miRTarBase - #MIRT568025 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CMTM4   
Synonyms CKLFSF4
Description CKLF like MARVEL transmembrane domain containing 4
Transcript NM_181521   
Other Transcripts NM_178818   
Expression
Putative miRNA Targets on CMTM4
3'UTR of CMTM4
(miRNA target sites are highlighted)
>CMTM4|NM_181521|3'UTR
   1 GGACCTGCCTGGATCCTCCTCCCTCCCGTCCTCGTGCCTGTCTCTCAGTCAAGTTTTCTTTCCCTTGTCCTGTCAGATTT
  81 CCATGTGATTCAGTTGAATTTTGTCCTCTTTGGTAAAAGTTCATTTTGGGAAAGGGTTTCCCGAGTGGCCCAGTGGGCGG
 161 GTCCGCGGTGGAGTTGGGAGGCCCACGTTCCTCAGCGTTTGGGGCTGTGGAGCAGCCGGCGTCACTGCCCAGGTCCACTT
 241 GAGGTCTTACCTGCCCTGAAGCACAGGCTTCCTTTGACTCTGAGCCACCTTGTCGTGTGTATTTGTAACAAGACTTTGGA
 321 TTAAATGGGGCTGCTAAGAGGGGGGAAATATGAAGGAATGAAGGGACAGCATTGGAACGGTCAGTCGGCAGTGGTTCTCA
 401 GGCAGCCTTAGGCACCACCTGCTCCAAGTCAGTGTTGAGTCTGCGTGCTGGGATCCAGCCCACTCCTCATCTTCCATGCC
 481 AGGGCCCCCAGGCAGCCAGCACCAGCCCAAAGGCCACAGGGCTGGGGAAAGCTGATGTCCTGTTAGGATGGCTCCCAGGG
 561 ACCTCTGACTCAAGGAAGGGTGACCTTTTGTTTCCTACTCTGCTGAGAAATCACTTGATTCTTCCTCAAATGAATCACCT
 641 TCCTGAACCCCAGATTCTTCTCCAGGAATATGGGGGCCATCTTGTTATGGGGACTATCTTGTTTTCCAGTTTCCTGCCTA
 721 CCCTAAATACTTTGAGGCTGAATTGCAGATTTTCAGTCATTTTACCTTCTCAGGTAAAAGCCATGAAAGAAACAAGCCTA
 801 CTCCACCAGCCAAAGCACTTGCCCATTTGCTGGCTTCATGAACCGCAGGTGGGAGGTGTTTGTGTTAAAAAACAGCATGC
 881 ACACGCGTGCGCGCACACATGCACACACACACCCCTCTATTTTAGGGATGTGTGCTAATTTTCTAAATGCCTGCAAAGAG
 961 TTCTAAAATGATTCTGAGCAGATTCGTCTAGGATTTGAAAATACTTGAATTTGCACCAGAACACACCCTTCCACCCATGT
1041 TTCAGAAGGCACTAATTGTCGCTTTGGGCGCCTCAGTGTCATAACTGTAGACATCATTCTTGGGAGTTGTTGGGGGGAAA
1121 AATCCTAGCTACTTAAGGTTTCTGATTGATTCTTGATAAAGTGAAGATTATTGTGTGTGGTGAATGAGTTCAGTGAGTCC
1201 CCATGATGCAGTAGTTTTTTTAAAAAATTAGAGAGTAATTATATCTTTTATGGAAAAAAGTTGTTTTAGTTTGTCAGGTT
1281 TTCCCTCTTTGAACTGTTTTTAATGTTTACAAACCTCACTTTAGCTCTAACATTTTGTGTTTAGCCCTCACCAAAAAGCA
1361 CTTACTGTGGCAGGAAGATTTTGCAGTAACATGGAGAAATCCCCAAGATCAAGTGCTGACAAATGTTGACAGCTTTAGCA
1441 GCGTACTGTGTAATAAATAACTCCGAGGGGGCGGCGGGGGGTCTGTGCAAGAAAGCGTCACCTTATGGACATGTGGCGTC
1521 TCATTCCCCAGAAAAGGACAGCATCTGAGCTCACAGTGTTGATCAGGCAACACTGCTGGGCTGGGGGTCGGAGTTGGGGT
1601 TAGCTTCCTGCACCAACACCTTCAGTACGATCTGAGTTGGGAGCAGTGTCCCAGGCTATGTGGCTGAGCACCACGTCTGC
1681 CTCAGGGGCTGACCCTGCTAGCCTGTTAACAACTCGTCTCCCCTCTGCTCCCACAGAGAGGGCAGCCAGGCCAGCTCACA
1761 GCTGGGTGTGCTGCCTGTCAGGTCTGTTGAGTGTGTTTGCAAAGTCAAAATTGGGCTTATCTCTCTTTGAGAGTTCCTTT
1841 TAAAATAGGGCCACAAAGGCTCAGCCTTGCATTAAATGGGGCCCACTTGGAAGGACCATCCTGAGCTTTATCAGAAATCT
1921 CCTGCTGGGAATCATGTTACTTGGCCCCCAAAAAAGGCCATCTTTGAAGTGAGATTGAAAACAAGAACACCATTCAGGTG
2001 GGCTTGTTGCCCAAGTTTTCCCAGCTCACTTCAGTAAAACCACTTGATCATCTGGTGAAAGAGGGGGGCAGGTGGTTGGC
2081 CTCCTGAGGATATGTTGTCAGCTGCAAGAAATAGTTCTGAAGTCACTGAAACTAAATGCAGATGAATGACCAAAAAGGAT
2161 GACACGCCAGAGAGTGACTTAGGAGTTAATTTGCATCTTCGTGATAGACTCTTCAGAATTATTTATGTCCCTGTAACTAT
2241 TTAATATCCTTTGTGCCGTGAGGCTCCTCGGTGGTTTTGTAAATGTTCTCCTTGTATTTAATTAACTCCCACTAGAACCG
2321 GAAGTGGTGCTATGGACGCTTTCTAGTTGATGTAATGTGTGGTTGCACATGTCATCATGTATAGACCACGTGGTGACGAA
2401 AGTTCTGGAGGGAATAGGGTTATCCAAGGTGAATATGAAGACGCCTATATTTTTCTTATATTGCCTCTATATGCAAACAG
2481 AAGACAATCGATATCTGGGGGCCTTAAAATGACCTCTTGGCAAATTGAAGGAAGCGTTTTTGCGTTTAATAGTTTCAATA
2561 GGGACCAATATCAGTTTGGTTTGGGGCATTTGAAGGCTGAGCGACCTTAGTTTTTCTCAGTGTTCTGGTGGGACGATATT
2641 GGTTTTCACATTTAAAGCAAAACTTGAAGAAACTGCAGTTGCTGTGTGCATTTGGGTTTTTTCCTGGACACTGTACAGCT
2721 GAAACCCTCAAGCATTTGGTGGAACCTCTGGTGGTTTTAGATGGATGCAAACACTGATGTCCTCAGAGAAAGTTTATTTT
2801 GGCACTGATTGGGTGGATTTGGTATTTTTTCCCTCTGATTCTCTTTGATATCCTTCTTTCACACTGCTGAAGGCATGGGA
2881 GGGAAATATGTTTTCCCTGCCTTAAAGAGGGATTACAGTCATGAAAGGCTGGAGATACTTGTTGGCCCCACATAAAGCTG
2961 GGAAGAACAGATGCAGTTTCAGATTAAAATCTCGTCAGAGAAGTTTGATTTGAAGTAAACAGCCATCCGAGGGAGGTGAC
3041 TTTTGTCTACAGAAAAAGCAAGAATGTGGCAGCCTGCACAGCCCCAATACACATCTTCCTTGGCAATGTGAGCTGAAGCC
3121 AGCATGGGCAAGTCCGGCCCAGCTCTGAGCGCTTGGCCCTGGGAAGCCAGCGGCACCCCCAGCCCTTCGGGCCCTGTTAC
3201 TGTCCCCTGGCAGGAAGGCTCACGCCTGTGGGCAGCCAGGGAATGTGTCTGACCTCCACCCTATGTCGGGTGCTTCTGGG
3281 ACAGCTTCGTGACTCAGTTGAAAACATTCTGACTCTCTTCAAGTTTGCAGTTACATCTGTGGTTCTTGGAAGCTGTCCTA
3361 GTGAGTCAGCCTTGGGTTAAGCCTGAGGAGACCAAGCTCCAACACCTTTGTGCACTCATGTACGTGAATTCTTGCTTGCA
3441 GTGAATGAGACCTGAACAACCCTAGTGGGTGCCATGTCCTGCGTGTGGCCCAGGCGTACCTTTTCTTGTAGATTCACATG
3521 AGAAACCCGTCACCTATCCATGTGCTCTGAGAGGTGGACTGAGGTCTAATCCCTTTCTGTGCCAGATTTTCTGTGGGTTG
3601 GTCTTAGCACCTAGGAGATGAATAGAGCATGGAGACACCTGAACAATTTAGTGATTCTGCAAGGCAGTGATGATTTAAGG
3681 GTTCCTATTGTCTCATCTGTGTTCAAAACAAAACAGTCATGAAGTCTTTGTGCCACTGCCTGACTGTCATCTTCTCCAGA
3761 TCTTGTTTACAGAGTAATAATGACGTTAAACAGGTATCAGAAAGGGGAAAAAGTTTCTAGGCCAAGAGCTGCTGGTGGAT
3841 TCTCTTGAGCAGAATAACAAGTTGCTTCCTGCTCCAGGGACTGCCATTAGCTTGTGAAGTCTCTAGGTGCCTTGTTATTT
3921 CCTAGTGAAGTTGCAGAATCCAGGGTTTTTTCCAGGTTTGTCTTATTTTATCAGCACCCACGTCCAGGCCCAACAGCTTG
4001 GTAGGCTGGTGAGGTCCACACACGGCCAGGTCTGGGAGATAAGGGAGGAAGCAGTGGCCTGGAACACCCCACCTGTCTGC
4081 TATCAGCACTAGACAGCTCAGGCTGTCTTGGAAACGTGTACTTTGTTAACTGCCTTCCTGTCCTCTTGTCTTTGAAAGCT
4161 GTCTCGCGTTCCACAGTCAGCTTGAGGGCAAGAGTGGGATGCTGGGGACAGGTCTTTCCCGTCCTGTGGGTGAGCTCCTG
4241 GCATCTGGCTCAGGAACATGTGGGTCCAGCAGGTGACTCTGAAGCTGGCTTGGCTGCCATCTCAGACAGGACGCAGGCCT
4321 GACACCCTCAGCTTTTAGCTTTGTAAACTTCCCTGGCGCTTTGTAGAATCTTGTGTTTCTTCTCTTCTCAGCAGATATCA
4401 TTCAAGTCACAAGAACTGTCTGGTTGAGAAAGTAATTTAAAATATTTGACCTTTTATGTTTCTTTTATTTAGAAACTGTG
4481 AGAGAAAATACCGTCAATATCTGTTAGGTCTAGAAAAATTTTCTTCCGAAAGTGAATGTTCTGTTTAATTCTTCTTCATG
4561 CAAGTGAGTGGCATTTTGTACACTCTTTAGCTTGAAGCGGAGTGGGTCCTATTGTATTTTCCCTTCTTTTGTCTGGAATA
4641 TATTCTTTTTCCATTTGGATACAGTTTTTCAACCTTTGGGATTTTTTTTTCCTTTCTAGTTTTTCCTACTCCACAAACGT
4721 AACAGTAAGGAAAAAATCACCCACAAACCTGCTGAGTTTGAATCACTGGCAACTTGCCTAGAAAAGTTCAGATGATGGGT
