miRTarBase - #MIRT568621 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ACVR2A   
Synonyms ACTRII, ACVR2
Description activin A receptor type 2A
Transcript NM_001616   
Expression
Putative miRNA Targets on ACVR2A
3'UTR of ACVR2A
(miRNA target sites are highlighted)
>ACVR2A|NM_001616|3'UTR
   1 TGGTTGCGCCATCTGTGCACACTAAGAAATGGGACTCTGAACTGGAGCTGCTAAGCTAAAGAAACTGCTTACAGTTTATT
  81 TTCTGTGTAAAATGAGTAGGATGTCTCTTGGAAATGTTAAGAAAGAAGACCCTTTGTTGAAAAATGTTGCTCTGGGAGAC
 161 TTACTGCATTGCCGACAGCACAGATGTGAAGGACATGAGACTAAGAGAAACCTTGCAAACTCTATAAAGAAACTTTTGAA
 241 AAAGTGTACATGAAGAATGTAGCCCTCTCCAAATCAAGGATCTTTTGGACCTGGCTAATGGAGTGTTTGAAAACTGACAT
 321 CAGATTTCTTAATGTCTGTCAGAAGACACTAATTCCTTAAATGAACTACTGCTATTTTTTTTAAATCAAAAACTTTTCAT
 401 TTCAGATTTTAAAAAGGGTAACTTGTTTTTATTGCATTTGCTGTTGTTTCTATAAATGACTATTGTAATGCCAATATGAC
 481 ACAGCTTGTGAATGTTTAGTGTGCTGCTGTTCTGTGTACATAAAGTCATCAAAGTGGGGTACAGTAAAGAGGCTTCCAAG
 561 CATTACTTTAACCTCCCTCAACAAGGTATACCTCAGTTCCACGGTTGCTAAATTATAAAATTGAAAACACTAACAAAATT
 641 TGAATAATAAATCGATCCATGTTTTGTAACAAATTCACTGTGTTATTTAAGGAAAAAAAGGTAAGCTATGCTTAGTGCCA
 721 ACAATAAGTGGCCATTCGTAAAGCAGTGTTTTAGCATTTCTTGTGCTGGCTTGTAATGTAGGGAAAAAAAGTGCTGTTTT
 801 TTGAAAAGATGGTGTCATTTCCCCCTTCTTCCCATGTTTTAAAGCCCCATCTTATATCCAGTTCCCAAAATTTGCATACT
 881 TACCTAAGTATTTTTTTTAGGTGTGCTGTGTTTGGGGAATATTTGAAAATTTAAAGCATGATTTAAAATTTTTTAAAGTG
 961 AGCTGTGACACTGGAAAGCTCTTCATTTTATCTTTTAAAATAGAGTTTTTTCTATTTATATATGTAAAATTGTAGTGTAT
1041 TTCTTTTCACCAAACAGTGTGTGGGACATTCTTTATCACTGTTTTAGGATCACCTCAGGAAGTGTCGTTACCCAGAATTC
1121 CCCACTGTCTGCTATGAGACTTGTAACTTTATCACTATACTTCTGCTTGGTGCCATCTTGTCAGAGTAATATTTGATGTC
1201 TGTGATATGTAAAGAATTATCCTAGGATAAAGATATTAAACTTTAAGCAGATTTCAGATGTTACTGCTTTAAAACAAATC
1281 AGGGATAACAAATTAAACGTATAACTTAAAATATGCAATGACATTTAGAGGTAACCAATGTTGATATAGGTAGCATAGCC
1361 TAGCCTCCTCCCCAAAATTGCTTTTACAACTAACACTGATACTAATTTAGGATAGTTCATGCCTTATCCTTGCTAAGAAA
1441 ATGGAATTGATGGTAGGCAGGTGCTAAAGTGCTTTTCAAAACAATATTACGTTAGAATACAATTGGATTCTTCCTCAAAT
1521 TTATACAGGCCAAAAAGTAAAACATTAATTTTCTGAATTTCCAGATTACCAATCAATTAATCAACAAATAGCCAGTATTA
1601 TGCTGTGTATTTCTGTCAGGTCATTTTAAAATCCATGTTAATTTTATAAAAGAATTTTTTACATGTCACTGTCAGGAGCT
1681 CACTGTGAATGTGTTGTCTTCAAATGGTTATTTAACCACACAGTACACTACATTTTACATATATGTACGTAATCTCTGGG
1761 AATAGTAAATTAATTATGTTATTTATAAACAATACATAGGTCAACAGACTTTAAGCAGGGAGGAAAAGAAGAGTAATAGC
1841 GTCTGTGTGCTGCAGACCATTCAGAACTGTCACGTGTGTCCCCATGGTCTCATTCATTGTATTCCTAGCAATTCCCTTTT
1921 CAATGTTGAGTTCACCTCTTTATTTCACAAAGTACTTGGTCTCTCAATTTCTTGATCTGGTTTTGCTTCCATTTAAAAAC
2001 TAATCAAGAAGGGAAAATATTGAGAATGTGCATACAAGAAAATCATTAATTTCCTGAAGATGAATTTCTACCTGTTGTGA
2081 ACATTTAACTTTCTTTTTAAAAGTTAAACAAAAATAAACAAGGGATATTATGATGAATGTTTGGCTTATGTGAGTACTAG
2161 AGATAAAATTTTTAAACCCAGTTATTCACAATATAAAATGTTTTCAAGTTAGAAAAAATTTTTAGAAATCCTGGGTATTG
2241 TATTTAACTGTAGCTAACCAATTTTAAAACTTGTATTCTTTTGAGAACTATTATTAATAGAAAAACTTTTTATAAGCAGT
2321 AAAATAAGAATGTTCCAGTGACTACCTGTCCTTATACCTAGTCTTGTTAAAACTTTCTTTTGCAGGGTATTTAGTGTTTG
2401 GTTTACAGTCAGTGCAGAGTGGGCAAGTTAACAGAAAGTTTGAGCTAGAGATACTGGAAAAAAAAAAGATCAAAGAATGA
2481 GAAAAATGGTGATCCATTTTGGGGCAAACTGAGACCCCCCAAATAACTCTTTCCTCATGTGTATGGTGCTCCTCATGACT
2561 CGTCTTGTATTTTGCCTTTCTGATACCCATCAGAACTGCTGCTGCTCTAACTTATACTCTTTACCTTGCCCAGATCTCCG
2641 CGTAAGGAATGCTTTATGATCAACTTGCCATAGGACTGATGGATTAACCAGTGTTCGGCTTTATTTGAAGTCTATGCCCT
2721 GCACAGCTCTTGTATGTATTTTAGATGCTAGAAGTTTTTTTAGCATGTGATGTGTGATTCTTGTTTGAATTCTAGGTACC
2801 TTGTGAATTCCAGAAAAAGAGACTGTGCTTCACGATTGTTAGTCCCATGAACTTGCACTATCTATCTTTCATGGTGATGT
2881 TTTGAAAATACAATCAGGAAAAAACCCAACACCTTTGGAATTTAAAATAGAATCATATCATGAAATTTAAAAAGAATCTC
2961 TTCTGTTGCATTTCCTCACCCCTAAGTAACAGCTACATTTAAGTAAAATGCAGGTGGTAGGGGAAAAAAAACCATGGCGA
3041 GATGGTGGTTTAGTGGAATAAACTGATTACTGGTTTTTTTGTTTTTTTTTTTTTTTTTAAAGAAAGAAGCTTCATCACAG
3121 ATACTTTCCAGTTTCTCTTTTATACTTTTTTGAAAGATTACTTTTTAGGAACATTTGGTATGATATGCATAAAATTATTT
3201 ATCCATTTATGGGCAAAATGATACAAGTAGCATCTTGATTGAACATCATTTACCTCAGATATTCAACCAGCAGTACGTTT
