miRTarBase - #MIRT567017 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KLHL15   
Synonyms HEL-S-305
Description kelch like family member 15
Transcript NM_030624   
Expression
Putative miRNA Targets on KLHL15
3'UTR of KLHL15
(miRNA target sites are highlighted)
>KLHL15|NM_030624|3'UTR
   1 TGACATCCTCCTCCCTAAAAAAAGAGGCAAACAAAGTATTTGTTTGCACAGAGTAATTAATTAAAACATATAAAGAAAAA
  81 CCTCACCAGTTTTACTATCAAAGCCATTGGTCTAACATTGTAAGAATTTTTCATTCTGTGCTAGCATCCTTTTTTTCTTT
 161 TCAGTGGCCTCAAACTCATGCAATAAGTTAATTCTAAGTGCTAGCTCTTGAAACTACTTCCAGAAGCAGTTGAATAGAAT
 241 GCTCCACTTATCTGGGATATTGATTTTCTGCTTTAAACATTTCTTTCAGATGTTAGCGTAGGAGTCATGTGTCTTCTAAG
 321 AGAAGACCCGATAAGTGTCACTGGATGTGATTTCAGTCTCTGTCTCTATCTGAAACCTTTTTGAAGATTTATTTCAGTGT
 401 ATTTCAGTCTGTTATACTTTTTAGTTTTATTATTTAAAAGTTTAAAACTCTTGACCTTTTTGCATGGCTTTTTGCTGAAA
 481 ATGCAAAAATATAAATTTTCTACAAAATTAACTTTTTATATTCAAAACACTATTTCTAAGCTGCCTTCTCTTATCCGCAT
 561 TGTGTTAGTGAAAGCATATTCATACTCGCATACAACCTATAAATACACAAGGCACATCCCTTTTATGCGTGGTTAGGATT
 641 CTATATTTTTAAGCTAGTGCACTTACTTGCACACACAGTTCGCCATACTTGTTGAATTTTAGATGTAACGTCTTTTCACA
 721 TATTAACATTTTTAGAAAGTTGAAATAACTGGAGTCCTCATTTGCTATCAAAGTAGCCTATCTTCAGTCCATACTGATTC
 801 AGTAATATTTGAACTCCTTATATTTCTGAAACATGTATGGTTATGAAAACTAACACTTTATATTTTATTTTCAAAAGTAA
 881 ATGTTAGTGTTCTTTGTCGATGTATGTCTTTTCTTTTTGAAAATGTTTTTCTTTGCAGTCTGTTTAACGTTACCCTGTTT
 961 TTAGTGAGAATCGGAGTGGTATATGACAAGTTCTGGCCCTGCAGCATGCAAGCACTTTTAAAGAGCATTTAGGTAATACC
1041 AGACTCCTAAATCAAGGCCCCTTAAAAGTAAGTGCAACTCCCATTTTTTACATTCAGTAAGGCTGCTGCATTTGTTATTG
1121 AATGGAAGGTAGAAACTCTTAGAAAATTTGACCTCAGTTTTGACTTAGAGGTAAGAAATAGAATTATAATGTTACTGGTT
1201 TTATCTACTTGTTTATTTTGTACAAAATACCCAGCGACACTAGGGATGTAAGCCCTCAGTTTTTGTTTTATTTACTGAAA
1281 GCTATTAGCATGAAGGATAGTAACCACAAAGTTCAGAATGGATCAAGAATAGCTGTTTAAAAGCATTTATAATAAGTGTT
1361 TTAGGATTAGCTGCACCTTTCAACTCTTTAAATGCAGAGGAAAAAACATAGTTGACAAAGTTAAGCAAGAATAACCTGGG
1441 AGTGGATCATTGAAATTGATGCCATTTGCGCATGAGTAGTCTATATCTGATACAGACTAGATCTATACTGGCAAAACTTG
1521 CCAGATCTTAGAATATTGGTGCAATATTGCAATGCCTTCTATATGGCTGCTGATGTATAAATTTTCTAGTTTCACTTTGT
1601 TTGGTGTTTTTTGTTTTTTTGTTTGTTTGTTTGTTTTTTTGCTGCTGCCACCATTGAACATAAAATGGAAGTGTGAAGTC
1681 ATGGAAATGTGAAGACTTTGGTTTTTGGGGGTTTTTTGGGCAGTTATTAGACATACTATGAGATTAAACCTGATCTTCAA
1761 ACTCCAGAATTGGAGGCATTTGGGTTTAAGAAACCAGGTACATAAGTAGCTTTTGAAAAAACCATTGGCATTGATTTCAA
1841 AAATCAATAATAATCTTATTTTATATATGAGACTTATATTTTCATTAACTAGTCCTGTCATTTACTTACAGTTTCCAAAC
1921 ATGAAATTTGGTATCTTGTTTCCCATGGTAATATGGGTAAAAGTCTTTTTCTACATTTAAAAAATACATTATTTTATTTT
2001 TGAAAGTTAGGAATAAGTTAGCCATTTAATTTTTTTCTACATTAGTTTAGTGGCTTTGTATGTGTGCTATTTTGCTTTAA
2081 AGAAAATAACGTCTTCATTATTTTCCTCATTGATGTCTTTTGCTAGAAAAGACCAAGAAAGAGCCATCAGGCCAGGTATC
2161 CACATCAAAGCCTTTACACTATAGTGGTGGTTCTCTTTAATTGCTTAGATATGACTTCATGACCCTAGTCAGGGTGACAT
2241 CTGGGCAAACATTTGAGTATTCTTGGTCTTCCATTTTAAAGACAGAGGCCAAGATCAAAGTTCATGTTTTGTAAAATTCG
2321 TAAAATCTTAACTTGAACTAACTCTGGGTTCAGCTTTACGTAAGTCACGTCGGACCTGATGTTAGCTGTAATCAGTTTTG
2401 AGCTTTAAGGATAGTTGCTGTTGCTTGGGTTCTGAATGTATGAGAAAACTCCCTGTTTATATGTAGTTCTAATTTAGGTT