4801 CCTTGAACTGTGTATCTATTTCATAGGGTAAGTTTGTTGTCTATGTTTGTTTTTTTATGCTGAGGCTTTAATTCAGGTGA
4881 CTTGCTATCTAGACACCTGGGGTGGCGTGTTTTCTTTGGGATGCATAATACACAAAGGCCAGGGAGCCTTTGGCTTGGAC
4961 CCCCAGGGAGCTATTGAAACTTTTAAAGTTTGAGTTTAGGAGTAAGAACATATCTCAGACCACCTTAGTCAGCTTTGCTG
5041 ATGGGATTTAGGGCCAGGTCAGAGTTTCTTTTCATAACTGCCTGAAAAGAGAGATGGTGTGAAACAAGATTCTGATAATG
5121 GTTTGTGTGAGATTTGATCATAGTCTAAAACTATCACGTCTGAGTTGCCTTAGGATGACAGTGCTGACACCCAGTAGGAA
5201 GTATCCCATTTTTATCAGGAAAGTCAGTCACGCGTAGGGATGGTGAGGAGACGCGTAGGGATGGTGAGGAGGGGAGAGGA
5281 GGGAGACCTGCTGGTGCCCTTGCACCAGGGTGAGGCCTGACTCACGCTGCTTCCCCCCACAGGCCCTGCTTTGCTTGCCT
5361 GCTTTTTCCAGAATCGATTTTGCAAGCTTCAAGATTCTGTTCCCCTCTTCGCAGAAGTGAGGAAGGCAAATACTCAGGGT
5441 TTGAAGGGAGACCTGGCCGGCCTGAGGGCTGGCAGATGTGAGGGCAGGACACCTGGGATGGACTCGTAGGCTGACCCAGG
5521 CCCAAAGGGGGCTGCCTGTTCCCAACTCTTTCACTCTGTAACCCATTTTAAAATGAGTTTTTGAATCTTGCCTCAAATTG
5601 ACCTACTTGGATAAAATCAGTGCTTTTCCTAACTTGATTTTGTTTGACGTGGTTCCCTCTAAGAGAATGGTAGGAATTGA
5681 AACTATTTGTATATGTTGAAATTTGTAGGGGTTCAGGAACCCATGGCAGAAACACTAAACTATTTATTTACAAGTATGAC
5761 TATTTTTTTTTCAAAGTAGGCAATTCTTTGTATATTTTAAGGCAAATAATCACTTCACCTCTGGTGCCTTCCATGCGTCG
5841 CATAAGCACTCTTGTCAATCATGGAATTGGAAAAAAAGATGTACATTTAGTTAAACAAGATAACACTATTTTTGTAGCAT
5921 GATTTTAGATTGTGTCCTTTTAATATTGTTTTCAACAATGGTAGTTTTGAGGTTTTGGCCATTTTCTCTTTACACTTCGT
6001 ATGTATTTTAAAGAAGAAAAAAAACAAAAAAAATTCCCTGGCTATTCCTCTTTCCTCTCTGCTGCTGCTTCTCCTGCATC
6081 TTGTTCCTGCTTATTTAAATAGTCTGAGAGTAAGAGTATATTTCTGTGAAATAATTATAAGTCAGTATAATTGCATTTGG
6161 CATTTTTTAACCACTTGCTCAGTTTGGAGCCACTGCTCACCTCAAACAGTACAAAGAAAGTGGTTCCATATTTTACAAAC
6241 AGAAGAGTAGCATCAGAGCCCTGACCTCCTGTCTTTGGGTGTAAAATGGTGAGAGGCCGGTGTCCGGCTCCTTCCCCTGT
6321 GGTTTGGGCTGGTGAACTGAGCCCAAGTGTATTCTCTGGCCTGGGCCCCTTCCAGAATCAGTGCGAGCGTCCTGCAGAGG
6401 CATGGCCTTCCTGCCACTGCAGAGTGGGAAGCTTCCTGGGGGACCTCAGCCAGCTCCGGGGCTCTCATCTTCCACTCGGA
6481 TCTCAGATTGGTTCGTTGTGGATGCTCTGGCTAGGCTCGGCGGCCTTTTCCAGGCTTCAGGCCTGAACAAAACAGGCTGT
6561 TTGCTGTGAGGAGCTAGATGACACCAAGACACAGACACGTACTCTTCACCGGCTCCTTTTGCTTCTCCTTCCTGCAGGAC
6641 GTGAGTTATGTCTGGTCCCAAAACCCTTGAGTAAACTAGCTGAGCCATTGCAAATGAAGGTACAGATGGATTGAAACATA
6721 AAATTGTAGCTTTTGGTGTCCTTCTGAAGGGTCAGAATATGTAATTATTTGATAACCAAGGAAGTCAAGTCAGATGGCTA
6801 AGTAGTAACTTTCCAATATGATTTCTCCGTGGTACTTCACCTGGTGGCACTTTTGGGGGGCAATGTTAACAACTATCACA
6881 TTTTACTCATCAAGTCTCTTTCATTTCGGCAGTTTAAAGACACAACTGTGGGCTTTCTGAGGCGATGCCCGTTGGGCAAA
6961 CTTAGGTTTATGTGTTTGGTTTTTCAGCTGACGTGGAAGCCCTGGGTGGGCGTCCCCTGGCTGGCCTGGCTTTTGGGTTC
7041 AAGTCTGTATGTATGGAGTGGGTTGGGGCCCCAAAGCTTTGCTGCTATTGATTTGTCCCCGACAGCAGGCAAAGCCTCAC
7121 ATTGCCCTCAATTTTCCCCCTTTCATTTGAAGGACCAGTTTTTCATGGTACTTGTCTTGATCTTTTTCATAGTGTTCAAA
7201 TCTGTATTTTTGTATGTAGAGGGAAATAATTTTCTCAACACTAATCGTTAATAACTATTGTATTAAATTGTCATGAAGGA
7281 ACTTGTTTAATAAATGGACGTGTAAGGAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |||| | ||   ||||||| 
Target 5' ccCAAAGC-TT---TGCTGCTa 3'
7070 - 7087 152.00 -11.70
2
miRNA  3' guguuuGGUAAUAC-ACGACGAu 5'
                ||  | || ||||||| 
Target 5' ctctttCCTCTCTGCTGCTGCTt 3'
6048 - 6070 148.00 -11.40
3
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            || | |   :||||||||  
Target 5' ctCACAGCTGGGTGTGCTGCct 3'
1755 - 1776 136.00 -17.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31564787 9 COSMIC
COSN30530424 37 COSMIC
COSN15721472 158 COSMIC
COSN28767232 184 COSMIC
COSN31521563 194 COSMIC
COSN31567494 347 COSMIC
COSN7268443 452 COSMIC
COSN28692479 487 COSMIC
COSN23698366 855 COSMIC
COSN27747472 893 COSMIC
COSN22512192 1221 COSMIC
COSN9440445 2032 COSMIC
COSN9440444 2132 COSMIC
COSN2516218 2508 COSMIC
COSN26146115 3729 COSMIC
COSN6092164 4382 COSMIC
COSN30261200 4462 COSMIC
COSN28710349 4594 COSMIC
COSN24378323 4645 COSMIC
COSN20071924 4661 COSMIC
COSM5499266 4682 COSMIC
COSM9012161 4699 COSMIC
COSM4910400 4708 COSMIC
COSM1629949 4711 COSMIC
COSM8665214 4718 COSMIC
COSM8302831 4719 COSMIC
COSM9274429 4730 COSMIC
COSM972194 4733 COSMIC
COSM5514568 4736 COSMIC
COSM6464436 4737 COSMIC
COSM8727460 4741 COSMIC
COSM3387524 4760 COSMIC
COSM9161332 4778 COSMIC
COSN30479410 4798 COSMIC
COSN30148518 4811 COSMIC
COSN30513024 4826 COSMIC
COSN30125353 4849 COSMIC
COSN30136946 4897 COSMIC
COSN30126515 4906 COSMIC
COSN20867230 5219 COSMIC
COSN29561268 5762 COSMIC
COSN20093139 5998 COSMIC
COSN14598896 6025 COSMIC
COSN20093138 6445 COSMIC
COSN21065327 6482 COSMIC
COSN7268441 6567 COSMIC
COSN25727069 6975 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779685972 3 dbSNP
rs1439692485 11 dbSNP
rs941203247 15 dbSNP
rs909666157 17 dbSNP
rs769906527 18 dbSNP
rs1198776181 19 dbSNP
rs1439062734 22 dbSNP
rs1038115398 23 dbSNP
rs377585078 25 dbSNP
rs1199526705 26 dbSNP
rs781150030 27 dbSNP
rs184135491 28 dbSNP
rs951366460 31 dbSNP
rs1237655499 33 dbSNP
rs1376138854 34 dbSNP
rs1272584057 42 dbSNP
rs1309915450 44 dbSNP
rs201974553 46 dbSNP
rs1468968436 47 dbSNP
rs922656806 52 dbSNP
rs1231385409 53 dbSNP
rs557718819 58 dbSNP
rs939283755 62 dbSNP
rs1200052511 72 dbSNP
rs771573962 78 dbSNP
rs964012565 94 dbSNP
rs1162749872 106 dbSNP
rs77695496 108 dbSNP
rs978130349 109 dbSNP
rs567932622 118 dbSNP
rs554608221 142 dbSNP
rs192304807 143 dbSNP
rs1452342605 146 dbSNP
rs1378014604 155 dbSNP
rs974864487 158 dbSNP
rs964783056 159 dbSNP
rs1230099247 164 dbSNP
rs781116142 165 dbSNP
rs375482331 166 dbSNP
rs757031523 167 dbSNP
rs1437440503 173 dbSNP
rs1169698995 174 dbSNP
rs1009441521 186 dbSNP
rs770191111 187 dbSNP
rs1233207459 194 dbSNP
rs1026956325 207 dbSNP
rs1483918784 214 dbSNP
rs995039506 217 dbSNP
rs1013887002 218 dbSNP
rs746754229 220 dbSNP
rs894110673 221 dbSNP
