456699 2077 dbSNP
rs1296631422 2084 dbSNP
rs889159799 2089 dbSNP
rs994407328 2093 dbSNP
rs1469829442 2094 dbSNP
rs1274056418 2095 dbSNP
rs901331300 2098 dbSNP
rs1051888249 2100 dbSNP
rs1225292338 2106 dbSNP
rs1019819760 2107 dbSNP
rs892630051 2114 dbSNP
rs1209118499 2116 dbSNP
rs1205194467 2134 dbSNP
rs1052724348 2139 dbSNP
rs936905212 2144 dbSNP
rs766486639 2152 dbSNP
rs924992621 2158 dbSNP
rs1197673110 2166 dbSNP
rs889507519 2176 dbSNP
rs1053947540 2177 dbSNP
rs936297370 2179 dbSNP
rs1410380900 2186 dbSNP
rs991906003 2187 dbSNP
rs981499566 2188 dbSNP
rs1342554365 2189 dbSNP
rs1289489317 2191 dbSNP
rs1387174366 2194 dbSNP
rs970712976 2194 dbSNP
rs1236043665 2203 dbSNP
rs902210478 2209 dbSNP
rs951217895 2210 dbSNP
rs1345921944 2211 dbSNP
rs1328805318 2218 dbSNP
rs189811688 2223 dbSNP
rs1286445688 2224 dbSNP
rs1322330324 2234 dbSNP
rs1025469915 2236 dbSNP
rs974032247 2241 dbSNP
rs564312378 2244 dbSNP
rs138689871 2248 dbSNP
rs962922298 2254 dbSNP
rs1490631722 2255 dbSNP
rs747293701 2263 dbSNP
rs1250294420 2278 dbSNP
rs1016268106 2279 dbSNP
rs1042311978 2281 dbSNP
rs1365615236 2282 dbSNP
rs539903647 2284 dbSNP
rs1376187627 2286 dbSNP
rs1456402291 2288 dbSNP
rs1163257804 2304 dbSNP
rs1007938445 2313 dbSNP
rs779709143 2317 dbSNP
rs1438536725 2321 dbSNP
rs150202548 2322 dbSNP
rs1372293333 2323 dbSNP
rs1391918971 2330 dbSNP
rs1030410898 2333 dbSNP
rs547473965 2341 dbSNP
rs1243413533 2347 dbSNP
rs892662619 2351 dbSNP
rs1054931449 2355 dbSNP
rs143040586 2360 dbSNP
rs936943754 2363 dbSNP
rs1272958169 2365 dbSNP
rs1482566149 2371 dbSNP
rs568250621 2375 dbSNP
rs1178288167 2376 dbSNP
rs1280817839 2379 dbSNP
rs1004106716 2383 dbSNP
rs1045315009 2384 dbSNP
rs1273920466 2386 dbSNP
rs947741019 2393 dbSNP
rs927378762 2397 dbSNP
rs1426823848 2403 dbSNP
rs1166896141 2411 dbSNP
rs186590960 2412 dbSNP
rs1462300094 2415 dbSNP
rs138497497 2416 dbSNP
rs762091657 2419 dbSNP
rs1299873553 2425 dbSNP
rs1399951663 2426 dbSNP
rs991938642 2429 dbSNP
rs1315175255 2435 dbSNP
rs759614324 2438 dbSNP
rs796070930 2440 dbSNP
rs1225740029 2454 dbSNP
rs1408572417 2456 dbSNP
rs929684023 2457 dbSNP
rs16859081 2458 dbSNP
rs1416558886 2461 dbSNP
rs974273292 2471 dbSNP
rs1482547006 2473 dbSNP
rs1203546541 2474 dbSNP
rs1243848312 2475 dbSNP
rs1400336765 2476 dbSNP
rs1172276654 2478 dbSNP
rs918610272 2478 dbSNP
rs181935276 2479 dbSNP
rs962666117 2479 dbSNP
rs985389184 2480 dbSNP
rs1357170595 2481 dbSNP
rs1469246014 2482 dbSNP
rs1337244784 2487 dbSNP
rs1365605136 2487 dbSNP
rs965691586 2490 dbSNP
rs764724289 2510 dbSNP
rs367943810 2511 dbSNP
rs1215568232 2513 dbSNP
rs1020292116 2516 dbSNP
rs1472235383 2518 dbSNP
rs1223456648 2522 dbSNP
rs1007017445 2525 dbSNP
rs1264228017 2542 dbSNP
rs1030275028 2548 dbSNP
rs1258194388 2552 dbSNP
rs1206875998 2556 dbSNP
rs1241784401 2558 dbSNP
rs761299331 2559 dbSNP
rs1212712186 2562 dbSNP
rs1422811048 2563 dbSNP
rs1440553710 2565 dbSNP
rs1177146682 2569 dbSNP
rs1431338439 2571 dbSNP