2481 ATTTTAAATCCATGATTAACTTACATTCCCTTTTAAAATTATGGTTTTATTGCTGCAAGAGATTTATTTTTGTTATACTA
2561 AACTATGGAAAAGTTTTTCATAGCATTTTTTTCAAGTTTATTTTTTGTGTGCTTCATTTGGAGTTTTTGTTTATATACAT
2641 TGCGCTCAAAAAAGTAGTTTTTTGAAAAATTCAGTAAGATTTGAATCTATACAGTTTAACTGTTATGACCTTTATGCGTG
2721 TTGTTTTCACTTTATATCTCAAATGCCAGAGTTCACAAAAATAGCTGATCTTCATTAATTACATCTTAATTAGAACCATT
2801 TGTTCTCTTCCGTGTCTTTGACCTTCTAAGTTTTGATTTTAAAGAAATTCCTTGCACTACAGCCTTTTCTTAAAATGCAA
2881 GATTCTCACTTTGAAGGTTTTGTGTTGGAAGAAATGCTACTGGTTTTTAAAAAGCAAAGCTTAACTAATAGAATTATTAG
2961 CTTTTCTTGAGACAGCTTTCTGTGTCCTCATTACTCTGCTCTGTGTGAGTGTTACTAGAATTTGTGAAATACTGACTGAG
3041 CCCTTCACTTATCTTTTCTAAAGCAGCACCTTTGGACACCTCATTCTGGGAAGCCTGCTCGAGTCATAGTAAAGGACACA
3121 CGCTTTATGTGGGGAGAAGTGGTAAAAATGGAGTTTTGTCTTAATTACATGAAACTAAGCTTTAAAATATTTTATAACAG
3201 ATTATTTGAGCTGCATAATCTAAACATGTCAAACGTTCAGTGGGACTATTTTTATATATGTATATGTGGGTGTAGGTCAT
3281 AACATTTCAGTTTATAATATAAATTGTTATTTCAGTTTATAAGCTATCTCTCAGAGGAGACTAGCTCTTTTGAGAATTCA
3361 TAATTTAAAGTTTTAGACTGAAGTAAAATGCAACATAGATAATAGTGTAAATCAGATATAATTGAGGGCTATATGGCAGT
3441 AAAACTGCTAGTGCCAGTTTTCTTGTTTGCCTGTTATACATTTTTGATTTTTGTTTTTGTATTCTGAACATTTTGAGAGA
3521 TCATATGTTTGTTCAATTACATTTAGAGTTGGTTTGGGAATAAATATCTTCTAAAAAGAGATTTATCTTAAAAATGGAAG
3601 TCCTAAAAATTAGTTTATCCAGAGTTTATAAAGTCAAATATTCAGTAGGCATAGACTGGAATAGATAAATTCATGGAAAT
3681 CATATCCTTTCAGTACACCGTATAACTTCAATATTACACAAGTAACATTGAGGAGAATGCCATCAGCTTTGTTCTCCCTT
3761 AAATTCTTTGGTTTTCTTTTTACATTTTGGGAACAACTGCATTTAAAATGTTATTAGTCAGTATATAGTAAGGATTAGGT
3841 GTTTGCTTTCTGAAGGAATGGTCCAGTGAGGTGATTGGGAGAGGTTATTTTCTACCTAACTTGTATATGCCCTATACCTC
3921 TTGGGCATACTTTGTCTATAGAAAAATATTTTGACCTTTAGGTACATTTTGGGCCAGTAGTCAAATAATCCTAGGGCCGA
4001 TATAAAAATCTTAGAATAATTTAAGGTTTGCCTTTTATACCTGTTTTGAAAGCCTTTACATTTTTGTCAGGTAATTTTTC
4081 CCAAGCCGTGGATATAATCTATTCAAACATGTTTATGCTATCCATTCTGTTTTTAAATTGAAAAAAATGTTAAAAGTGTT
4161 TATGAAGAAAAGTTTAAATAAAATATTTTTAATCTTTAAAATATAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   || | ||||||| 
Target 5' tttgtttgtTTTTTTGCTGCTg 3'
1626 - 1647 149.00 -10.60
2
miRNA  3' gugUUUGGU-----AAUACACGACGau 5'
             |||::|     |||| ||||||  
Target 5' ttaAAATTATGGTTTTAT-TGCTGCaa 3'
2513 - 2538 138.00 -8.31
3
miRNA  3' guguUUGGUAAUA--CACGACGAu 5'
              :||| ||||  |||:||:| 
Target 5' ttatGACCTTTATGCGTGTTGTTt 3'
2703 - 2726 136.00 -11.90
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1478228760 4 dbSNP
rs532904531 5 dbSNP
rs182471953 7 dbSNP
rs780961925 8 dbSNP
rs1268538479 23 dbSNP
rs1463640021 24 dbSNP
rs747838167 24 dbSNP
rs778491924 24 dbSNP
rs1187973000 29 dbSNP
rs1242977940 32 dbSNP
rs754728995 34 dbSNP
rs1215457589 36 dbSNP
rs754754581 37 dbSNP
rs746683646 39 dbSNP
rs753681944 39 dbSNP
rs779934606 47 dbSNP
rs1218702502 51 dbSNP
rs931811959 53 dbSNP
rs1406279162 97 dbSNP
rs964399585 111 dbSNP
rs1387060694 113 dbSNP
rs1433763927 124 dbSNP
rs1320626391 143 dbSNP
rs756253697 150 dbSNP
rs1262223525 157 dbSNP
rs1206787966 162 dbSNP
rs1463538734 163 dbSNP
rs1266923077 164 dbSNP