rs1037990873 229 dbSNP
rs776324513 233 dbSNP
rs565662861 237 dbSNP
rs1170714781 240 dbSNP
rs888319603 241 dbSNP
rs1180057555 246 dbSNP
rs1479384700 248 dbSNP
rs1312725070 257 dbSNP
rs1047323048 258 dbSNP
rs1056316511 263 dbSNP
rs939152336 264 dbSNP
rs1338863958 275 dbSNP
rs748503909 276 dbSNP
rs929932287 284 dbSNP
rs1453883686 294 dbSNP
rs923783440 295 dbSNP
rs189569011 307 dbSNP
rs922527552 309 dbSNP
rs1485927723 317 dbSNP
rs1189569130 332 dbSNP
rs946614809 334 dbSNP
rs1239794820 338 dbSNP
rs778014748 342 dbSNP
rs942680550 347 dbSNP
rs1432524436 348 dbSNP
rs1173380176 349 dbSNP
rs1376468867 351 dbSNP
rs974709041 359 dbSNP
rs964794047 362 dbSNP
rs1372838997 364 dbSNP
rs1294248113 372 dbSNP
rs1438690500 379 dbSNP
rs1351611799 381 dbSNP
rs1369017016 381 dbSNP
rs1233869561 382 dbSNP
rs1279287151 385 dbSNP
rs147815956 386 dbSNP
rs1345454374 409 dbSNP
rs1202051729 416 dbSNP
rs1423778897 418 dbSNP
rs987671756 419 dbSNP
rs1282049261 423 dbSNP
rs758584928 425 dbSNP
rs1026466589 427 dbSNP
rs537893423 430 dbSNP
rs1360872681 432 dbSNP
rs1188609550 433 dbSNP
rs995081939 437 dbSNP
rs963561368 444 dbSNP
rs1016556116 445 dbSNP
rs1011842038 449 dbSNP
rs1396003801 457 dbSNP
rs1479218240 465 dbSNP
rs1191325091 469 dbSNP
rs780935563 469 dbSNP
rs375035713 476 dbSNP
rs569786937 481 dbSNP
rs1384871963 485 dbSNP
rs958352227 485 dbSNP
rs35659043 487 dbSNP
rs1056644531 509 dbSNP
rs1440358053 525 dbSNP
rs978685580 530 dbSNP
rs185493747 547 dbSNP
rs1003276264 548 dbSNP
rs1267398154 548 dbSNP
rs970893503 554 dbSNP
rs1349843336 556 dbSNP
rs902383039 557 dbSNP
rs1042237874 558 dbSNP
rs946624716 560 dbSNP
rs1025653904 561 dbSNP
rs1222336532 562 dbSNP
rs1012411405 564 dbSNP
rs894182692 567 dbSNP
rs55680910 571 dbSNP
rs1453043981 580 dbSNP
rs1033969019 582 dbSNP
rs1363603910 594 dbSNP
rs549474733 595 dbSNP
rs1162003255 597 dbSNP
rs1415691528 602 dbSNP
rs1460973052 603 dbSNP
rs1005287907 607 dbSNP
rs915123586 613 dbSNP
rs1039073463 623 dbSNP
rs1389939846 630 dbSNP
rs1326552555 632 dbSNP
rs943337461 648 dbSNP
rs1046785788 652 dbSNP
rs911885632 653 dbSNP
rs987985917 654 dbSNP
rs1332663742 657 dbSNP
rs900966107 666 dbSNP
rs1221018358 673 dbSNP
rs560800229 679 dbSNP
rs1489227316 684 dbSNP
rs1193743581 701 dbSNP
rs1365503413 703 dbSNP
rs1041023556 721 dbSNP
rs1281316727 735 dbSNP
rs1404216200 764 dbSNP
rs1184857192 783 dbSNP
rs1256017531 789 dbSNP
rs1475190312 793 dbSNP
rs1165543585 804 dbSNP
rs919425272 816 dbSNP
rs1361052853 822 dbSNP
rs1370293101 825 dbSNP
rs973500408 829 dbSNP
rs541034354 833 dbSNP
rs755496580 844 dbSNP
rs911256684 845 dbSNP
rs989465765 846 dbSNP
rs1299858321 847 dbSNP
rs1309696477 848 dbSNP
rs1353455722 849 dbSNP
rs1451338374 850 dbSNP
rs1414148816 854 dbSNP
rs963615174 856 dbSNP
rs113684889 858 dbSNP
rs57282823 858 dbSNP
rs1023143005 860 dbSNP
rs202045012 860 dbSNP
rs527724147 861 dbSNP
rs959321268 862 dbSNP
rs1426539179 873 dbSNP
rs565279189 879 dbSNP
rs1034689079 884 dbSNP
rs193218713 885 dbSNP
rs373286356 886 dbSNP
rs144525087 887 dbSNP
rs566639717 890 dbSNP
rs543197993 891 dbSNP
rs1039000608 892 dbSNP
rs1256822716 893 dbSNP
rs1431910179 895 dbSNP
rs1170232271 899 dbSNP
rs1034000242 900 dbSNP
rs1465421062 902 dbSNP
rs574396159 903 dbSNP
rs943284500 907 dbSNP
rs1005193221 910 dbSNP
rs1380021122 912 dbSNP
rs374596353 913 dbSNP
rs952384205 913 dbSNP
rs911922860 919 dbSNP
rs369906875 933 dbSNP
rs1025819204 936 dbSNP
rs1278583437 937 dbSNP
rs929382566 947 dbSNP
rs1211371718 949 dbSNP
rs1380327761 956 dbSNP
rs1248781957 958 dbSNP
rs1360954349 958 dbSNP
rs1485218525 958 dbSNP
rs901036472 963 dbSNP
rs934999287 969 dbSNP
rs1006838153 976 dbSNP
rs1432369181 985 dbSNP
rs534496519 986 dbSNP
rs973554054 1004 dbSNP
rs1449829945 1005 dbSNP
rs1403417522 1008 dbSNP
rs889728679 1023 dbSNP
rs1053676444 1024 dbSNP
rs1388771297 1025 dbSNP
rs1436744500 1033 dbSNP
rs1300824773 1034 dbSNP
rs1175165373 1037 dbSNP
rs1220175930 1038 dbSNP
rs1303919773 1044 dbSNP
rs1315639042 1048 dbSNP
rs1238992430 1052 dbSNP
rs963540444 1055 dbSNP
rs916060036 1060 dbSNP
rs923924712 1065 dbSNP
rs1465688282 1069 dbSNP
rs1042904136 1070 dbSNP
rs1488951499 1072 dbSNP
rs992189562 1077 dbSNP
rs1191531783 1085 dbSNP
rs960311500 1088 dbSNP
rs1417193404 1090 dbSNP
rs1158342950 1093 dbSNP
rs758569738 1094 dbSNP
rs1411983365 1098 dbSNP
rs565571149 1104 dbSNP
rs981762627 1106 dbSNP
rs1348909835 1107 dbSNP
rs558510861 1114 dbSNP
rs1371675189 1118 dbSNP
rs55696119 1118 dbSNP
rs764454671 1118 dbSNP
rs1228251623 1119 dbSNP
rs1020689229 1120 dbSNP
rs1331924852 1121 dbSNP
rs1010649209 1122 dbSNP
rs750649767 1123 dbSNP
rs909480294 1123 dbSNP
rs985022428 1130 dbSNP
rs1479543991 1156 dbSNP
rs115755678 1158 dbSNP
rs1017448842 1159 dbSNP
rs1252446801 1160 dbSNP
rs546852405 1161 dbSNP
rs187975251 1166 dbSNP
rs1412477943 1172 dbSNP
rs994352471 1174 dbSNP
rs1166485264 1180 dbSNP
rs1352456580 1182 dbSNP
rs965109073 1184 dbSNP
rs1019353151 1188 dbSNP
rs1352843723 1193 dbSNP
rs1413495724 1208 dbSNP
rs1283632168 1217 dbSNP
rs182858938 1221 dbSNP
rs1052215474 1222 dbSNP
rs889591390 1222 dbSNP
rs1341805086 1223 dbSNP
rs355946 1235 dbSNP
rs1000785187 1236 dbSNP
rs1247887120 1236 dbSNP
rs1185757638 1245 dbSNP
rs897815939 1245 dbSNP
rs1037772602 1251 dbSNP
rs760971109 1254 dbSNP
rs949523486 1255 dbSNP
rs916113728 1260 dbSNP
rs1169564599 1278 dbSNP
rs1446897670 1279 dbSNP
rs192182376 1285 dbSNP
rs1296987188 1289 dbSNP
rs1461953123 1290 dbSNP
rs1369529162 1298 dbSNP
rs1433330337 1302 dbSNP
rs938189037 1315 dbSNP
rs1341652067 1317 dbSNP
rs909383791 1318 dbSNP