3281 TTTATGCAGTCTCAACCCATATCCCATTTGTTACCTCTCAGAATATTGGTAAGCAGTTATTTTCGCTTTACTCTGTATTT
3361 CTTGTGTTTTGGGCACAGGTTATTGTACTACTGTCAAATCGTACTTGCTATTTTTTCTGCAAGTATTTAACAGAAAGCTT
3441 AAAATCCCCATAAAACCCCACCTTGGATAAGTGATTGTTAAATATTGTACAAATAAAATGTATGCTATCCCCATTCCATC
3521 CCCAAGTTAAATAAAAAAATGAATACGGTATGAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAU-ACACGACGAu 5'
            ::||:  ||| ||||||||| 
Target 5' tgTGAATGTTTAGTGTGCTGCTg 3'
487 - 509 164.00 -15.70
2
miRNA  3' guguUUGGUAAU----AC-ACGACGAu 5'
              | |||| |    || ||||||| 
Target 5' tgatACCCATCAGAACTGCTGCTGCTc 3'
2581 - 2607 152.00 -15.30
3
miRNA  3' guGUU-UGGUA-AUACACGACGau 5'
            :|| | |:| |:||||||||  
Target 5' agTAATAGCGTCTGTGTGCTGCag 3'
1832 - 1855 144.00 -15.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30119090 5 COSMIC
COSN20074171 8 COSMIC
COSN13939688 9 COSMIC
COSN30578028 26 COSMIC
COSN30709014 50 COSMIC
COSN31660838 57 COSMIC
COSN31525551 62 COSMIC
COSN30144452 69 COSMIC
COSN31521980 172 COSMIC
COSN28882146 178 COSMIC
COSN24720514 231 COSMIC
COSN4797521 271 COSMIC
COSN31578836 285 COSMIC
COSN30170884 404 COSMIC
COSN31536400 445 COSMIC
COSN9862514 466 COSMIC
COSN9862515 467 COSMIC
COSN31527985 528 COSMIC
COSN31596471 669 COSMIC
COSN28814130 778 COSMIC
COSN31540163 899 COSMIC
COSN24294820 1003 COSMIC
COSN31485100 1012 COSMIC
COSN30173299 1044 COSMIC
COSN31576249 1128 COSMIC
COSN31549835 1298 COSMIC
COSN31567820 1440 COSMIC
COSN26645708 1606 COSMIC
COSN31590305 1655 COSMIC
COSN31961725 1699 COSMIC
COSN27156928 1905 COSMIC
COSN20097222 2106 COSMIC
COSN22628673 2178 COSMIC
COSN24230470 2272 COSMIC
COSN31486654 2284 COSMIC
COSN31584361 2286 COSMIC
COSN21695814 2537 COSMIC
COSN26560600 2628 COSMIC
COSN21963287 2683 COSMIC
COSN20229284 2784 COSMIC
COSN31583086 2793 COSMIC
COSN20097224 3099 COSMIC
COSN15660959 3100 COSMIC
COSN7107992 3187 COSMIC
COSN26636642 3188 COSMIC
COSN7107993 3227 COSMIC
COSN31531182 3252 COSMIC
COSN31547359 3346 COSMIC
COSN28778519 3364 COSMIC
COSN31523841 3388 COSMIC
COSN9067879 3476 COSMIC
COSN30029508 3504 COSMIC
COSN31592607 3504 COSMIC
rs17692648 2889 GWAS
rs151062078 3082 GWAS
rs5835176 3083 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1426520441 4 dbSNP
rs770324693 4 dbSNP
rs978379535 6 dbSNP
rs201620807 8 dbSNP
rs375329742 9 dbSNP
rs757398334 14 dbSNP
rs1430033047 23 dbSNP
rs1463608927 25 dbSNP
rs558172231 30 dbSNP
rs1168504682 32 dbSNP
rs1399640405 34 dbSNP
rs778868374 36 dbSNP
rs890119377 38 dbSNP
rs745374659 48 dbSNP
rs566531448 63 dbSNP
rs1168441643 65 dbSNP
rs933445120 69 dbSNP
rs1014615807 72 dbSNP
rs1371870584 73 dbSNP
rs1317819195 74 dbSNP
rs1051695973 78 dbSNP
rs907896834 81 dbSNP
rs780376676 86 dbSNP
rs1312481237 94 dbSNP
rs1389551447 101 dbSNP
rs1338094575 102 dbSNP
rs939919235 102 dbSNP
rs527739012 109 dbSNP
rs973206133 112 dbSNP
rs1036956450 115 dbSNP
rs1322146753 116 dbSNP
rs1024204964 119 dbSNP
rs1373414591 121 dbSNP
rs1186656676 124 dbSNP
rs1803029 131 dbSNP
rs1434124621 133 dbSNP
rs969621476 138 dbSNP
rs1245250525 154 dbSNP
rs1293306226 155 dbSNP
rs898290924 159 dbSNP
rs982760973 161 dbSNP
rs1457339077 163 dbSNP
rs1270982289 174 dbSNP
rs1198017468 175 dbSNP
rs1340759058 181 dbSNP
rs1247051272 184 dbSNP
rs751273191 188 dbSNP
rs935586979 189 dbSNP
rs1055407836 196 dbSNP
rs894880405 198 dbSNP
rs147387385 208 dbSNP
rs1211984361 209 dbSNP
rs192909728 219 dbSNP
rs946780579 222 dbSNP
rs1411585614 223 dbSNP
rs1162407444 226 dbSNP
rs1397173111 226 dbSNP
rs1465589698 227 dbSNP
rs1039816135 230 dbSNP
rs921759335 231 dbSNP
rs1186328126 234 dbSNP
rs931868537 234 dbSNP
rs1051606866 237 dbSNP
rs1231238395 242 dbSNP
rs112515489 250 dbSNP
rs1004816000 266 dbSNP
rs184320682 268 dbSNP
rs898855159 270 dbSNP
rs1361989384 271 dbSNP
rs994992677 277 dbSNP
rs1023415899 278 dbSNP
rs1352613435 289 dbSNP
rs1277232641 295 dbSNP