rs752935513 166 dbSNP
rs1325079550 167 dbSNP
rs1272676992 183 dbSNP
rs1445364461 204 dbSNP
rs1283198950 210 dbSNP
rs1379655843 216 dbSNP
rs56242532 220 dbSNP
rs1053454351 251 dbSNP
rs1266209045 270 dbSNP
rs935044093 283 dbSNP
rs755043687 286 dbSNP
rs760808190 297 dbSNP
rs1320741114 298 dbSNP
rs982152918 304 dbSNP
rs751639571 308 dbSNP
rs1185723730 309 dbSNP
rs1237070005 311 dbSNP
rs776227242 318 dbSNP
rs1470971823 320 dbSNP
rs1190474696 326 dbSNP
rs146597679 329 dbSNP
rs1172188538 330 dbSNP
rs958847462 331 dbSNP
rs1026435984 335 dbSNP
rs1386539559 335 dbSNP
rs775777707 341 dbSNP
rs1333156398 355 dbSNP
rs1340671360 358 dbSNP
rs993752787 367 dbSNP
rs185198388 370 dbSNP
rs1286208355 375 dbSNP
rs866991965 381 dbSNP
rs1349586038 397 dbSNP
rs1228932244 405 dbSNP
rs1373425180 411 dbSNP
rs1190335204 414 dbSNP
rs962397280 415 dbSNP
rs1278236198 421 dbSNP
rs1015016184 425 dbSNP
rs1009305911 429 dbSNP
rs1486118385 436 dbSNP
rs1213218186 440 dbSNP
rs890500917 448 dbSNP
rs1472447143 449 dbSNP
rs1366039270 453 dbSNP
rs907473785 453 dbSNP
rs750713748 454 dbSNP
rs1447449941 456 dbSNP
rs1171484733 464 dbSNP
rs1375747266 488 dbSNP
rs1436209980 490 dbSNP
rs1305721777 492 dbSNP
rs1247267339 495 dbSNP
rs1410147902 496 dbSNP
rs1050284889 503 dbSNP
rs996075892 523 dbSNP
rs772691908 532 dbSNP
rs1462229474 540 dbSNP
rs893735570 546 dbSNP
rs150462731 556 dbSNP
rs1348598875 557 dbSNP
rs1236809682 567 dbSNP
rs935188436 587 dbSNP
rs1482963643 592 dbSNP
rs779479346 593 dbSNP
rs3829712 594 dbSNP
rs1253371996 596 dbSNP
rs1046187938 597 dbSNP
rs1198702701 603 dbSNP
rs949057054 607 dbSNP
rs926536598 610 dbSNP
rs1455161815 612 dbSNP
rs916278624 631 dbSNP
rs990498727 643 dbSNP
rs937553371 654 dbSNP
rs1389143942 658 dbSNP
rs920850489 659 dbSNP
rs1364959956 662 dbSNP
rs903170349 669 dbSNP
rs1299665160 673 dbSNP
rs771157051 681 dbSNP
rs775195971 689 dbSNP
rs1386147134 704 dbSNP
rs1326452685 711 dbSNP
rs1371848821 712 dbSNP
rs1455097808 714 dbSNP
rs1443169948 719 dbSNP
rs1295731213 723 dbSNP
rs1341721336 729 dbSNP
rs1042134299 740 dbSNP
rs973944793 745 dbSNP
rs1354601904 756 dbSNP
rs962269579 757 dbSNP
rs1254117586 771 dbSNP
rs923201959 778 dbSNP
rs1186088307 782 dbSNP
rs1247099430 799 dbSNP
rs975852800 801 dbSNP
rs56051542 809 dbSNP
rs5925970 814 dbSNP
rs1166953668 826 dbSNP
rs1165630005 829 dbSNP
rs1463143361 835 dbSNP
rs943207026 835 dbSNP
rs954859473 856 dbSNP
rs1318612512 860 dbSNP
rs1361293978 864 dbSNP
rs1382992096 866 dbSNP
rs1297942461 867 dbSNP
rs1389346294 872 dbSNP
rs1339097578 878 dbSNP
rs1028920414 882 dbSNP
rs774012696 883 dbSNP
rs770946002 888 dbSNP
rs1184107831 895 dbSNP
rs1473760891 896 dbSNP
rs1235241946 897 dbSNP
rs996149981 898 dbSNP
rs1266953429 902 dbSNP
rs754662844 917 dbSNP
rs1187925586 919 dbSNP
rs375474258 920 dbSNP
rs1423070616 931 dbSNP
rs917968188 936 dbSNP
rs1188389666 949 dbSNP
rs3813165 952 dbSNP
rs1202612329 972 dbSNP
rs1247669854 973 dbSNP
rs371078072 978 dbSNP
rs1290902125 985 dbSNP