rs985481027 1322 dbSNP
rs35786214 1335 dbSNP
rs1364706623 1339 dbSNP
rs1229444860 1349 dbSNP
rs938935532 1359 dbSNP
rs928881021 1362 dbSNP
rs1198571547 1366 dbSNP
rs982200291 1366 dbSNP
rs1167422350 1367 dbSNP
rs1277820806 1367 dbSNP
rs527561788 1369 dbSNP
rs1211587856 1383 dbSNP
rs1239881452 1393 dbSNP
rs1448458595 1398 dbSNP
rs1020615920 1426 dbSNP
rs565168791 1442 dbSNP
rs564421695 1443 dbSNP
rs1459170629 1445 dbSNP
rs1403497727 1450 dbSNP
rs1416702641 1461 dbSNP
rs1316255539 1464 dbSNP
rs1248560729 1465 dbSNP
rs1322827673 1467 dbSNP
rs550549616 1467 dbSNP
rs1230792943 1471 dbSNP
rs1274092823 1472 dbSNP
rs760537343 1475 dbSNP
rs1007367528 1476 dbSNP
rs1345562354 1477 dbSNP
rs890380356 1480 dbSNP
rs1265960560 1482 dbSNP
rs1265652862 1484 dbSNP
rs531716021 1485 dbSNP
rs993802337 1493 dbSNP
rs1449580247 1495 dbSNP
rs562930948 1496 dbSNP
rs543135144 1497 dbSNP
rs942127515 1501 dbSNP
rs1157369142 1511 dbSNP
rs574333770 1512 dbSNP
rs1056386028 1517 dbSNP
rs938835140 1518 dbSNP
rs752643756 1532 dbSNP
rs1390299610 1534 dbSNP
rs928783490 1542 dbSNP
rs560650230 1543 dbSNP
rs1386438801 1556 dbSNP
rs1322570251 1577 dbSNP
rs540606214 1586 dbSNP
rs1331504591 1587 dbSNP
rs1438462338 1588 dbSNP
rs766999975 1589 dbSNP
rs1305420200 1590 dbSNP
rs759035742 1599 dbSNP
rs1021267392 1604 dbSNP
rs1013600195 1605 dbSNP
rs370410173 1612 dbSNP
rs1268442234 1615 dbSNP
rs578172346 1628 dbSNP
rs938090958 1629 dbSNP
rs530538337 1637 dbSNP
rs538580217 1641 dbSNP
rs1473240542 1643 dbSNP
rs776453272 1647 dbSNP
rs1161393430 1650 dbSNP
rs910272007 1657 dbSNP
rs1441829303 1658 dbSNP
rs1362267995 1669 dbSNP
rs1457560798 1671 dbSNP
rs986268855 1672 dbSNP
rs575739042 1674 dbSNP
rs929443133 1675 dbSNP
rs919532443 1679 dbSNP
rs1267992638 1683 dbSNP
rs1410371259 1686 dbSNP
rs1289606487 1689 dbSNP
rs561594521 1697 dbSNP
rs993408485 1705 dbSNP
rs200399795 1715 dbSNP
rs770875603 1716 dbSNP
rs1483630900 1727 dbSNP
rs541931083 1733 dbSNP
rs1352468154 1743 dbSNP
rs1032611127 1750 dbSNP
rs894578568 1752 dbSNP
rs572878667 1756 dbSNP
rs560297434 1759 dbSNP
rs1020876884 1793 dbSNP
rs1013415862 1795 dbSNP
rs1166418180 1799 dbSNP
rs547171800 1819 dbSNP
rs763249447 1822 dbSNP
rs896525688 1829 dbSNP
rs540464662 1870 dbSNP
rs772342457 1871 dbSNP
rs369620015 1875 dbSNP
rs533857690 1876 dbSNP
rs1394910117 1881 dbSNP
rs946291307 1884 dbSNP
rs1002267754 1901 dbSNP
rs887887126 1902 dbSNP
rs1049586124 1912 dbSNP
rs1403683119 1912 dbSNP
rs1345410326 1917 dbSNP
rs1207802206 1924 dbSNP
rs929501536 1934 dbSNP
rs1483247859 1940 dbSNP
rs1299255147 1941 dbSNP
rs897950562 1946 dbSNP
rs1040670382 1947 dbSNP
rs1389263979 1950 dbSNP
rs369413886 1950 dbSNP
rs74650968 1951 dbSNP
rs34660969 1956 dbSNP
rs912258762 1956 dbSNP
rs1375850997 1959 dbSNP
rs1465500131 1962 dbSNP
rs748385227 1968 dbSNP
rs1049402813 1978 dbSNP
rs932281922 1979 dbSNP
rs1407702300 1988 dbSNP
rs1466640394 1990 dbSNP
rs75901413 1996 dbSNP
rs1365525798 1998 dbSNP
rs355945 1999 dbSNP
rs187118574 2014 dbSNP
rs1234607664 2021 dbSNP
rs1463616051 2023 dbSNP
rs1208238499 2027 dbSNP
rs1248844120 2032 dbSNP
rs1479441495 2033 dbSNP
rs1466468700 2034 dbSNP
rs549529345 2040 dbSNP
rs369290975 2045 dbSNP
rs1187989905 2062 dbSNP
rs1265010408 2063 dbSNP
rs1432488778 2063 dbSNP
rs1176736854 2064 dbSNP
rs72790445 2064 dbSNP
rs1157861298 2069 dbSNP
rs1388903327 2071 dbSNP
rs1432473840 2074 dbSNP
rs1268074875 2076 dbSNP
rs560686515 2080 dbSNP
rs1367382148 2086 dbSNP
rs756659073 2089 dbSNP
rs910189575 2094 dbSNP
rs1387806619 2103 dbSNP
rs1448446258 2112 dbSNP
rs1304020272 2122 dbSNP
rs1327748017 2128 dbSNP
rs985936392 2141 dbSNP
rs992067438 2150 dbSNP
rs954603666 2153 dbSNP
rs1204147128 2156 dbSNP
rs1331409879 2162 dbSNP
rs140558613 2163 dbSNP
rs971831990 2165 dbSNP
rs1264511787 2166 dbSNP
rs1033534062 2176 dbSNP
rs768006600 2185 dbSNP
rs1471603084 2195 dbSNP
rs1180754927 2197 dbSNP
rs578187918 2200 dbSNP
rs1006083003 2201 dbSNP
rs1162284489 2209 dbSNP
rs1325004093 2230 dbSNP
rs1458703500 2231 dbSNP
rs1027743683 2247 dbSNP
rs993988534 2257 dbSNP
rs958757983 2258 dbSNP
rs564757367 2263 dbSNP
rs575619806 2269 dbSNP
rs1409756541 2270 dbSNP
rs1289026952 2271 dbSNP
rs1040549693 2274 dbSNP
rs1034763332 2277 dbSNP
rs1002995483 2282 dbSNP
rs1322624603 2284 dbSNP
rs1222013075 2290 dbSNP
rs1293691369 2293 dbSNP
rs1174437778 2306 dbSNP
rs1009174122 2310 dbSNP
rs907249286 2311 dbSNP
rs1041894208 2312 dbSNP
rs1251846042 2315 dbSNP
rs889387647 2318 dbSNP
rs1179644467 2319 dbSNP
rs151008754 2320 dbSNP
rs1428521368 2332 dbSNP
rs893294365 2337 dbSNP
rs1050637971 2338 dbSNP
rs932343296 2351 dbSNP
rs1429623668 2374 dbSNP
rs1168366991 2379 dbSNP
rs924900117 2386 dbSNP
rs1054734470 2389 dbSNP
rs1356833042 2389 dbSNP
rs575677168 2390 dbSNP
rs1248449877 2392 dbSNP
rs1380088232 2392 dbSNP
rs762200275 2398 dbSNP
rs888820788 2426 dbSNP
rs1204238078 2428 dbSNP
rs913760077 2429 dbSNP
rs1050480037 2441 dbSNP
rs1236393987 2442 dbSNP
rs933086636 2443 dbSNP
rs1192174722 2444 dbSNP
rs183439337 2447 dbSNP
rs764892753 2452 dbSNP
rs940557390 2460 dbSNP
rs190731641 2464 dbSNP
rs1422257470 2469 dbSNP
rs369529288 2471 dbSNP
rs1413280344 2472 dbSNP
rs1333515326 2476 dbSNP
rs1259298354 2478 dbSNP
rs1359848610 2478 dbSNP
rs759015347 2487 dbSNP
rs573366659 2489 dbSNP
rs1318757459 2490 dbSNP
rs958867826 2496 dbSNP
rs1337977144 2511 dbSNP
rs1227385611 2514 dbSNP
rs1270607656 2521 dbSNP
rs574330314 2532 dbSNP
rs1028063944 2533 dbSNP
rs981813869 2534 dbSNP
rs993623562 2535 dbSNP
rs185958982 2536 dbSNP
rs1334882317 2539 dbSNP
rs1019014145 2543 dbSNP