rs1443799912 300 dbSNP
rs1367316955 308 dbSNP
rs1459429735 325 dbSNP
rs1160866655 330 dbSNP
rs1388965322 333 dbSNP
rs1367147873 335 dbSNP
rs1164041621 346 dbSNP
rs569751857 350 dbSNP
rs1419327177 372 dbSNP
rs1434044854 373 dbSNP
rs1003673453 375 dbSNP
rs969550761 375 dbSNP
rs1377173616 378 dbSNP
rs1035170944 383 dbSNP
rs1490999908 384 dbSNP
rs1270042576 385 dbSNP
rs772972639 387 dbSNP
rs1446042220 394 dbSNP
rs568257205 394 dbSNP
rs1281634571 395 dbSNP
rs781487124 397 dbSNP
rs1275551400 419 dbSNP
rs1311928575 420 dbSNP
rs988383469 423 dbSNP
rs769792502 424 dbSNP
rs968116357 435 dbSNP
rs1303505062 444 dbSNP
rs137976741 453 dbSNP
rs974934392 463 dbSNP
rs1320492217 468 dbSNP
rs777529977 473 dbSNP
rs1401565775 475 dbSNP
rs1174450584 480 dbSNP
rs1481687437 482 dbSNP
rs1231551938 491 dbSNP
rs188715230 498 dbSNP
rs540372667 501 dbSNP
rs1330138378 502 dbSNP
rs921325363 523 dbSNP
rs1244195923 524 dbSNP
rs1217416361 527 dbSNP
rs934072308 529 dbSNP
rs1259411596 531 dbSNP
rs1029139705 533 dbSNP
rs954778580 535 dbSNP
rs763077912 539 dbSNP
rs1283794165 545 dbSNP
rs1213947235 546 dbSNP
rs1359527349 558 dbSNP
rs1271729842 560 dbSNP
rs1431746040 575 dbSNP
rs911755604 580 dbSNP
rs572084136 589 dbSNP
rs987535903 602 dbSNP
rs555802188 603 dbSNP
rs545884882 604 dbSNP
rs973846593 611 dbSNP
rs898815658 616 dbSNP
rs1422076109 617 dbSNP
rs1187541032 622 dbSNP
rs1183768392 632 dbSNP
rs1242205216 637 dbSNP
rs994478044 638 dbSNP
rs1181394200 645 dbSNP
rs1045126946 646 dbSNP
rs1462237002 646 dbSNP
rs1412220502 652 dbSNP
rs144014646 654 dbSNP
rs931247789 660 dbSNP
rs1305762482 665 dbSNP
rs1156658837 673 dbSNP
rs1214993901 675 dbSNP
rs1054952931 677 dbSNP
rs1003261185 679 dbSNP
rs1454781935 679 dbSNP
rs774272760 681 dbSNP
rs949092191 691 dbSNP
rs956894965 693 dbSNP
rs1009774787 696 dbSNP
rs1046181592 701 dbSNP
rs1360611583 716 dbSNP
rs74730572 725 dbSNP
rs1171541730 726 dbSNP
rs1405090061 736 dbSNP
rs1022579852 738 dbSNP
rs576237505 739 dbSNP
rs968713693 745 dbSNP
rs975401507 750 dbSNP
rs1176164038 755 dbSNP
rs1466372988 760 dbSNP
rs1302142733 764 dbSNP
rs1373591178 767 dbSNP
rs1412977677 770 dbSNP
rs921283926 772 dbSNP
rs1351335938 777 dbSNP
rs1223366188 780 dbSNP
rs1358376259 781 dbSNP
rs955470310 784 dbSNP
rs180683564 785 dbSNP
rs911724532 792 dbSNP
rs940538648 792 dbSNP
rs999190349 797 dbSNP
rs1306348717 801 dbSNP
rs909001396 804 dbSNP
rs971896809 808 dbSNP
rs1032460101 810 dbSNP
rs1280209535 817 dbSNP
rs1485003886 818 dbSNP
rs894037705 824 dbSNP
rs1206660021 825 dbSNP
rs996859023 828 dbSNP
rs1258324352 835 dbSNP
rs1364042577 837 dbSNP
rs375846152 839 dbSNP
rs148171495 848 dbSNP
rs930573074 850 dbSNP
rs1157944164 852 dbSNP
rs954880306 861 dbSNP
rs761041419 862 dbSNP
rs1433513639 867 dbSNP
rs1044709398 869 dbSNP
rs1393181226 872 dbSNP
rs1409531456 874 dbSNP
rs1431624040 874 dbSNP
rs1308567203 875 dbSNP
rs1490182105 877 dbSNP
rs1266500216 880 dbSNP
rs1185361375 881 dbSNP
rs904887926 881 dbSNP
rs1490569324 882 dbSNP
rs1237202595 885 dbSNP
rs1318740947 885 dbSNP
rs939088237 885 dbSNP
rs1296630154 886 dbSNP
rs1223424756 891 dbSNP
rs751197567 891 dbSNP
rs1370059728 892 dbSNP
rs768690362 903 dbSNP
rs544775606 909 dbSNP
rs892628161 909 dbSNP
rs1287858550 911 dbSNP
rs562871051 911 dbSNP
rs973410766 913 dbSNP
rs776799060 922 dbSNP
rs1346333502 933 dbSNP
rs563144810 934 dbSNP
rs780172467 938 dbSNP
rs1022888741 945 dbSNP
rs747912004 949 dbSNP
rs1427176955 950 dbSNP
rs1436674979 955 dbSNP
rs904082068 972 dbSNP
rs1480620040 973 dbSNP
rs1260787766 985 dbSNP
rs1203556640 988 dbSNP
rs1487006315 989 dbSNP
rs1203165682 990 dbSNP
rs1261385429 990 dbSNP
rs997534805 993 dbSNP
rs1248059916 994 dbSNP
rs1285702784 994 dbSNP
rs1488630184 999 dbSNP
rs761762797 1001 dbSNP
rs1363685859 1002 dbSNP
rs1380163154 1002 dbSNP
rs765332672 1002 dbSNP
rs530283078 1005 dbSNP
rs1169499508 1006 dbSNP