rs1400293886 988 dbSNP
rs984551404 989 dbSNP
rs1294277122 990 dbSNP
rs951919247 998 dbSNP
rs1248795809 1001 dbSNP
rs918913069 1002 dbSNP
rs902370978 1003 dbSNP
rs1046558833 1004 dbSNP
rs949136760 1023 dbSNP
rs894916525 1039 dbSNP
rs1253948484 1044 dbSNP
rs1013050940 1058 dbSNP
rs1482718658 1058 dbSNP
rs935308581 1059 dbSNP
rs958852303 1060 dbSNP
rs1033207872 1061 dbSNP
rs1181388938 1062 dbSNP
rs1408592100 1062 dbSNP
rs1306356040 1087 dbSNP
rs1161371131 1090 dbSNP
rs1429407311 1091 dbSNP
rs1434352066 1096 dbSNP
rs1000266028 1099 dbSNP
rs1377676577 1106 dbSNP
rs903283960 1114 dbSNP
rs779484710 1117 dbSNP
rs1225030973 1135 dbSNP
rs1298579278 1141 dbSNP
rs930973519 1141 dbSNP
rs1234615697 1149 dbSNP
rs998600765 1153 dbSNP
rs1346941578 1156 dbSNP
rs1233451335 1167 dbSNP
rs1481566917 1171 dbSNP
rs192286750 1175 dbSNP
rs1040263603 1177 dbSNP
rs943325151 1179 dbSNP
rs1407004994 1184 dbSNP
rs747956618 1190 dbSNP
rs1397086885 1191 dbSNP
rs973719790 1207 dbSNP
rs1170175379 1209 dbSNP
rs1355423461 1211 dbSNP
rs940836258 1215 dbSNP
rs1444998894 1222 dbSNP
rs1292256392 1225 dbSNP
rs1411465492 1226 dbSNP
rs1369635975 1230 dbSNP
rs1440971930 1232 dbSNP
rs1305227934 1236 dbSNP
rs781322688 1236 dbSNP
rs755201545 1252 dbSNP
rs1339627291 1258 dbSNP
rs1162597169 1266 dbSNP
rs1213833097 1268 dbSNP
rs868440789 1270 dbSNP
rs1273459194 1284 dbSNP
rs186977914 1290 dbSNP
rs867817403 1292 dbSNP
rs1253404551 1296 dbSNP
rs988056452 1319 dbSNP
rs147687619 1337 dbSNP
rs1029035024 1346 dbSNP
rs1194336955 1356 dbSNP
rs758448054 1359 dbSNP
rs1255195463 1374 dbSNP
rs1270030308 1379 dbSNP
rs1447906255 1390 dbSNP
rs750917646 1395 dbSNP
rs1224162685 1413 dbSNP
rs12686878 1418 dbSNP
rs1420713399 1430 dbSNP
rs1411956760 1431 dbSNP
rs1394345297 1441 dbSNP
rs1461567002 1457 dbSNP
rs1289742023 1467 dbSNP
rs184024392 1469 dbSNP
rs1362321661 1470 dbSNP
rs1429594452 1471 dbSNP
rs1270371820 1472 dbSNP
rs1032657776 1483 dbSNP
rs999480022 1484 dbSNP
rs41309551 1486 dbSNP
rs971055058 1508 dbSNP
rs1024786592 1509 dbSNP
rs764405313 1519 dbSNP
rs191107097 1521 dbSNP
rs1275134332 1535 dbSNP
rs1445317774 1536 dbSNP
rs1409437852 1539 dbSNP
rs1242889125 1544 dbSNP
rs894864266 1549 dbSNP
rs139996628 1561 dbSNP
rs1305205234 1571 dbSNP
rs958967486 1573 dbSNP
rs1438270272 1575 dbSNP
rs1347939280 1578 dbSNP
rs1322782146 1581 dbSNP
rs767221147 1604 dbSNP
rs1385842888 1608 dbSNP
rs759284933 1613 dbSNP
rs868310421 1613 dbSNP
rs1156388680 1616 dbSNP
rs1346592364 1617 dbSNP
rs187961161 1617 dbSNP
rs770538787 1621 dbSNP
rs773962238 1621 dbSNP
rs1355782676 1627 dbSNP
rs1235097154 1633 dbSNP
rs762422544 1634 dbSNP
rs1192599233 1635 dbSNP
rs199680569 1637 dbSNP
rs553362160 1637 dbSNP
rs559424437 1637 dbSNP
rs747916137 1637 dbSNP
rs752643571 1637 dbSNP
rs1487681760 1638 dbSNP
rs768826024 1640 dbSNP
rs868546101 1641 dbSNP
rs967453107 1641 dbSNP
rs1486179770 1642 dbSNP
rs866584505 1642 dbSNP
rs1038343444 1648 dbSNP
rs1362543363 1649 dbSNP
rs183716909 1660 dbSNP
rs998262577 1681 dbSNP