rs1009081093 2544 dbSNP
rs1020406417 2549 dbSNP
rs1244199207 2555 dbSNP
rs1010314913 2558 dbSNP
rs1172528254 2559 dbSNP
rs571344581 2566 dbSNP
rs1470977770 2571 dbSNP
rs1157116830 2579 dbSNP
rs1388159141 2580 dbSNP
rs1417282772 2584 dbSNP
rs1436101206 2589 dbSNP
rs1318645706 2590 dbSNP
rs903548096 2595 dbSNP
rs770836599 2602 dbSNP
rs866951238 2603 dbSNP
rs1007146523 2609 dbSNP
rs1167180469 2620 dbSNP
rs1327962458 2623 dbSNP
rs1191242429 2629 dbSNP
rs1444947640 2633 dbSNP
rs558080153 2634 dbSNP
rs1050109300 2635 dbSNP
rs932956952 2638 dbSNP
rs901490885 2639 dbSNP
rs537730281 2641 dbSNP
rs760596532 2648 dbSNP
rs1481736921 2653 dbSNP
rs773080198 2659 dbSNP
rs1460513764 2667 dbSNP
rs552646853 2686 dbSNP
rs1411332297 2696 dbSNP
rs926457359 2703 dbSNP
rs980691599 2705 dbSNP
rs1388900189 2708 dbSNP
rs1403390671 2709 dbSNP
rs1322717800 2712 dbSNP
rs930541935 2714 dbSNP
rs115049571 2720 dbSNP
rs1285866315 2723 dbSNP
rs1349358728 2746 dbSNP
rs972489689 2751 dbSNP
rs1280895874 2762 dbSNP
rs937280291 2765 dbSNP
rs771861909 2766 dbSNP
rs962039735 2770 dbSNP
rs1272915324 2774 dbSNP
rs1490964072 2775 dbSNP
rs117563284 2777 dbSNP
rs971834482 2780 dbSNP
rs987514179 2781 dbSNP
rs1361964317 2791 dbSNP
rs1419719295 2800 dbSNP
rs1020291673 2810 dbSNP
rs1184162800 2819 dbSNP
rs988935670 2825 dbSNP
rs1366925550 2831 dbSNP
rs1313216326 2840 dbSNP
rs113481577 2843 dbSNP
rs1472599796 2844 dbSNP
rs1162363022 2847 dbSNP
rs1365998430 2850 dbSNP
rs953564072 2851 dbSNP
rs1262347944 2862 dbSNP
rs957404339 2868 dbSNP
rs1369916364 2869 dbSNP
rs1391458562 2873 dbSNP
rs779027208 2879 dbSNP
rs1000476916 2880 dbSNP
rs1243614230 2885 dbSNP
rs1316118082 2910 dbSNP
rs1362066421 2913 dbSNP
rs1226703584 2928 dbSNP
rs182664496 2929 dbSNP
rs1281404922 2933 dbSNP
rs1197572036 2936 dbSNP
rs1007441513 2939 dbSNP
rs796734201 2949 dbSNP
rs1442020808 2952 dbSNP
rs890062588 2958 dbSNP
rs1387368201 2964 dbSNP
rs1446195320 2968 dbSNP
rs1030351145 2971 dbSNP
rs1328036259 2972 dbSNP
rs1425092850 2973 dbSNP
rs904791160 2981 dbSNP
rs998434771 2982 dbSNP
rs190717432 2993 dbSNP
rs1161411914 2994 dbSNP
rs1395036289 3000 dbSNP
rs546815384 3001 dbSNP
rs1336948647 3004 dbSNP
rs1009655867 3005 dbSNP
rs1433336468 3012 dbSNP
rs1297346057 3015 dbSNP
rs1484802065 3017 dbSNP
rs1308528527 3020 dbSNP
rs1230300948 3024 dbSNP
rs892094739 3028 dbSNP
rs371732196 3036 dbSNP
rs1035982812 3041 dbSNP
rs546885713 3055 dbSNP
rs1245193591 3064 dbSNP
rs1463758558 3069 dbSNP
rs1357947004 3073 dbSNP
rs1186375669 3077 dbSNP
rs1260779521 3083 dbSNP
rs939099467 3087 dbSNP
rs905065546 3090 dbSNP
rs1004590554 3092 dbSNP
rs749367811 3093 dbSNP
rs533613729 3098 dbSNP
rs930467298 3106 dbSNP
rs920519208 3110 dbSNP
rs1320261152 3113 dbSNP
rs971971175 3118 dbSNP
rs1384325132 3124 dbSNP
rs940674942 3127 dbSNP
rs780178217 3135 dbSNP
rs756203587 3138 dbSNP
rs1265093286 3150 dbSNP
rs1208376508 3151 dbSNP
rs927138332 3158 dbSNP
rs1468094879 3162 dbSNP
rs1046096619 3166 dbSNP
rs1188123451 3167 dbSNP
rs777486334 3171 dbSNP
rs564519535 3174 dbSNP
rs1029059119 3177 dbSNP
rs1455273712 3178 dbSNP
rs755959903 3179 dbSNP
rs1490951629 3181 dbSNP
rs867473522 3188 dbSNP
rs544916247 3189 dbSNP
rs988778678 3190 dbSNP
rs1406094157 3201 dbSNP
rs746381126 3204 dbSNP
rs1222199726 3208 dbSNP
rs1348729037 3221 dbSNP
rs968880755 3221 dbSNP
rs1020959893 3223 dbSNP
rs957455260 3224 dbSNP
rs1263464440 3228 dbSNP
rs1490155820 3231 dbSNP
rs1286527002 3253 dbSNP
rs892168498 3255 dbSNP
rs926003210 3256 dbSNP
rs1222156255 3257 dbSNP
rs985544441 3262 dbSNP
rs954384478 3263 dbSNP
rs904967350 3267 dbSNP
rs531092642 3268 dbSNP
rs998880895 3270 dbSNP
rs1163039626 3277 dbSNP
rs142834247 3288 dbSNP
rs1014549933 3289 dbSNP
rs1036726601 3291 dbSNP
rs1369286087 3301 dbSNP
rs940580924 3311 dbSNP
rs1298835617 3316 dbSNP
rs1004474238 3319 dbSNP
rs556809872 3324 dbSNP
rs1051785653 3327 dbSNP
rs1358438375 3328 dbSNP
rs931941623 3336 dbSNP
rs1246494612 3341 dbSNP
rs922020046 3349 dbSNP
rs1423758792 3350 dbSNP
rs1345419798 3352 dbSNP
rs887544264 3357 dbSNP
rs7198123 3369 dbSNP
rs1049315989 3376 dbSNP
rs1481387942 3396 dbSNP
rs1179775759 3399 dbSNP
rs1384274580 3402 dbSNP
rs1445583071 3405 dbSNP
rs1001286679 3406 dbSNP
rs905732995 3415 dbSNP
rs573411144 3416 dbSNP
rs544802186 3419 dbSNP
rs1481739463 3420 dbSNP
rs1267374711 3423 dbSNP
rs1356380749 3439 dbSNP
rs1445975266 3440 dbSNP
rs577638078 3443 dbSNP
rs553872527 3452 dbSNP
rs1336288261 3457 dbSNP
rs1045530707 3460 dbSNP
rs1453081168 3465 dbSNP
rs960264564 3471 dbSNP
rs1337291630 3474 dbSNP
rs1213947130 3482 dbSNP
rs539949892 3483 dbSNP
rs949958026 3485 dbSNP
rs913125912 3490 dbSNP
rs1207458902 3492 dbSNP
rs1242139281 3493 dbSNP
rs767484070 3495 dbSNP
rs1034373767 3496 dbSNP
rs936011492 3497 dbSNP
rs1213862056 3503 dbSNP
rs1422324097 3507 dbSNP
rs1316528486 3518 dbSNP
rs1175869793 3519 dbSNP
rs1263890359 3520 dbSNP
rs1225410652 3521 dbSNP
rs925931003 3528 dbSNP
rs111682953 3529 dbSNP
rs1036184531 3546 dbSNP
rs954152023 3550 dbSNP
rs1362337862 3553 dbSNP
rs1221137322 3554 dbSNP
rs1261973580 3555 dbSNP
rs764833236 3561 dbSNP
rs1323757893 3565 dbSNP
rs1004695177 3568 dbSNP
rs186305598 3571 dbSNP
rs1194426020 3582 dbSNP
rs181536386 3596 dbSNP
rs921954515 3610 dbSNP
rs1198698990 3611 dbSNP
rs1430106793 3618 dbSNP
rs538155940 3622 dbSNP
rs1043570378 3624 dbSNP
rs754650180 3625 dbSNP
rs947483942 3640 dbSNP
rs1399890028 3644 dbSNP
rs759065883 3644 dbSNP
rs913416067 3655 dbSNP
rs569147739 3660 dbSNP
rs1470633291 3667 dbSNP
rs1427833838 3672 dbSNP
rs1176280039 3676 dbSNP
rs1015773026 3677 dbSNP