rs771868279 1006 dbSNP
rs1403311178 1011 dbSNP
rs1178423434 1013 dbSNP
rs986875162 1014 dbSNP
rs1190844327 1019 dbSNP
rs990752381 1023 dbSNP
rs1392964905 1035 dbSNP
rs1430491386 1038 dbSNP
rs1015650193 1040 dbSNP
rs542519154 1044 dbSNP
rs1459983778 1048 dbSNP
rs1265093429 1049 dbSNP
rs961454717 1051 dbSNP
rs971897701 1051 dbSNP
rs1249941948 1055 dbSNP
rs1230134823 1062 dbSNP
rs1308472324 1066 dbSNP
rs916378285 1068 dbSNP
rs1451473312 1069 dbSNP
rs1379872113 1075 dbSNP
rs1451114532 1075 dbSNP
rs920434272 1086 dbSNP
rs1395738575 1089 dbSNP
rs1166107448 1090 dbSNP
rs1463294000 1093 dbSNP
rs930565405 1095 dbSNP
rs1163105265 1104 dbSNP
rs1443068679 1107 dbSNP
rs560081086 1108 dbSNP
rs1188377393 1110 dbSNP
rs185409061 1113 dbSNP
rs926309206 1124 dbSNP
rs776619624 1130 dbSNP
rs1046296189 1132 dbSNP
rs902255022 1138 dbSNP
rs1351817970 1139 dbSNP
rs1291526792 1141 dbSNP
rs1437536067 1144 dbSNP
rs1356912658 1150 dbSNP
rs533436948 1151 dbSNP
rs190507263 1160 dbSNP
rs545256865 1161 dbSNP
rs570598850 1171 dbSNP
rs1043873097 1179 dbSNP
rs1370925184 1183 dbSNP
rs1302381692 1189 dbSNP
rs1298938308 1191 dbSNP
rs1387366087 1193 dbSNP
rs904042106 1197 dbSNP
rs1164070131 1205 dbSNP
rs1469658806 1209 dbSNP
rs1362143863 1210 dbSNP
rs1388074028 1215 dbSNP
rs531875697 1227 dbSNP
rs1212272895 1229 dbSNP
rs1268623225 1233 dbSNP
rs1220773128 1234 dbSNP
rs1489708385 1235 dbSNP
rs1291489592 1237 dbSNP
rs1321799669 1239 dbSNP
rs1210065306 1242 dbSNP
rs549708880 1251 dbSNP
rs1277322929 1252 dbSNP
rs1029026046 1254 dbSNP
rs568252477 1258 dbSNP
rs1351070815 1259 dbSNP
rs1402817604 1262 dbSNP
rs1050646843 1278 dbSNP
rs891391137 1282 dbSNP
rs1324372994 1284 dbSNP
rs565719623 1287 dbSNP
rs1008190715 1288 dbSNP
rs1160442702 1289 dbSNP
rs1473189238 1290 dbSNP
rs1466059730 1297 dbSNP
rs535350698 1299 dbSNP
rs182267646 1300 dbSNP
rs961423670 1302 dbSNP
rs147286326 1303 dbSNP
rs1415964529 1304 dbSNP
rs1210106584 1315 dbSNP
rs1329263762 1318 dbSNP
rs1462039787 1319 dbSNP
rs1015071233 1323 dbSNP
rs1369390960 1324 dbSNP
rs1164416623 1325 dbSNP
rs1392593342 1332 dbSNP
rs1459125668 1348 dbSNP
rs1319446741 1355 dbSNP
rs763438068 1357 dbSNP
rs1320347773 1361 dbSNP
rs35733780 1370 dbSNP
rs765337382 1388 dbSNP
rs539424674 1391 dbSNP
rs757777116 1392 dbSNP
rs557826365 1394 dbSNP
rs1286483963 1395 dbSNP
rs576201251 1399 dbSNP
rs980708466 1400 dbSNP
rs1027631030 1409 dbSNP
rs773123154 1419 dbSNP
rs990701362 1424 dbSNP
rs916493615 1427 dbSNP
rs1270853832 1433 dbSNP
rs1190143544 1435 dbSNP
rs960615118 1450 dbSNP
rs1242004216 1466 dbSNP
rs970669302 1474 dbSNP
rs1201677851 1485 dbSNP
rs981921131 1491 dbSNP
rs751856387 1492 dbSNP
rs935065917 1496 dbSNP
rs1213829293 1502 dbSNP
rs1337232879 1504 dbSNP
rs1053950468 1508 dbSNP
rs1436101261 1519 dbSNP
rs914880994 1527 dbSNP
rs543506337 1530 dbSNP
rs1189457734 1534 dbSNP
rs754670641 1537 dbSNP
rs945109309 1539 dbSNP
rs1455018686 1543 dbSNP
rs1360298834 1544 dbSNP
rs1170385459 1546 dbSNP
rs1408531693 1551 dbSNP
rs556441061 1555 dbSNP
rs1475552789 1565 dbSNP
rs1043905064 1567 dbSNP
rs766083265 1570 dbSNP
rs932778783 1570 dbSNP
rs1181259909 1571 dbSNP
rs1237939594 1575 dbSNP
rs1415924783 1575 dbSNP
rs1203773688 1576 dbSNP
rs1049925474 1577 dbSNP
rs1229399678 1579 dbSNP
rs1276578748 1579 dbSNP
rs1359037946 1581 dbSNP
rs1312983831 1585 dbSNP
rs1159372610 1587 dbSNP
rs931643597 1593 dbSNP
rs186884887 1597 dbSNP
rs1050093922 1602 dbSNP
rs1298038369 1604 dbSNP
rs1399344244 1606 dbSNP
rs559722189 1608 dbSNP
rs111430637 1611 dbSNP
rs1384282034 1621 dbSNP
rs1376640393 1623 dbSNP
rs1425004051 1624 dbSNP
rs1413896224 1626 dbSNP
rs752283485 1628 dbSNP
rs1037019305 1629 dbSNP
rs1009133731 1637 dbSNP
rs1290971174 1638 dbSNP
rs1205665075 1640 dbSNP
rs191765833 1640 dbSNP
rs1490131447 1648 dbSNP
rs1289813491 1649 dbSNP
rs182485553 1653 dbSNP
rs1306461440 1654 dbSNP
rs1222561603 1655 dbSNP