rs1455235405 2573 dbSNP
rs1157701349 2575 dbSNP
rs1345230428 2581 dbSNP
rs1032064595 2582 dbSNP
rs1432487951 2582 dbSNP
rs1344032641 2583 dbSNP
rs113622541 2584 dbSNP
rs1404717475 2585 dbSNP
rs997568639 2588 dbSNP
rs1000642046 2592 dbSNP
rs551955691 2595 dbSNP
rs1352165820 2597 dbSNP
rs1001477770 2600 dbSNP
rs1317529538 2602 dbSNP
rs1218215042 2604 dbSNP
rs1245193959 2609 dbSNP
rs1490142479 2612 dbSNP
rs375333759 2616 dbSNP
rs1271016024 2623 dbSNP
rs771763161 2627 dbSNP
rs1401875461 2637 dbSNP
rs527381532 2640 dbSNP
rs560232803 2641 dbSNP
rs1162344162 2642 dbSNP
rs1364545564 2647 dbSNP
rs1055470492 2652 dbSNP
rs937831656 2661 dbSNP
rs1450622517 2664 dbSNP
rs990265275 2666 dbSNP
rs1347718934 2676 dbSNP
rs369031026 2678 dbSNP
rs541444139 2680 dbSNP
rs1333673739 2692 dbSNP
rs896168035 2712 dbSNP
rs1225525020 2714 dbSNP
rs1401532675 2725 dbSNP
rs745458561 2726 dbSNP
rs1390861256 2729 dbSNP
rs909066442 2732 dbSNP
rs1157004792 2737 dbSNP
rs1048444485 2748 dbSNP
rs200281649 2754 dbSNP
rs1293704187 2755 dbSNP
rs796696409 2756 dbSNP
rs1181006788 2758 dbSNP
rs918296031 2759 dbSNP
rs544706779 2761 dbSNP
rs1179574867 2763 dbSNP
rs1470912272 2763 dbSNP
rs918579278 2772 dbSNP
rs202107503 2773 dbSNP
rs10713437 2774 dbSNP
rs1247007389 2775 dbSNP
rs1328843490 2775 dbSNP
rs1367849179 2775 dbSNP
rs1408566445 2775 dbSNP
rs35562209 2775 dbSNP
rs372867908 2775 dbSNP
rs563455732 2775 dbSNP
rs1337283198 2778 dbSNP
rs201524632 2778 dbSNP
rs1194999914 2779 dbSNP
rs912788331 2785 dbSNP
rs1273675788 2786 dbSNP
rs1439522395 2786 dbSNP
rs1201637704 2789 dbSNP
rs1236712983 2791 dbSNP
rs941230207 2793 dbSNP
rs770718569 2797 dbSNP
rs1193395612 2799 dbSNP
rs1444637803 2799 dbSNP
rs1185119064 2800 dbSNP
rs911037313 2809 dbSNP
rs1370968794 2810 dbSNP
rs1448350683 2812 dbSNP
rs562363288 2820 dbSNP
rs1167672253 2828 dbSNP
rs1420621495 2830 dbSNP
rs954221136 2839 dbSNP
rs985370360 2841 dbSNP
rs1453468893 2845 dbSNP
rs771157645 2845 dbSNP
rs1339010809 2848 dbSNP
rs1324888776 2849 dbSNP
rs750196244 2853 dbSNP
rs1334986058 2854 dbSNP
rs955261911 2870 dbSNP
rs1341140611 2871 dbSNP
rs1221615940 2876 dbSNP
rs1032552364 2887 dbSNP
rs1000610620 2890 dbSNP
rs1259284771 2892 dbSNP
rs976022929 2892 dbSNP
rs956699446 2895 dbSNP
rs1193397284 2898 dbSNP
rs1243073177 2900 dbSNP
rs1478968749 2900 dbSNP
rs1354634874 2902 dbSNP
rs201595179 2902 dbSNP
rs10568002 2903 dbSNP
rs34226908 2903 dbSNP
rs1431990171 2905 dbSNP
rs1367579737 2910 dbSNP
rs544092615 2911 dbSNP
rs1318862336 2914 dbSNP
rs1434446389 2921 dbSNP
rs1470373521 2923 dbSNP
rs1178715204 2928 dbSNP
rs1395327831 2930 dbSNP
rs1382818456 2934 dbSNP
rs966415988 2934 dbSNP
rs1166783839 2942 dbSNP
rs1319151507 2946 dbSNP
rs1020722019 2948 dbSNP
rs190879998 2954 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||: | || ||||||| 
Target 5' ----cACUCUAAU-UGCUGCUa 3'
1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