rs1282037210 3679 dbSNP
rs1345570313 3686 dbSNP
rs559290242 3687 dbSNP
rs555803860 3695 dbSNP
rs960166762 3700 dbSNP
rs1185123895 3704 dbSNP
rs1485695898 3710 dbSNP
rs355944 3716 dbSNP
rs980281468 3724 dbSNP
rs1286783591 3733 dbSNP
rs969498584 3733 dbSNP
rs1459989196 3735 dbSNP
rs1222425985 3744 dbSNP
rs1261198889 3747 dbSNP
rs1490852001 3747 dbSNP
rs1179829096 3749 dbSNP
rs760113999 3759 dbSNP
rs1232389630 3761 dbSNP
rs566740720 3763 dbSNP
rs1027320956 3774 dbSNP
rs1158891213 3778 dbSNP
rs1409917949 3780 dbSNP
rs1001695457 3782 dbSNP
rs905578817 3784 dbSNP
rs1023291394 3785 dbSNP
rs1366193907 3793 dbSNP
rs1406235182 3794 dbSNP
rs547117231 3800 dbSNP
rs1326299428 3803 dbSNP
rs1297517976 3808 dbSNP
rs1212583330 3817 dbSNP
rs995023870 3845 dbSNP
rs1239354438 3858 dbSNP
rs1357709971 3861 dbSNP
rs1245751643 3863 dbSNP
rs1293132987 3871 dbSNP
rs1362290769 3876 dbSNP
rs565548780 3883 dbSNP
rs1194089402 3897 dbSNP
rs963141761 3900 dbSNP
rs1015059277 3903 dbSNP
rs1184225503 3907 dbSNP
rs1454140710 3912 dbSNP
rs1024573177 3918 dbSNP
rs1442543887 3920 dbSNP
rs1014072800 3922 dbSNP
rs1403218979 3926 dbSNP
rs1335458853 3929 dbSNP
rs891616684 3935 dbSNP
rs1004726283 3945 dbSNP
rs355943 3948 dbSNP
rs1375277826 3954 dbSNP
rs190688273 3956 dbSNP
rs1030293576 3960 dbSNP
rs1168855275 3960 dbSNP
rs1391510306 3963 dbSNP
rs1330430775 3970 dbSNP
rs148503631 3979 dbSNP
rs76037591 3981 dbSNP
rs1049709211 3982 dbSNP
rs1362132276 3986 dbSNP
rs767394446 3994 dbSNP
rs1442888032 4001 dbSNP
rs568114984 4006 dbSNP
rs891889731 4023 dbSNP
rs144747538 4024 dbSNP
rs922681027 4030 dbSNP
rs976905349 4032 dbSNP
rs1243564654 4035 dbSNP
rs940213740 4038 dbSNP
rs908710740 4040 dbSNP
rs1425431748 4044 dbSNP
rs928802823 4048 dbSNP
rs561998028 4053 dbSNP
rs984378480 4067 dbSNP
rs542108646 4068 dbSNP
rs1027743101 4069 dbSNP
rs1172265125 4078 dbSNP
rs979765197 4080 dbSNP
rs948984435 4083 dbSNP
rs186266540 4095 dbSNP
rs1468970028 4096 dbSNP
rs774164645 4099 dbSNP
rs768828978 4101 dbSNP
rs1024082206 4115 dbSNP
rs74691338 4116 dbSNP
rs775507643 4128 dbSNP
rs770022954 4133 dbSNP
rs1031505879 4140 dbSNP
rs1000115095 4143 dbSNP
rs1229634736 4148 dbSNP
rs759749445 4153 dbSNP
rs904404659 4161 dbSNP
rs1050200993 4163 dbSNP
rs540358863 4165 dbSNP
rs901149187 4166 dbSNP
rs773015381 4167 dbSNP
rs531383607 4168 dbSNP
rs1391455077 4176 dbSNP
rs940108747 4177 dbSNP
rs908720550 4180 dbSNP
rs1429061877 4181 dbSNP
rs1195126295 4192 dbSNP
rs1426629499 4195 dbSNP
rs1479853650 4196 dbSNP
rs1296892725 4207 dbSNP
rs1360607215 4209 dbSNP
rs1452063969 4211 dbSNP
rs181532432 4218 dbSNP
rs769134013 4220 dbSNP
rs1366538608 4221 dbSNP
rs557956883 4226 dbSNP
rs544377584 4235 dbSNP
rs575616540 4237 dbSNP
rs1344937736 4238 dbSNP
rs1423027143 4246 dbSNP
rs1285422708 4248 dbSNP
rs1011582251 4268 dbSNP
rs1236540707 4270 dbSNP
rs1259930543 4275 dbSNP
rs1384830799 4292 dbSNP
rs1218678796 4293 dbSNP
rs1266738157 4300 dbSNP
rs1490042591 4303 dbSNP
rs568026030 4312 dbSNP
rs981413402 4313 dbSNP
rs1158789598 4321 dbSNP
rs1252605790 4345 dbSNP
rs1421953581 4349 dbSNP
rs1365574528 4351 dbSNP
rs1175372677 4352 dbSNP
rs1295374934 4353 dbSNP
rs1482671722 4357 dbSNP
rs969779178 4358 dbSNP
rs1224430502 4361 dbSNP
rs1305963369 4366 dbSNP
rs1356918176 4367 dbSNP
rs1024383370 4373 dbSNP
rs745893287 4380 dbSNP
rs907408979 4382 dbSNP
rs867286584 4385 dbSNP
rs1264424857 4389 dbSNP
rs1031515709 4397 dbSNP
rs1247986275 4404 dbSNP
rs999999354 4418 dbSNP
rs555736547 4422 dbSNP
rs920198133 4423 dbSNP
rs1336962882 4428 dbSNP
rs1250842309 4432 dbSNP
rs1441922596 4452 dbSNP
rs1162124120 4454 dbSNP
rs974691714 4466 dbSNP
rs1425851007 4467 dbSNP
rs941745882 4467 dbSNP
rs535743211 4470 dbSNP
rs573215635 4491 dbSNP
rs1441620895 4492 dbSNP
rs1298957800 4493 dbSNP
rs1028261685 4503 dbSNP
rs781776153 4505 dbSNP
rs1448646760 4510 dbSNP
rs983229613 4512 dbSNP
rs954427783 4517 dbSNP
rs1030064501 4521 dbSNP
rs997152522 4527 dbSNP
rs1292004323 4528 dbSNP
rs901214541 4528 dbSNP
rs1203286303 4535 dbSNP
rs964864696 4536 dbSNP
rs1040986560 4540 dbSNP
rs1182060000 4556 dbSNP
rs1021542359 4558 dbSNP
rs1242952617 4558 dbSNP
rs1004263172 4567 dbSNP
rs771327019 4567 dbSNP
rs1409440488 4578 dbSNP
rs1171239042 4580 dbSNP
rs1403485819 4581 dbSNP
rs1468466300 4583 dbSNP
rs887165983 4585 dbSNP
rs757805358 4588 dbSNP
rs553074929 4589 dbSNP
rs199985904 4598 dbSNP
rs1002935641 4599 dbSNP
rs1455442212 4603 dbSNP
rs547910470 4604 dbSNP
rs747396091 4605 dbSNP
rs1359851922 4611 dbSNP
rs1045355266 4612 dbSNP
rs1044430190 4614 dbSNP
rs949665785 4617 dbSNP
rs916922221 4624 dbSNP
rs1013089623 4625 dbSNP
rs898658434 4632 dbSNP
rs992459334 4636 dbSNP
rs1362179240 4640 dbSNP
rs776114933 4642 dbSNP
rs1338782428 4651 dbSNP
rs1333524489 4652 dbSNP
rs755206736 4653 dbSNP
rs78010692 4654 dbSNP
rs766443498 4662 dbSNP
rs940255762 4663 dbSNP
rs907566000 4669 dbSNP
rs370982322 4677 dbSNP
rs746244934 4684 dbSNP
rs750870059 4689 dbSNP
rs531661664 4691 dbSNP
rs779329689 4691 dbSNP
rs1186223109 4692 dbSNP
rs1442687515 4693 dbSNP
rs1281998167 4694 dbSNP
rs1213947400 4696 dbSNP
rs1352757424 4698 dbSNP
rs1286383605 4699 dbSNP
rs1225407584 4705 dbSNP
rs767891322 4708 dbSNP
rs1283739751 4711 dbSNP
rs762042681 4714 dbSNP
rs202098888 4718 dbSNP
rs374620860 4719 dbSNP
rs1335946641 4720 dbSNP
rs753904829 4721 dbSNP
rs1361575783 4722 dbSNP
rs189643240 4723 dbSNP
rs777767021 4724 dbSNP
rs1404167951 4729 dbSNP
rs1298221784 4733 dbSNP
rs375038843 4736 dbSNP
rs1198722686 4737 dbSNP
rs964613355 4741 dbSNP
rs1282229494 4745 dbSNP
rs996780264 4746 dbSNP