rs1352908379 1660 dbSNP
rs545784853 1672 dbSNP
rs994891086 1675 dbSNP
rs1278603068 1684 dbSNP
rs185295528 1685 dbSNP
rs1201992007 1688 dbSNP
rs531667896 1692 dbSNP
rs958852534 1695 dbSNP
rs1012920271 1696 dbSNP
rs1279205091 1708 dbSNP
rs1157780134 1712 dbSNP
rs1002407132 1717 dbSNP
rs1033492956 1718 dbSNP
rs1024333459 1722 dbSNP
rs960584289 1722 dbSNP
rs1479949062 1728 dbSNP
rs550262404 1732 dbSNP
rs1266525450 1734 dbSNP
rs190105658 1743 dbSNP
rs1488969339 1745 dbSNP
rs1260188835 1746 dbSNP
rs1255578237 1747 dbSNP
rs529061716 1749 dbSNP
rs923773447 1750 dbSNP
rs966812519 1754 dbSNP
rs547644307 1764 dbSNP
rs989364915 1767 dbSNP
rs1363472787 1768 dbSNP
rs914974141 1768 dbSNP
rs571617169 1774 dbSNP
rs1491354422 1775 dbSNP
rs1491309921 1776 dbSNP
rs1455149905 1778 dbSNP
rs932434874 1783 dbSNP
rs1159736760 1786 dbSNP
rs1469278968 1787 dbSNP
rs1049891994 1792 dbSNP
rs1434717631 1797 dbSNP
rs912763184 1801 dbSNP
rs944252079 1806 dbSNP
rs1037328204 1810 dbSNP
rs1185034133 1817 dbSNP
rs897153762 1823 dbSNP
rs1371803504 1829 dbSNP
rs1248740638 1832 dbSNP
rs1391481043 1839 dbSNP
rs1327715735 1841 dbSNP
rs777392400 1842 dbSNP
rs1322079205 1843 dbSNP
rs1048392379 1844 dbSNP
rs905919565 1844 dbSNP
rs1307315230 1848 dbSNP
rs1001640670 1852 dbSNP
rs1294327659 1858 dbSNP
rs1303950965 1859 dbSNP
rs1320722387 1863 dbSNP
rs1451789723 1864 dbSNP
rs1050037289 1874 dbSNP
rs565970117 1875 dbSNP
rs960566386 1880 dbSNP
rs1484054592 1886 dbSNP
rs944937263 1887 dbSNP
rs1183116222 1888 dbSNP
rs1390829249 1888 dbSNP
rs1250059177 1893 dbSNP
rs1436351769 1901 dbSNP
rs1020793655 1908 dbSNP
rs966653367 1924 dbSNP
rs1253953056 1929 dbSNP
rs1480477701 1934 dbSNP
rs1454115307 1949 dbSNP
rs1172260243 1951 dbSNP
rs1225721836 1953 dbSNP
rs1037022949 1959 dbSNP
rs376695352 1960 dbSNP
rs1297670912 1965 dbSNP
rs148799216 1975 dbSNP
rs561024837 1976 dbSNP
rs531436094 1989 dbSNP
rs930798896 1991 dbSNP
rs1049268745 1993 dbSNP
rs551349057 2002 dbSNP
rs1431834671 2006 dbSNP
rs1371342782 2009 dbSNP
rs1163206661 2010 dbSNP
rs1393857111 2016 dbSNP
rs1388218780 2027 dbSNP
rs1188836682 2029 dbSNP
rs912733905 2035 dbSNP
rs1326173168 2036 dbSNP
rs1281249513 2039 dbSNP
rs569643102 2045 dbSNP
rs142478109 2047 dbSNP
rs1274864392 2057 dbSNP
rs1024281164 2061 dbSNP
rs1221291323 2071 dbSNP
rs1353579687 2074 dbSNP
rs972905066 2075 dbSNP
rs1245428021 2080 dbSNP
rs555460728 2081 dbSNP
rs1286401860 2086 dbSNP
rs1411382167 2088 dbSNP
rs1350886289 2089 dbSNP
rs1302719445 2090 dbSNP
rs549948757 2090 dbSNP
rs1299696775 2092 dbSNP
rs931603278 2093 dbSNP
rs1228232625 2094 dbSNP
rs546388343 2099 dbSNP
rs201695955 2102 dbSNP
rs1473085340 2104 dbSNP
rs386391451 2104 dbSNP
rs80225730 2104 dbSNP
rs34380358 2106 dbSNP
rs573683520 2106 dbSNP
rs1209860872 2110 dbSNP
rs1291367056 2110 dbSNP
rs895910786 2116 dbSNP
rs1274060520 2121 dbSNP
rs1468285411 2129 dbSNP
rs1230160659 2138 dbSNP
rs1329587724 2140 dbSNP
rs1003428667 2146 dbSNP
rs1282473358 2146 dbSNP
rs1013331028 2149 dbSNP
rs1333096965 2150 dbSNP
rs1192194282 2151 dbSNP
rs1031330180 2156 dbSNP
rs1381679993 2158 dbSNP
rs1386553516 2160 dbSNP
rs956691020 2165 dbSNP
rs902399395 2167 dbSNP
rs1191839402 2190 dbSNP
rs989703608 2194 dbSNP
rs1171237037 2196 dbSNP
rs1022157801 2199 dbSNP
rs1370776543 2200 dbSNP
rs1447572282 2202 dbSNP
rs953103980 2204 dbSNP
rs1459015872 2207 dbSNP
rs1199133504 2209 dbSNP
rs1464001158 2214 dbSNP
rs1245728513 2218 dbSNP
rs13430086 2219 dbSNP
rs1393329236 2220 dbSNP
rs1329819999 2222 dbSNP
rs953776039 2233 dbSNP
rs1217215008 2234 dbSNP
rs1346899297 2235 dbSNP
rs1275595947 2242 dbSNP
rs1227962633 2243 dbSNP
rs1363104620 2244 dbSNP
rs1322724952 2245 dbSNP
rs1459658880 2245 dbSNP
rs1322368380 2251 dbSNP
rs985200504 2254 dbSNP
rs1416450717 2261 dbSNP
rs774513213 2269 dbSNP
rs1381517426 2271 dbSNP
rs553988290 2272 dbSNP
rs1019341604 2275 dbSNP