rs908136760 1706 dbSNP
rs1051898864 1711 dbSNP
rs1375864086 1719 dbSNP
rs375947514 1735 dbSNP
rs192234356 1736 dbSNP
rs1007416019 1745 dbSNP
rs371561332 1759 dbSNP
rs922019389 1760 dbSNP
rs746004121 1761 dbSNP
rs1352848582 1777 dbSNP
rs958020849 1783 dbSNP
rs1349112772 1784 dbSNP
rs1213462021 1794 dbSNP
rs1303630539 1795 dbSNP
rs1048859584 1800 dbSNP
rs1437772543 1805 dbSNP
rs202211933 1822 dbSNP
rs73486003 1823 dbSNP
rs754207761 1824 dbSNP
rs918973680 1830 dbSNP
rs1395275055 1831 dbSNP
rs1436432219 1843 dbSNP
rs1165930196 1845 dbSNP
rs1431369677 1847 dbSNP
rs1036519343 1855 dbSNP
rs1391902638 1856 dbSNP
rs949809395 1859 dbSNP
rs916899685 1865 dbSNP
rs775867659 1869 dbSNP
rs978516825 1877 dbSNP
rs1348852978 1878 dbSNP
rs764587494 1885 dbSNP
rs1249978712 1887 dbSNP
rs1456210925 1887 dbSNP
rs1339093488 1902 dbSNP
rs1406201499 1905 dbSNP
rs1275690619 1909 dbSNP
rs1466779467 1911 dbSNP
rs756591544 1911 dbSNP
rs1253309025 1930 dbSNP
rs1177763969 1945 dbSNP
rs751236207 1948 dbSNP
rs1013416448 1954 dbSNP
rs959231107 1957 dbSNP
rs1033410125 1962 dbSNP
rs1169628321 1963 dbSNP
rs759688083 1965 dbSNP
rs3073993 1985 dbSNP
rs772021806 1985 dbSNP
rs79127910 1985 dbSNP
rs866134388 1985 dbSNP
rs1388773595 1987 dbSNP
rs1293635563 2004 dbSNP
rs1326257616 2008 dbSNP
rs1272492287 2022 dbSNP
rs1431135206 2022 dbSNP
rs898249922 2028 dbSNP
rs1333325200 2029 dbSNP
rs762454599 2031 dbSNP
rs1213556503 2037 dbSNP
rs1424900970 2048 dbSNP
rs991171166 2062 dbSNP
rs774668784 2069 dbSNP
rs1004287235 2091 dbSNP
rs886658408 2093 dbSNP
rs1052486854 2119 dbSNP
rs771515313 2120 dbSNP
rs1246660482 2129 dbSNP
rs1208689297 2144 dbSNP
rs749582387 2144 dbSNP
rs1428941947 2146 dbSNP
rs922134480 2150 dbSNP
rs1415320498 2155 dbSNP
rs1474842508 2156 dbSNP
rs1165511642 2157 dbSNP
rs1395338603 2159 dbSNP
rs1039193669 2167 dbSNP
rs1459486323 2180 dbSNP
rs936735187 2181 dbSNP
rs547159791 2182 dbSNP
rs1257871579 2208 dbSNP
rs1383180815 2212 dbSNP
rs868670724 2212 dbSNP
rs1280509105 2218 dbSNP
rs978911572 2223 dbSNP
rs978084848 2224 dbSNP
rs967945724 2254 dbSNP
rs188877530 2271 dbSNP
rs1367133165 2283 dbSNP
rs1295248111 2284 dbSNP
rs1236215770 2288 dbSNP
rs1259851914 2300 dbSNP
rs1434344973 2302 dbSNP
rs917838032 2310 dbSNP
rs1020484062 2319 dbSNP
rs149512801 2320 dbSNP
rs965459138 2322 dbSNP
rs1485193475 2325 dbSNP
rs1188632313 2326 dbSNP
rs959180120 2342 dbSNP
rs1033483831 2348 dbSNP
rs1464220545 2354 dbSNP
rs1334336770 2359 dbSNP
rs139195303 2360 dbSNP
rs1018209940 2368 dbSNP
rs962450910 2369 dbSNP
rs1006861499 2372 dbSNP
rs1431976227 2378 dbSNP
rs1414531258 2382 dbSNP
rs1314067003 2384 dbSNP
rs150810894 2402 dbSNP
rs1389236879 2412 dbSNP
rs757797794 2416 dbSNP
rs1305680561 2424 dbSNP
rs1316943671 2451 dbSNP
rs1003881182 2459 dbSNP
rs1241899299 2471 dbSNP
rs1277720431 2492 dbSNP
rs1346930653 2493 dbSNP
rs889004250 2504 dbSNP
rs749999414 2515 dbSNP
rs552037394 2523 dbSNP
rs1176487307 2544 dbSNP
rs1249952881 2546 dbSNP
rs1027987393 2555 dbSNP