rs914380889 4747 dbSNP
rs965640558 4748 dbSNP
rs745825863 4749 dbSNP
rs1258959398 4755 dbSNP
rs1191071180 4756 dbSNP
rs201212372 4764 dbSNP
rs1263708877 4767 dbSNP
rs756246742 4768 dbSNP
rs1282637597 4771 dbSNP
rs537288410 4772 dbSNP
rs150421604 4773 dbSNP
rs777612353 4774 dbSNP
rs990110719 4776 dbSNP
rs755224073 4786 dbSNP
rs1004146719 4789 dbSNP
rs1276308517 4792 dbSNP
rs753991660 4797 dbSNP
rs199881405 4798 dbSNP
rs1291042872 4799 dbSNP
rs1479130139 4808 dbSNP
rs200104728 4809 dbSNP
rs756137545 4811 dbSNP
rs750958182 4823 dbSNP
rs752810252 4829 dbSNP
rs768048815 4831 dbSNP
rs762354497 4832 dbSNP
rs1159148227 4834 dbSNP
rs1362442836 4840 dbSNP
rs1402492010 4843 dbSNP
rs1301996648 4845 dbSNP
rs1330846363 4845 dbSNP
rs1319358292 4853 dbSNP
rs971332773 4857 dbSNP
rs1277463413 4859 dbSNP
rs1384187090 4860 dbSNP
rs1350376151 4877 dbSNP
rs142010831 4894 dbSNP
rs1288761778 4900 dbSNP
rs1357936484 4901 dbSNP
rs1048490825 4906 dbSNP
rs559066395 4907 dbSNP
rs1429918613 4914 dbSNP
rs905398942 4932 dbSNP
rs1178436466 4936 dbSNP
rs1179893599 4938 dbSNP
rs1479349980 4941 dbSNP
rs1045601287 4947 dbSNP
rs1469432848 4951 dbSNP
rs1376895105 4960 dbSNP
rs202108859 4961 dbSNP
rs1193602491 4962 dbSNP
rs528765934 4965 dbSNP
rs560112051 4968 dbSNP
rs546252434 4974 dbSNP
rs1162324852 4977 dbSNP
rs918143479 4982 dbSNP
rs1004361896 4983 dbSNP
rs1259227842 4985 dbSNP
rs533053141 5000 dbSNP
rs1406644242 5006 dbSNP
rs80079273 5010 dbSNP
rs1326444653 5011 dbSNP
rs1334866761 5012 dbSNP
rs1207561014 5026 dbSNP
rs879637079 5031 dbSNP
rs1447901610 5038 dbSNP
rs887372171 5046 dbSNP
rs1381170909 5051 dbSNP
rs1051316792 5055 dbSNP
rs376622245 5065 dbSNP
rs1265576098 5074 dbSNP
rs1222268191 5077 dbSNP
rs1344894196 5082 dbSNP
rs1194221266 5101 dbSNP
rs934337207 5108 dbSNP
rs1458387739 5123 dbSNP
rs544312957 5125 dbSNP
rs1324909911 5127 dbSNP
rs914434295 5138 dbSNP
rs990407304 5141 dbSNP
rs1369059132 5143 dbSNP
rs1473487974 5151 dbSNP
rs1165660392 5155 dbSNP
rs1395231902 5157 dbSNP
rs1297074666 5158 dbSNP
rs1465843116 5158 dbSNP
rs924258208 5159 dbSNP
rs575553272 5189 dbSNP
rs765980732 5194 dbSNP
rs968836382 5209 dbSNP
rs921117512 5217 dbSNP
rs1342842709 5222 dbSNP
rs924538830 5224 dbSNP
rs975624684 5231 dbSNP
rs371427412 5232 dbSNP
rs1019515041 5233 dbSNP
rs982651331 5234 dbSNP
rs355942 5242 dbSNP
rs1387962918 5243 dbSNP
rs1261548462 5244 dbSNP
rs573018605 5248 dbSNP
rs1023375927 5252 dbSNP
rs140134430 5253 dbSNP
rs539404700 5254 dbSNP
rs991612926 5255 dbSNP
rs1439327705 5259 dbSNP
rs1477888691 5260 dbSNP
rs1244495020 5262 dbSNP
rs1465843751 5272 dbSNP
rs924963709 5272 dbSNP
rs1303796777 5273 dbSNP
rs749913946 5274 dbSNP
rs1442413728 5277 dbSNP
rs746416124 5278 dbSNP
rs577276720 5285 dbSNP
rs1220618781 5287 dbSNP
rs1274237709 5288 dbSNP
rs561008720 5294 dbSNP
rs1323112412 5301 dbSNP
rs905242425 5303 dbSNP
rs557080791 5312 dbSNP
rs1484165223 5314 dbSNP
rs1023816777 5320 dbSNP
rs1297188028 5325 dbSNP
rs761453299 5325 dbSNP
rs887231617 5326 dbSNP
rs1195286117 5328 dbSNP
rs1266252154 5329 dbSNP
rs1014147263 5333 dbSNP
rs1379713399 5337 dbSNP
rs896635743 5338 dbSNP
rs767482380 5344 dbSNP
rs1052715241 5352 dbSNP
rs1401864025 5353 dbSNP
rs935558706 5357 dbSNP
rs1313084614 5358 dbSNP
rs373435297 5366 dbSNP
rs374759873 5375 dbSNP
rs568351189 5393 dbSNP
rs1387583702 5399 dbSNP
rs146108100 5404 dbSNP
rs535351668 5410 dbSNP
rs1313705634 5432 dbSNP
rs1236697929 5440 dbSNP
rs1285201872 5449 dbSNP
rs1039090664 5455 dbSNP
rs947171345 5458 dbSNP
rs533355417 5472 dbSNP
rs1487902329 5473 dbSNP
rs1191384821 5479 dbSNP
rs1269109507 5503 dbSNP
rs116545474 5505 dbSNP
rs943903119 5506 dbSNP
rs934535006 5517 dbSNP
rs371823946 5528 dbSNP
rs76198339 5530 dbSNP
rs949953767 5532 dbSNP
rs951261124 5536 dbSNP
rs763953117 5538 dbSNP
rs991913552 5540 dbSNP
rs762614244 5544 dbSNP
rs962710031 5544 dbSNP
rs1377487998 5551 dbSNP
rs1386700553 5583 dbSNP
rs1017439929 5586 dbSNP
rs1320589580 5602 dbSNP
rs1221740118 5613 dbSNP
rs1266789406 5624 dbSNP
rs1479458858 5629 dbSNP
rs1179608792 5634 dbSNP
rs1198368474 5637 dbSNP
rs1239191549 5642 dbSNP
rs142953991 5648 dbSNP
rs982859406 5649 dbSNP
rs1233993601 5656 dbSNP
rs1413784916 5661 dbSNP
rs1184556572 5668 dbSNP
rs1424458141 5670 dbSNP
rs1167016195 5682 dbSNP
rs1352912322 5683 dbSNP
rs775877711 5691 dbSNP
rs1332356994 5692 dbSNP
rs770117885 5694 dbSNP
rs1400721020 5695 dbSNP
rs951557685 5695 dbSNP
rs1282346636 5696 dbSNP
rs1378371416 5705 dbSNP
rs1228331254 5710 dbSNP
rs1024161021 5720 dbSNP
rs745981281 5724 dbSNP
rs998461359 5728 dbSNP
rs896687889 5732 dbSNP
rs1274435882 5737 dbSNP
rs1258345815 5738 dbSNP
rs1459364356 5751 dbSNP
rs776844192 5751 dbSNP
rs1018498085 5764 dbSNP
rs796403937 5772 dbSNP
rs892762872 5772 dbSNP
rs1223673275 5777 dbSNP
rs1417436881 5777 dbSNP
rs1477560428 5779 dbSNP
rs1361947865 5780 dbSNP
rs771620428 5792 dbSNP
rs1426122256 5814 dbSNP
rs1466941661 5817 dbSNP
rs1054167554 5828 dbSNP
rs747568806 5836 dbSNP
rs564064463 5837 dbSNP
rs903048879 5839 dbSNP
rs1304559827 5840 dbSNP
rs1337724722 5846 dbSNP
rs1217551193 5847 dbSNP
rs1045561202 5849 dbSNP
rs1042749874 5861 dbSNP
rs1348540015 5874 dbSNP
rs543609768 5878 dbSNP
rs550721562 5878 dbSNP
rs899485580 5880 dbSNP
rs1405257870 5884 dbSNP
rs1240935943 5894 dbSNP
rs1487997100 5896 dbSNP
rs1194497610 5900 dbSNP
rs1265529787 5905 dbSNP
rs1479598670 5906 dbSNP
rs1367061182 5908 dbSNP
rs1039894066 5919 dbSNP
rs1424175150 5923 dbSNP
rs1404280436 5953 dbSNP
rs1178131117 5956 dbSNP
rs1358607519 5959 dbSNP
rs778078589 5970 dbSNP