rs911519721 2276 dbSNP
rs965127298 2276 dbSNP
rs972875570 2279 dbSNP
rs1207944554 2289 dbSNP
rs1464975693 2289 dbSNP
rs918777842 2292 dbSNP
rs1324707868 2298 dbSNP
rs1204701332 2299 dbSNP
rs1235245031 2300 dbSNP
rs1340359925 2302 dbSNP
rs1299896248 2303 dbSNP
rs1229177085 2304 dbSNP
rs1274006778 2304 dbSNP
rs944383066 2311 dbSNP
rs971789766 2313 dbSNP
rs1450886565 2314 dbSNP
rs776257125 2318 dbSNP
rs1212194142 2320 dbSNP
rs1368265197 2326 dbSNP
rs547664463 2326 dbSNP
rs1170128691 2329 dbSNP
rs1449470920 2331 dbSNP
rs1486400392 2339 dbSNP
rs927277055 2346 dbSNP
rs1180035513 2357 dbSNP
rs1448601167 2364 dbSNP
rs937307279 2365 dbSNP
rs1237810119 2366 dbSNP
rs1204245103 2374 dbSNP
rs1481965403 2376 dbSNP
rs572404402 2377 dbSNP
rs865980416 2378 dbSNP
rs1206149234 2380 dbSNP
rs1049679418 2386 dbSNP
rs1475884528 2388 dbSNP
rs894658366 2389 dbSNP
rs1230494148 2395 dbSNP
rs182110840 2399 dbSNP
rs1042600702 2402 dbSNP
rs1408346400 2403 dbSNP
rs1352719163 2406 dbSNP
rs902367736 2408 dbSNP
rs1001187743 2417 dbSNP
rs772380728 2433 dbSNP
rs1406998777 2434 dbSNP
rs889711058 2435 dbSNP
rs1045851525 2439 dbSNP
rs564102582 2448 dbSNP
rs1181365655 2449 dbSNP
rs1471452440 2453 dbSNP
rs1006522545 2458 dbSNP
rs1173899122 2458 dbSNP
rs999261744 2462 dbSNP
rs1245029610 2463 dbSNP
rs965097856 2472 dbSNP
rs1452814709 2473 dbSNP
rs1322437498 2475 dbSNP
rs1287002844 2478 dbSNP
rs187646612 2489 dbSNP
rs892364414 2494 dbSNP
rs1010837089 2496 dbSNP
rs111284072 2500 dbSNP
rs562194322 2503 dbSNP
rs1289445059 2509 dbSNP
rs1391583893 2510 dbSNP
rs375596352 2511 dbSNP
rs776763235 2514 dbSNP
rs759466543 2515 dbSNP
rs984701581 2515 dbSNP
rs529408081 2523 dbSNP
rs1309438414 2524 dbSNP
rs958963662 2524 dbSNP
rs992757477 2529 dbSNP
rs1159622497 2532 dbSNP
rs917276751 2532 dbSNP
rs985808572 2540 dbSNP
rs946116778 2541 dbSNP
rs1041844421 2544 dbSNP
rs1018640579 2545 dbSNP
rs1193143490 2549 dbSNP
rs965804228 2554 dbSNP
rs923761183 2557 dbSNP
rs139267363 2562 dbSNP
rs1054032137 2563 dbSNP
rs1171550800 2575 dbSNP
rs1466672577 2576 dbSNP
rs1269143459 2581 dbSNP
rs1486974637 2581 dbSNP
rs1310846993 2583 dbSNP
rs1298660535 2587 dbSNP
rs1210976194 2588 dbSNP
rs1220650176 2593 dbSNP
rs193237044 2594 dbSNP
rs889684518 2598 dbSNP
rs1256116591 2599 dbSNP
rs1319347316 2607 dbSNP
rs1484414219 2612 dbSNP
rs918958713 2614 dbSNP
rs1432779326 2615 dbSNP
rs930861099 2615 dbSNP
rs985077821 2616 dbSNP
rs1040722217 2633 dbSNP
rs149975112 2634 dbSNP
rs769823538 2640 dbSNP
rs566891847 2641 dbSNP
rs184000387 2642 dbSNP
rs948858569 2643 dbSNP
rs1156726536 2646 dbSNP
rs146584630 2648 dbSNP
rs1435338309 2655 dbSNP
rs537029395 2657 dbSNP
rs1249150370 2658 dbSNP
rs1200392499 2659 dbSNP
rs1482471185 2664 dbSNP
rs1312202716 2667 dbSNP
rs188627239 2668 dbSNP
rs764899132 2671 dbSNP
rs934791511 2672 dbSNP
rs1348210316 2674 dbSNP
rs1053503334 2677 dbSNP
rs1296443142 2677 dbSNP
rs893157328 2687 dbSNP
rs1300084547 2689 dbSNP
rs766815671 2692 dbSNP
rs1296137591 2696 dbSNP
rs191997961 2697 dbSNP
rs1223566596 2698 dbSNP
rs1043633938 2702 dbSNP
rs993063778 2703 dbSNP
rs889063992 2710 dbSNP
rs534461278 2721 dbSNP
rs1235587308 2731 dbSNP
rs1280272776 2733 dbSNP
rs967385135 2735 dbSNP
rs1383276351 2741 dbSNP
rs977834004 2746 dbSNP
rs1345073246 2748 dbSNP
rs1206053836 2750 dbSNP
rs1233074188 2752 dbSNP
rs1007342665 2753 dbSNP
rs1343664221 2754 dbSNP
rs1243938801 2755 dbSNP
rs926021412 2755 dbSNP
rs936102858 2757 dbSNP
rs774718967 2772 dbSNP
rs1175261143 2775 dbSNP
rs1053596827 2781 dbSNP
rs1415130625 2781 dbSNP
rs1306351469 2784 dbSNP
rs1431929135 2787 dbSNP
rs1018755572 2800 dbSNP
rs759777744 2803 dbSNP
rs1397260164 2814 dbSNP
rs1162788848 2818 dbSNP
rs911089301 2819 dbSNP
rs1254573366 2821 dbSNP
rs1370661870 2821 dbSNP
rs1472435490 2827 dbSNP
rs942577448 2834 dbSNP
rs966172384 2835 dbSNP
rs1250591111 2836 dbSNP