CLIP-seq Support 1 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000431350.2 | 3UTR | CACUCUAAUUGCUGCUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000431350.2 | 3UTR | CACUCUAAUUGCUGCUAAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis 0.797 7.6e-6 0.832 1.5e-6 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.669 6.3e-4 0.698 3.1e-4 20 Click to see details
GSE21032 Prostate cancer 0.246 1.2e-2 0.207 3.0e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.489 1.4e-2 -0.559 5.2e-3 20 Click to see details
GSE19783 ER- ER- breast cancer 0.229 2.1e-2 0.211 3.1e-2 79 Click to see details
GSE28260 Renal cortex and medulla -0.528 3.2e-2 -0.527 3.2e-2 13 Click to see details
GSE19536 Breast cancer 0.168 4.7e-2 0.135 9.0e-2 100 Click to see details
GSE32688 Pancreatic cancer 0.282 5.9e-2 0.041 4.1e-1 32 Click to see details
GSE17306 Multiple myeloma -0.199 8.5e-2 -0.209 7.5e-2 49 Click to see details
GSE17498 Multiple myeloma 0.182 1.3e-1 0.104 2.6e-1 40 Click to see details
GSE27834 Pluripotent stem cells -0.296 1.3e-1 -0.382 7.2e-2 16 Click to see details
GSE42095 Differentiated embryonic stem cells 0.228 1.5e-1 0.262 1.1e-1 23 Click to see details
GSE19350 CNS germ cell tumors 0.289 1.8e-1 0.021 4.7e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.148 2.4e-1 -0.043 4.2e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.068 2.6e-1 -0.044 3.4e-1 90 Click to see details
GSE28544 Breast cancer 0.132 2.7e-1 0.238 1.3e-1 24 Click to see details
GSE21849 B cell lymphoma 0.08 3.4e-1 0.080 3.4e-1 29 Click to see details
GSE26953 Aortic valvular endothelial cells -0.041 4.2e-1 -0.116 2.9e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.024 4.5e-1 0.055 4.0e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.024 4.5e-1 0.055 4.0e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0 5.0e-1 -0.058 3.2e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.531 0 -0.517 0 32 Click to see details
BLCA -0.593 0 -0.602 0 18 Click to see details
PAAD 0.917 0.04 1.000 0.5 4 Click to see details
PCPG -0.985 0.06 -1.000 0.5 3 Click to see details
LUSC -0.236 0.08 -0.145 0.19 38 Click to see details
KICH -0.281 0.09 -0.315 0.06 25 Click to see details
LUAD -0.396 0.1 -0.483 0.06 12 Click to see details
PRAD 0.175 0.11 0.132 0.18 50 Click to see details
KIRP 0.213 0.12 0.123 0.25 32 Click to see details
HNSC 0.182 0.12 0.135 0.2 42 Click to see details
CHOL -0.403 0.14 -0.367 0.17 9 Click to see details
LIHC -0.138 0.17 -0.102 0.24 49 Click to see details
UCEC 0.221 0.18 0.061 0.4 19 Click to see details
BRCA -0.099 0.19 -0.136 0.11 84 Click to see details
ESCA -0.181 0.3 -0.091 0.4 11 Click to see details
KIRC -0.045 0.36 -0.063 0.3 68 Click to see details
COAD -0.143 0.37 -0.571 0.07 8 Click to see details
THCA -0.009 0.47 -0.017 0.45 59 Click to see details
CESC 0.04 0.49 -0.500 0.33 3 Click to see details
CESC 0.04 0.49 -0.500 0.33 3 Click to see details
CESC 0.04 0.49 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*