rs1160732603 2556 dbSNP
rs775684221 2561 dbSNP
rs994805675 2565 dbSNP
rs1434561738 2580 dbSNP
rs1174643700 2593 dbSNP
rs1361195980 2596 dbSNP
rs1460946383 2597 dbSNP
rs866614639 2602 dbSNP
rs897646877 2613 dbSNP
rs890811231 2639 dbSNP
rs1051956078 2640 dbSNP
rs997697361 2641 dbSNP
rs949758133 2643 dbSNP
rs1180124253 2644 dbSNP
rs1369767282 2654 dbSNP
rs895580980 2654 dbSNP
rs900781970 2659 dbSNP
rs1280483356 2661 dbSNP
rs772189641 2673 dbSNP
rs1305513976 2675 dbSNP
rs1055434195 2693 dbSNP
rs1235403718 2704 dbSNP
rs1039138764 2706 dbSNP
rs1180584278 2709 dbSNP
rs936990582 2717 dbSNP
rs745905085 2718 dbSNP
rs778882055 2729 dbSNP
rs979414113 2736 dbSNP
rs946346343 2741 dbSNP
rs1170408890 2764 dbSNP
rs1272271412 2768 dbSNP
rs1227556160 2769 dbSNP
rs1355618528 2793 dbSNP
rs1466782569 2801 dbSNP
rs1323317938 2802 dbSNP
rs141140207 2803 dbSNP
rs945378138 2812 dbSNP
rs1276205994 2822 dbSNP
rs1393731107 2828 dbSNP
rs1377833868 2840 dbSNP
rs1308214250 2843 dbSNP
rs1411316778 2844 dbSNP
rs1296296761 2857 dbSNP
rs1319896820 2859 dbSNP
rs138545582 2868 dbSNP
rs753670873 2874 dbSNP
rs1168427298 2875 dbSNP
rs778476592 2878 dbSNP
rs756536527 2880 dbSNP
rs937885215 2887 dbSNP
rs1222647932 2902 dbSNP
rs1248639525 2903 dbSNP
rs1370648480 2904 dbSNP
rs1186278906 2914 dbSNP
rs1420590497 2949 dbSNP
rs1163321797 2955 dbSNP
rs1479089566 2961 dbSNP
rs763920948 2963 dbSNP
rs1416561552 2974 dbSNP
rs1018324457 2982 dbSNP
rs753182056 2986 dbSNP
rs1325165698 2990 dbSNP
rs1343069945 2996 dbSNP
rs985388233 3009 dbSNP
rs1289244797 3012 dbSNP
rs527618947 3015 dbSNP
rs1342072948 3037 dbSNP
rs1231401839 3038 dbSNP
rs952821241 3040 dbSNP
rs765996122 3046 dbSNP
rs1228957528 3050 dbSNP
rs1027021659 3051 dbSNP
rs995143374 3059 dbSNP
rs973865973 3060 dbSNP
rs183019435 3068 dbSNP
rs1489449426 3072 dbSNP
rs1014736559 3086 dbSNP
rs1204094638 3094 dbSNP
rs1015326829 3100 dbSNP
rs1014103708 3101 dbSNP
rs982968457 3114 dbSNP
rs895526356 3121 dbSNP
rs955164093 3122 dbSNP
rs1267089355 3124 dbSNP
rs1362274143 3127 dbSNP
rs1055548052 3129 dbSNP
rs1029260843 3142 dbSNP
rs1355992533 3159 dbSNP
rs1320555386 3169 dbSNP
rs996473961 3172 dbSNP
rs1348574755 3176 dbSNP
rs937139962 3180 dbSNP
rs904172617 3188 dbSNP
rs1356343860 3189 dbSNP
rs900731306 3194 dbSNP
rs1257503949 3196 dbSNP
rs1443514005 3201 dbSNP
rs1042754991 3202 dbSNP
rs1288478253 3215 dbSNP
rs1229853502 3216 dbSNP
rs946269037 3219 dbSNP
rs1469161867 3234 dbSNP
rs1178908421 3235 dbSNP
rs913500007 3250 dbSNP
rs1041164103 3251 dbSNP
rs944213689 3259 dbSNP
rs1375760376 3262 dbSNP
rs911429677 3271 dbSNP
rs1017848032 3276 dbSNP
rs1334109823 3286 dbSNP
rs1441531289 3290 dbSNP
rs1310355864 3298 dbSNP
rs952856617 3306 dbSNP
rs1232293661 3310 dbSNP
rs1348171933 3311 dbSNP
rs1307045596 3315 dbSNP
rs1387660307 3325 dbSNP
rs749905189 3326 dbSNP
rs1178698808 3333 dbSNP
rs1292261218 3333 dbSNP
rs1457886053 3337 dbSNP
rs764621043 3341 dbSNP
rs761361085 3350 dbSNP
rs1192571107 3351 dbSNP