rs1439236235 2836 dbSNP
rs993273100 2839 dbSNP
rs1208679077 2840 dbSNP
rs1041025168 2848 dbSNP
rs1454559786 2854 dbSNP
rs900833056 2856 dbSNP
rs1323095103 2857 dbSNP
rs1172881077 2858 dbSNP
rs1233840115 2858 dbSNP
rs993808174 2858 dbSNP
rs555613428 2860 dbSNP
rs888172134 2865 dbSNP
rs1411871183 2875 dbSNP
rs1005739379 2877 dbSNP
rs1034461763 2878 dbSNP
rs17692648 2889 dbSNP
rs1172698883 2891 dbSNP
rs572317567 2891 dbSNP
rs1327148603 2907 dbSNP
rs1355333112 2907 dbSNP
rs1014450936 2919 dbSNP
rs1024477166 2927 dbSNP
rs1296684494 2929 dbSNP
rs1373589602 2931 dbSNP
rs1197734446 2933 dbSNP
rs1449320772 2936 dbSNP
rs967608068 2937 dbSNP
rs1254402889 2939 dbSNP
rs1214207708 2940 dbSNP
rs372746787 2951 dbSNP
rs539713927 2959 dbSNP
rs1266183272 2964 dbSNP
rs916164119 2980 dbSNP
rs1225195630 2981 dbSNP
rs1351175026 2982 dbSNP
rs1274436952 2983 dbSNP
rs1303269005 2983 dbSNP
rs1332875285 2984 dbSNP
rs1326740514 2985 dbSNP
rs1434994676 2986 dbSNP
rs1033440528 2997 dbSNP
rs970322337 3000 dbSNP
rs1323141897 3001 dbSNP
rs1401605847 3002 dbSNP
rs1401966549 3005 dbSNP
rs1171612361 3009 dbSNP
rs1369486192 3012 dbSNP
rs957465908 3018 dbSNP
rs1333113840 3019 dbSNP
rs1193654179 3024 dbSNP
rs543656199 3024 dbSNP
rs981594097 3025 dbSNP
rs1217893448 3027 dbSNP
rs755773884 3032 dbSNP
rs934720302 3033 dbSNP
rs1350396304 3034 dbSNP
rs1304459429 3036 dbSNP
rs1053213528 3039 dbSNP
rs1306416744 3040 dbSNP
rs1201933548 3041 dbSNP
rs914525030 3045 dbSNP
rs558405547 3047 dbSNP
rs184548635 3050 dbSNP
rs942546481 3055 dbSNP
rs976582882 3061 dbSNP
rs922488741 3064 dbSNP
rs1192827176 3069 dbSNP
rs1251047401 3070 dbSNP
rs1416535159 3070 dbSNP
rs1376828187 3071 dbSNP
rs1476390351 3072 dbSNP
rs1173915017 3073 dbSNP
rs1187044698 3073 dbSNP
rs1046712692 3074 dbSNP
rs1428488438 3074 dbSNP
rs200762261 3074 dbSNP
rs369508483 3074 dbSNP
rs888132978 3074 dbSNP
rs941117515 3077 dbSNP
rs1185067482 3078 dbSNP
rs1486531734 3079 dbSNP
rs1420248017 3080 dbSNP
rs1204729083 3081 dbSNP
rs151062078 3081 dbSNP
rs1275250247 3082 dbSNP
rs1356530701 3082 dbSNP
rs200393601 3082 dbSNP
rs397986183 3082 dbSNP
rs5835176 3082 dbSNP
rs1168747025 3083 dbSNP
rs1397014717 3086 dbSNP
rs796429720 3087 dbSNP
rs543788769 3088 dbSNP
rs555523525 3089 dbSNP
rs1392911173 3090 dbSNP
rs567870182 3091 dbSNP
rs574031189 3092 dbSNP
rs903406345 3093 dbSNP
rs1212324125 3095 dbSNP
rs1294721342 3097 dbSNP
rs1321232521 3098 dbSNP
rs1335143440 3098 dbSNP
rs1235731229 3099 dbSNP
rs1335873868 3099 dbSNP
rs201354372 3099 dbSNP
rs1288191257 3100 dbSNP
rs1227385170 3103 dbSNP
rs1370650705 3105 dbSNP
rs1299530541 3108 dbSNP
rs1212835163 3109 dbSNP
rs999543127 3112 dbSNP
rs1348816157 3118 dbSNP
rs1323781419 3122 dbSNP
rs1032999309 3126 dbSNP
rs957642576 3128 dbSNP
rs1158075403 3138 dbSNP
rs1471492418 3143 dbSNP
rs1448536536 3145 dbSNP
rs1178021495 3146 dbSNP
rs889011538 3152 dbSNP
rs1488186333 3157 dbSNP
rs1216352947 3163 dbSNP
rs1245098974 3183 dbSNP
rs1007457187 3187 dbSNP
rs1469352872 3188 dbSNP
rs1241480884 3190 dbSNP
rs1226871750 3194 dbSNP
rs1475110189 3195 dbSNP
rs1319137035 3204 dbSNP
rs1191653857 3209 dbSNP
rs1040154147 3213 dbSNP
rs1366246780 3218 dbSNP
rs1300707025 3225 dbSNP
rs1442989728 3225 dbSNP
rs986208536 3227 dbSNP
rs1319849056 3229 dbSNP
rs1451299091 3237 dbSNP
rs1346800274 3243 dbSNP
rs1160064954 3244 dbSNP
rs1432889862 3244 dbSNP
rs1475694358 3244 dbSNP
rs1164482534 3249 dbSNP
rs1423138532 3263 dbSNP
rs901695153 3269 dbSNP
rs993613258 3277 dbSNP
rs541546889 3278 dbSNP
rs1487040009 3280 dbSNP
rs1402828259 3290 dbSNP
rs1311305572 3303 dbSNP
rs1026070627 3304 dbSNP
rs1277759436 3305 dbSNP
rs763759235 3306 dbSNP
rs1005873677 3315 dbSNP
rs1345160428 3315 dbSNP
rs59216363 3322 dbSNP
rs1022667270 3327 dbSNP
rs114710451 3332 dbSNP
rs188578492 3341 dbSNP
rs1363814702 3344 dbSNP
rs563584038 3345 dbSNP
rs983143686 3346 dbSNP
rs956242785 3354 dbSNP