rs1298278528 5981 dbSNP
rs1341944385 5993 dbSNP
rs943787890 5998 dbSNP
rs912398828 5999 dbSNP
rs951423368 6005 dbSNP
rs1221353157 6010 dbSNP
rs1408133622 6013 dbSNP
rs1159774357 6016 dbSNP
rs1284432266 6019 dbSNP
rs982544793 6024 dbSNP
rs1217376916 6025 dbSNP
rs1453337507 6025 dbSNP
rs530603965 6025 dbSNP
rs919814031 6026 dbSNP
rs976932250 6026 dbSNP
rs1200609238 6028 dbSNP
rs144989651 6034 dbSNP
rs397840805 6034 dbSNP
rs964211308 6034 dbSNP
rs1490926690 6036 dbSNP
rs1245224885 6041 dbSNP
rs1221163819 6043 dbSNP
rs1317720998 6048 dbSNP
rs1018944803 6050 dbSNP
rs1331339596 6052 dbSNP
rs1438966153 6057 dbSNP
rs1307568661 6073 dbSNP
rs1376745372 6076 dbSNP
rs1286499020 6078 dbSNP
rs973998025 6080 dbSNP
rs1312155245 6088 dbSNP
rs867991142 6094 dbSNP
rs1222137493 6110 dbSNP
rs1326997845 6117 dbSNP
rs916575147 6126 dbSNP
rs992281596 6135 dbSNP
rs1453549313 6146 dbSNP
rs960740885 6173 dbSNP
rs1291544666 6176 dbSNP
rs1031190338 6184 dbSNP
rs1032620521 6192 dbSNP
rs999673411 6196 dbSNP
rs544870535 6200 dbSNP
rs552047404 6203 dbSNP
rs1382158397 6205 dbSNP
rs1022999729 6208 dbSNP
rs996435939 6227 dbSNP
rs1319798428 6237 dbSNP
rs902952231 6242 dbSNP
rs1399980349 6262 dbSNP
rs561879570 6262 dbSNP
rs1039306633 6263 dbSNP
rs1045421357 6266 dbSNP
rs1339244058 6268 dbSNP
rs1014504799 6269 dbSNP
rs1007939540 6271 dbSNP
rs1284889777 6271 dbSNP
rs755873589 6272 dbSNP
rs1177722089 6278 dbSNP
rs1217007874 6279 dbSNP
rs1257711532 6289 dbSNP
rs890846862 6291 dbSNP
rs941276462 6295 dbSNP
rs184334896 6298 dbSNP
rs1047113751 6299 dbSNP
rs779732240 6300 dbSNP
rs1243991274 6304 dbSNP
rs919754121 6305 dbSNP
rs1475922927 6306 dbSNP
rs1464456272 6314 dbSNP
rs1038723916 6315 dbSNP
rs1267456975 6318 dbSNP
rs947993286 6332 dbSNP
rs1466417212 6338 dbSNP
rs916569424 6339 dbSNP
rs922689910 6341 dbSNP
rs573095579 6346 dbSNP
rs3743723 6352 dbSNP
rs924048732 6356 dbSNP
rs911380657 6367 dbSNP
rs555724796 6372 dbSNP
rs1432290257 6375 dbSNP
rs968656257 6384 dbSNP
rs546075588 6385 dbSNP
rs996835965 6388 dbSNP
rs374570910 6389 dbSNP
rs1017908120 6406 dbSNP
rs1256855565 6406 dbSNP
rs1007823683 6411 dbSNP
rs756653695 6427 dbSNP
rs1046825847 6438 dbSNP
rs1190899139 6439 dbSNP
rs1175801814 6442 dbSNP
rs751545477 6443 dbSNP
rs898359537 6447 dbSNP
rs1038166033 6451 dbSNP
rs947971686 6452 dbSNP
rs541905989 6455 dbSNP
rs3743722 6457 dbSNP
rs150901028 6458 dbSNP
rs966975143 6458 dbSNP
rs1376262743 6467 dbSNP
rs553514093 6477 dbSNP
rs539610143 6478 dbSNP
rs923930931 6486 dbSNP
rs894330954 6489 dbSNP
rs978211701 6494 dbSNP
rs751522905 6502 dbSNP
rs574566751 6515 dbSNP
rs946783640 6518 dbSNP
rs554748139 6519 dbSNP
rs974908553 6521 dbSNP
rs965349319 6522 dbSNP
rs1329128083 6536 dbSNP
rs888379208 6540 dbSNP
rs1209181941 6542 dbSNP
rs762855398 6548 dbSNP
rs1349972806 6556 dbSNP
rs1046982158 6562 dbSNP
rs1284716084 6579 dbSNP
rs1488360828 6583 dbSNP
rs150553001 6585 dbSNP
rs752505448 6592 dbSNP
rs1187873743 6593 dbSNP
rs1307812835 6598 dbSNP
rs570681960 6599 dbSNP
rs929965254 6610 dbSNP
rs955073581 6611 dbSNP
rs765617187 6616 dbSNP
rs1361209500 6621 dbSNP
rs1363993850 6627 dbSNP
rs1291984798 6636 dbSNP
rs113764296 6640 dbSNP
rs1385951232 6643 dbSNP
rs898207981 6645 dbSNP
rs1454053671 6646 dbSNP
rs1377635428 6649 dbSNP
rs1017199506 6661 dbSNP
rs1302725728 6666 dbSNP
rs1462838494 6667 dbSNP
rs1217384821 6687 dbSNP
rs147974302 6688 dbSNP
rs1487971848 6694 dbSNP
rs1210757808 6724 dbSNP
rs1255258594 6726 dbSNP
rs559030772 6728 dbSNP
rs1438266437 6730 dbSNP
rs180866040 6732 dbSNP
rs1178560929 6758 dbSNP
rs894970431 6761 dbSNP
rs189301520 6786 dbSNP
rs550558215 6808 dbSNP
rs530643287 6809 dbSNP
rs1282747326 6827 dbSNP
rs556904595 6828 dbSNP
rs939248091 6829 dbSNP
rs1386093388 6849 dbSNP
rs79425004 6853 dbSNP
rs936805717 6855 dbSNP
rs1254024681 6863 dbSNP
rs185066987 6875 dbSNP
rs1344475036 6879 dbSNP
rs1444387192 6885 dbSNP
rs1181170636 6894 dbSNP
rs1480900839 6898 dbSNP
rs924195853 6902 dbSNP
rs141184007 6907 dbSNP
rs866783158 6908 dbSNP
rs1320642835 6919 dbSNP
rs1245022574 6921 dbSNP
rs946805095 6925 dbSNP
rs1198421273 6943 dbSNP
rs1239254238 6944 dbSNP
rs967047988 6948 dbSNP
rs760632996 6950 dbSNP
rs568303752 6951 dbSNP
rs943579020 6960 dbSNP
rs559477550 6964 dbSNP
rs4538003 6965 dbSNP
rs1246373533 6972 dbSNP
rs1319359672 6977 dbSNP
rs1463814182 6980 dbSNP
rs545813058 6992 dbSNP
rs772440218 6993 dbSNP
rs987720000 7002 dbSNP
rs888242976 7003 dbSNP
rs950928116 7004 dbSNP
rs370514063 7011 dbSNP
rs1306640477 7014 dbSNP
rs532241114 7021 dbSNP
rs1294680773 7026 dbSNP
rs1315691510 7028 dbSNP
rs1218367213 7031 dbSNP
rs1259139269 7037 dbSNP
rs1309686144 7039 dbSNP
rs972396708 7041 dbSNP
rs748552754 7046 dbSNP
rs1208602640 7047 dbSNP
rs1237480348 7051 dbSNP
rs1483611930 7060 dbSNP
rs962675668 7061 dbSNP
rs1190170911 7066 dbSNP
rs1016715429 7070 dbSNP
rs994077727 7079 dbSNP
rs901197714 7087 dbSNP
rs1419925607 7093 dbSNP
rs1411516469 7097 dbSNP
rs779245756 7100 dbSNP
rs200202076 7101 dbSNP
rs548163404 7102 dbSNP
rs748971539 7107 dbSNP
rs1253799343 7108 dbSNP
rs1003470200 7125 dbSNP
rs936879005 7127 dbSNP
rs1398989541 7131 dbSNP
rs1179762654 7135 dbSNP
rs1364520609 7138 dbSNP
rs902403058 7143 dbSNP
rs1269189519 7147 dbSNP
rs1278465357 7157 dbSNP
rs1349241627 7159 dbSNP
rs1211303640 7165 dbSNP
rs1283944593 7168 dbSNP
rs1045604 7169 dbSNP
rs1487286214 7171 dbSNP
rs1217616320 7192 dbSNP
rs192135166 7212 dbSNP
rs1239138430 7215 dbSNP
rs978344822 7216 dbSNP
rs1424330657 7227 dbSNP
rs946760656 7229 dbSNP
rs1454675656 7236 dbSNP
rs1045617 7240 dbSNP
rs1175496951 7245 dbSNP