rs962236245 3352 dbSNP
rs561320257 3360 dbSNP
rs1014851767 3365 dbSNP
rs1166131421 3370 dbSNP
rs776534166 3375 dbSNP
rs1042460372 3380 dbSNP
rs1465224089 3381 dbSNP
rs1332143370 3389 dbSNP
rs1402468276 3391 dbSNP
rs945422659 3402 dbSNP
rs755973578 3423 dbSNP
rs1034212062 3428 dbSNP
rs190789376 3432 dbSNP
rs1235878488 3438 dbSNP
rs938001485 3448 dbSNP
rs1268990401 3472 dbSNP
rs368563938 3477 dbSNP
rs1043087831 3478 dbSNP
rs1207961147 3480 dbSNP
rs1009915477 3489 dbSNP
rs974011368 3499 dbSNP
rs941191271 3503 dbSNP
rs1190745686 3507 dbSNP
rs1041280029 3515 dbSNP
rs908343975 3517 dbSNP
rs1229641380 3521 dbSNP
rs1172682680 3522 dbSNP
rs752924056 3523 dbSNP
rs1326489132 3526 dbSNP
rs760396355 3531 dbSNP
rs1293224022 3532 dbSNP
rs944327596 3535 dbSNP
rs1388681780 3541 dbSNP
rs1321199567 3556 dbSNP
rs767802160 3557 dbSNP
rs1316682191 3573 dbSNP
rs911378357 3585 dbSNP
rs955263193 3585 dbSNP
rs1340245045 3587 dbSNP
rs1029377674 3595 dbSNP
rs975043260 3605 dbSNP
rs931359960 3614 dbSNP
rs963721772 3618 dbSNP
rs1299715331 3619 dbSNP
rs1265727668 3627 dbSNP
rs1386701064 3635 dbSNP
rs1389934046 3644 dbSNP
rs1202931878 3649 dbSNP
rs775279437 3651 dbSNP
rs1323152517 3656 dbSNP
rs1195822880 3667 dbSNP
rs1255311269 3679 dbSNP
rs1474299494 3691 dbSNP
rs1164189772 3694 dbSNP
rs1017792480 3699 dbSNP
rs920029733 3700 dbSNP
rs41311497 3711 dbSNP
rs1156992501 3713 dbSNP
rs904116235 3717 dbSNP
rs1479154792 3722 dbSNP
rs1021515468 3732 dbSNP
rs1009740113 3749 dbSNP
rs1400957685 3765 dbSNP
rs1300665419 3769 dbSNP
rs973105078 3779 dbSNP
rs1395903143 3814 dbSNP
rs1312819936 3816 dbSNP
rs1322958349 3817 dbSNP
rs961396426 3843 dbSNP
rs1259761967 3844 dbSNP
rs1354201924 3851 dbSNP
rs896537561 3860 dbSNP
rs1391661597 3875 dbSNP
rs1196405270 3882 dbSNP
rs917954866 3905 dbSNP
rs1485306216 3907 dbSNP
rs774527570 3908 dbSNP
rs1256974169 3910 dbSNP
rs1425605446 3912 dbSNP
rs1179972566 3914 dbSNP
rs1002201310 3922 dbSNP
rs1248519566 3931 dbSNP
rs1379916760 3939 dbSNP
rs6629782 3941 dbSNP
rs1420756744 3948 dbSNP
rs905223551 3952 dbSNP
rs1034163038 3953 dbSNP
rs1466007767 3961 dbSNP
rs1210551759 3976 dbSNP
rs746109002 3979 dbSNP
rs1038386440 3983 dbSNP
rs1463137778 3990 dbSNP
rs1380775668 3993 dbSNP
rs1389144643 3995 dbSNP
rs941251548 3996 dbSNP
rs908457939 3999 dbSNP
rs1047304253 4014 dbSNP
rs1241782877 4015 dbSNP
rs1277961235 4016 dbSNP
rs1200665022 4019 dbSNP
rs968841393 4026 dbSNP
rs933863106 4030 dbSNP
rs1257655482 4038 dbSNP
rs1346767276 4041 dbSNP
rs1484314674 4060 dbSNP
rs6629781 4070 dbSNP
rs922355242 4087 dbSNP
rs1237585363 4089 dbSNP
rs1021379080 4094 dbSNP
rs1180705501 4099 dbSNP
rs1393682428 4099 dbSNP
rs1253886880 4101 dbSNP
rs774678442 4114 dbSNP
rs1010440830 4136 dbSNP
rs891455096 4138 dbSNP
rs975158521 4140 dbSNP
rs1330097785 4148 dbSNP
rs1400342461 4151 dbSNP
rs1040716837 4158 dbSNP
rs1300773569 4159 dbSNP
rs766789719 4161 dbSNP
rs1303397800 4162 dbSNP
rs1305711740 4183 dbSNP
rs1217869719 4201 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   || | ||||||| 