rs909541323 3362 dbSNP
rs1055389369 3385 dbSNP
rs1389682632 3386 dbSNP
rs1232241706 3388 dbSNP
rs1291084686 3389 dbSNP
rs989420776 3399 dbSNP
rs1181577459 3401 dbSNP
rs1277693180 3411 dbSNP
rs1352529686 3411 dbSNP
rs1212641152 3414 dbSNP
rs1347935433 3417 dbSNP
rs1273372289 3423 dbSNP
rs537201850 3424 dbSNP
rs914658204 3424 dbSNP
rs1224173262 3431 dbSNP
rs949818127 3443 dbSNP
rs1415666743 3448 dbSNP
rs1370020916 3449 dbSNP
rs1166283527 3457 dbSNP
rs1463598392 3459 dbSNP
rs1047081 3461 dbSNP
rs1374102170 3468 dbSNP
rs1164724108 3472 dbSNP
rs530754435 3487 dbSNP
rs947480441 3489 dbSNP
rs1445265639 3491 dbSNP
rs775524462 3491 dbSNP
rs1485828822 3506 dbSNP
rs985411294 3508 dbSNP
rs1193502988 3522 dbSNP
rs1481345991 3524 dbSNP
rs1251767795 3525 dbSNP
rs1244034954 3529 dbSNP
rs1045863608 3538 dbSNP
rs1294969808 3540 dbSNP
rs548962924 3545 dbSNP
rs911232518 3547 dbSNP
rs191842811 3548 dbSNP
rs1327103214 3549 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000241416.7 | 3UTR | CUCUAACUUAUACUCUUUACCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer -0.373 6.6e-5 -0.367 8.6e-5 100 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.681 4.7e-4 0.820 4.8e-6 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.609 1.0e-3 -0.480 1.0e-2 23 Click to see details
GSE19783 ER- ER- breast cancer -0.302 3.4e-3 -0.294 4.3e-3 79 Click to see details
GSE21032 Prostate cancer 0.285 4.5e-3 0.205 3.2e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.439 2.6e-2 -0.453 2.2e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.346 4.5e-2 0.163 2.2e-1 25 Click to see details
GSE17306 Multiple myeloma 0.195 9.0e-2 0.088 2.7e-1 49 Click to see details
GSE28260 Renal cortex and medulla -0.387 9.6e-2 -0.341 1.3e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.398 1.0e-1 0.168 3.0e-1 12 Click to see details
GSE27834 Pluripotent stem cells 0.338 1.0e-1 0.347 9.4e-2 16 Click to see details
GSE17498 Multiple myeloma 0.191 1.2e-1 0.229 7.8e-2 40 Click to see details
GSE32688 Pancreatic cancer 0.211 1.2e-1 0.089 3.1e-1 32 Click to see details
GSE14794 Lymphoblastoid cells -0.122 1.3e-1 -0.202 2.8e-2 90 Click to see details
GSE28544 Breast cancer -0.17 2.1e-1 0.100 3.2e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.144 2.5e-1 -0.178 2.0e-1 24 Click to see details
GSE38226 Liver fibrosis 0.06 4.0e-1 0.094 3.4e-1 21 Click to see details
GSE21687 Ependynoma primary tumors 0.029 4.1e-1 0.088 2.4e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.032 4.4e-1 -0.106 3.1e-1 25 Click to see details
GSE21849 B cell lymphoma 0.025 4.5e-1 0.186 1.7e-1 29 Click to see details
GSE21849 B cell lymphoma 0.025 4.5e-1 0.186 1.7e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC 0.564 0 0.563 0 38 Click to see details
BRCA -0.266 0.01 -0.316 0 84 Click to see details
ESCA -0.659 0.01 -0.709 0.01 11 Click to see details
KIRP -0.363 0.02 -0.366 0.02 32 Click to see details
KICH -0.378 0.03 -0.452 0.01 25 Click to see details
HNSC -0.281 0.04 -0.198 0.1 42 Click to see details
LUAD -0.48 0.06 -0.448 0.07 12 Click to see details
PCPG 0.974 0.07 1.000 0.5 3 Click to see details
THCA -0.113 0.2 -0.134 0.16 59 Click to see details
KIRC 0.083 0.25 0.151 0.11 68 Click to see details
STAD 0.117 0.26 0.069 0.35 32 Click to see details
PRAD -0.071 0.31 -0.126 0.19 50 Click to see details
CHOL 0.168 0.33 0.450 0.11 9 Click to see details
LIHC 0.062 0.34 0.080 0.29 49 Click to see details
UCEC 0.061 0.4 -0.096 0.35 19 Click to see details
COAD -0.088 0.42 -0.310 0.23 8 Click to see details
CESC 0.188 0.44 0.500 0.33 3 Click to see details
PAAD -0.053 0.47 0.800 0.1 4 Click to see details
BLCA 0.014 0.48 0.034 0.45 18 Click to see details
BLCA 0.014 0.48 0.034 0.45 18 Click to see details
BLCA 0.014 0.48 0.034 0.45 18 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954