Target 5' --------uUUUUUUGCUGCUg 3'
1 - 14
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000328046.8 | 3UTR | UUUUUUUGCUGCUGCCACCAUUGAACAUAAAAUGGAAGUGUGAAGUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.692 3.6e-4 0.803 1.0e-5 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.627 6.8e-4 0.458 1.4e-2 23 Click to see details
GSE21032 Prostate cancer 0.242 1.4e-2 0.143 9.9e-2 83 Click to see details
GSE21687 Ependynoma primary tumors -0.262 1.8e-2 -0.212 4.6e-2 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.398 2.4e-2 0.377 3.2e-2 25 Click to see details
GSE14794 Lymphoblastoid cells 0.186 4.0e-2 0.243 1.1e-2 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.313 6.4e-2 0.228 1.4e-1 25 Click to see details
GSE19536 Breast cancer 0.147 7.2e-2 0.121 1.2e-1 100 Click to see details
GSE32688 Pancreatic cancer -0.251 8.3e-2 0.071 3.5e-1 32 Click to see details
GSE19783 ER- ER- breast cancer 0.14 1.1e-1 0.152 9.1e-2 79 Click to see details
GSE28260 Renal cortex and medulla -0.299 1.6e-1 -0.253 2.0e-1 13 Click to see details
GSE21849 B cell lymphoma 0.186 1.7e-1 0.521 1.9e-3 29 Click to see details
GSE26953 Aortic valvular endothelial cells -0.185 1.9e-1 -0.123 2.8e-1 24 Click to see details
GSE38226 Liver fibrosis 0.196 2.0e-1 0.186 2.1e-1 21 Click to see details
GSE28544 Breast cancer -0.168 2.2e-1 -0.153 2.4e-1 24 Click to see details
GSE27834 Pluripotent stem cells -0.146 2.9e-1 -0.271 1.5e-1 16 Click to see details
GSE19350 CNS germ cell tumors 0.143 3.3e-1 -0.259 2.1e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.046 4.2e-1 -0.092 3.5e-1 20 Click to see details
GSE17306 Multiple myeloma -0.006 4.8e-1 0.026 4.3e-1 49 Click to see details
GSE17306 Multiple myeloma -0.006 4.8e-1 0.026 4.3e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.665 0 -0.645 0 32 Click to see details
BLCA -0.586 0.01 -0.548 0.01 18 Click to see details
LUAD 0.57 0.03 0.629 0.01 12 Click to see details
HNSC -0.294 0.03 -0.381 0.01 42 Click to see details
LUSC 0.306 0.03 0.271 0.05 38 Click to see details
PAAD 0.889 0.06 0.800 0.1 4 Click to see details
CESC -0.965 0.08 -1.000 0.5 3 Click to see details
PRAD 0.162 0.13 0.151 0.15 50 Click to see details
CHOL -0.413 0.13 -0.350 0.18 9 Click to see details
KIRC -0.124 0.16 -0.080 0.26 68 Click to see details
KICH 0.147 0.24 0.153 0.23 25 Click to see details
PCPG -0.399 0.37 -0.500 0.33 3 Click to see details
BRCA -0.034 0.38 -0.039 0.36 84 Click to see details
COAD -0.124 0.38 -0.619 0.05 8 Click to see details
KIRP 0.048 0.4 -0.011 0.48 32 Click to see details
LIHC -0.038 0.4 -0.072 0.31 49 Click to see details
THCA -0.014 0.46 -0.003 0.49 59 Click to see details
UCEC -0.021 0.47 -0.188 0.22 19 Click to see details
ESCA 0.007 0.49 0.236 0.24 11 Click to see details
ESCA 0.007 0.49 0.236 0.24 11 Click to see details
ESCA 0.007 0.49 0.236 0.24 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*