miRTarBase - #MIRT565400 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TGFBR3   
Synonyms BGCAN, betaglycan
Description transforming growth factor beta receptor 3
Transcript NM_003243   
Expression
Putative miRNA Targets on TGFBR3
3'UTR of TGFBR3
(miRNA target sites are highlighted)
>TGFBR3|NM_003243|3'UTR
   1 CCCAACCCAGCCCAACCCGGCCCAACCCAGCCCAGCCCAGCTCAGCTCAGCTACTGCCAAGGGCAGGACCAATGGCTGAG
  81 CCTCGTGTCCAGACTCAGAGGGCTGGATTTTGGTTCCCTTGTAAAGACAGAGTGAATTTCAGTATAAAGATCACCCGTTG
 161 TATTCACCCCACACCCAGGGCTAGTATAAACATGACCCTGGGCTTCTGTACCACACTAGAATTCATGTGAGAAAGCTAAA
 241 ATGGTGGTCTTCTCCACCAGCCCCTCACAGGCTTGGGGGTTTTCAATGTGAAACACATGCCAGTTTTTAAAATGCTGCTT
 321 TGTCCAGGTGAGAACATCCATAATTTGGGGCCCTGAGTTTTACCCAGACTCAAGGAGTTGGTAAAGGGTTAATAGCCAGA
 401 TAGTAGAACCAGTGAGGAGATGCGGCCAAAGATTCTTTATATCTGAACCAAGATGTAAAACAAGAAATGCTTTGAGGCTT
 481 TCTAAGCGATCCTCCTGTCTAATTTGCACCTTTGTCTGGATGCACACTTCTGACCTTGCTGCCACAACCTGTGGGGTCTG
 561 ATGTGTCCCTTGATGGGTGCTGCCCTCAGGGACTGCACCCTGACAAGTGTTAAGGCAACATTCCTTTCTTGTGCCCTGGG
 641 CCAAAACCAATGCTGATGACCTTATCAGCTTCCTGTTTCTTCCCATACTTGCATACACCACTGCAAAATGTCTTAATGCA
 721 AATTTTGTATTTCTTACAGGCCTACAGAAATTGAAAATGACCAAAATCAGGAACCACAGATTTGTGCCCATTCCTAATAT
 801 TTTGTTCTGCAAATTAATGTATAATTTGAGGTGAAATTCAGTTATAAAGTCAAGGACGAATTTGCACAGTGATATATTTC
 881 TATGTGTATGCAAGTACAAGTATATAATATGTCACCTGGCACATTCATTTTCTCAGTTGAAGAAGAGAAAATTTGAAAAT
 961 GTCCTTATGCTTTTAGAGTTGCAACTTAAGTATATTTGGTAGGGTGAGTGTTTCCACTCAAAATATGTCAACTTAAAAAA
1041 AAATAGGCCCTTTCATAAAAACCAAACTGTAGCAAGATGCAAATGCATGGCAAATCCTGTCGGTCTCCAGTTGGTTATCT
1121 GAATAGTGTCACCAATTCCACCAAGACAGTGCTGAGATTGGAAAAGGGCACTCATTTGGATTGCCTTACTTCTCTTGCCT
1201 TAAATATATCCCATATATTTAATATGTCAAAAAGGGCTTGAGGTGAATTTCATTAAATGGAATAATATGATGCCACTTTG
1281 CAGCTAAAATAAGCTCAGTGATACCTCCTTGTTAAAAAAAAAAAAAAAAAAAAAGAATGCCAGGGGGGAATTATCATGCT
1361 AAATTATTTTACTGCTGAAGATAGCTTCATTGCAAATTATTCTTTTTCCAGAATTTCCCCCAAACAACTTAGAATTCCAT
1441 AAGTAGAACAAGATAGATTCTACCCCCAAAATATTCATAAGCAAATCCCACTGCCCTTAAAATAAGGAAGTTATGCCTGG
1521 TTGTCTGTGAATGGAACCTCAGTAGGTAATCCTGATGAAGCTTAAAACCTTAGGGCAGTGTCTACATGGGAAACAAGTAT
1601 GTGGAAATTGACAATCATTTTTACCAAATCGTTGAGTAATAATATGACTTACCTGATAGATATACACATTCAATAAGGAA
1681 CATTTTTTTTTTTCAATAAGGAACATTTTAACTAAAACATTACTTTAGGGCTGAGATTTCCAGGCTATCTACATTGATCT
1761 ACTGAAAAATTTCTAGATTTCCATATACAAACGAAGAAGACATGAGTTTAGAGAATTTTTTTCCTTTAATTTTTTTTTAA
1841 CAGAAGGGTATCAGAGTGGAGGACCTAGATTACGCTACCTGTGTTTGAAAATATTGCGCTTTGCCTAACCTTCGGTGGAA
1921 TGTATTGTTTCAGCATATTCTATGTATAAAAAAGTTTAAAGATGTCTTCAAAGAAGACTAGAGTCTTTAAGTCACTTATA
2001 GCTATATTTTACTACAAAATTTGTGTATAAAGATATATTTAAGTGTTTTAGATAAATTTAAGTTACTCCATATGAAATGT
2081 TTAATTTCAGCTACTGTGAATTCTTTCGATCAGTCCTTTGCTTTTTTAAAAAATCTTTTCCATCGTGTTAAAAAGAAAAT
2161 TAGCTATTAGGAGATATTAAAAGATTGATGTCTTAGAAGGACAGGGTTAAAACCTTCTGTAATATATTTAAATATATATT
2241 TTTAAGAGAGATGCTACATTGCCAATGATTTTATAAATAATTTAAAATTAATTTACAAATTTATAGATGCAAACCAAAAG
2321 ATCTTTTTAAAAGAGAGAGAGAGGAAAAAAATCACCTTTTATTTGTTTGGGTCTCATTGTCAGAATTATTATTCAGATCA
2401 AGAAATCTGTGTCGATAAAACCTAATCTCATATTGGAGAGTGAATGTCGTTAAGTATTTCTGAAATGTTTCTAAAAAATG
2481 AACATGAAAAAAATAAGGTATTTTCTCCCTAGCTTCTCATTACAGTATTTCTAATTGCTTCACACTTTACAGTTTTAATA
2561 CAAAGTACAAGCTCTACTTTTATAACGTGTACTACAAGTTTCTTTAAAAGTATTGTTGTATTTCAGCTGAACTCTTGTAT
2641 CTGCAGTCTTTTGTTATTTCTGCAGGCTACACCCTTAATTTGCAGAGGCCATTTTGTTGTTTGTTTGATGCTGAAGCTGT
2721 TGTTAAAATGCCCCAAACTCCAAGGCAGATTGTCTGTATAATACGCTATAGCTTTTCACCATGTGGTGTTTACCAGCTGT
2801 TACTCTGTATTTTAAAAAGCCAGAGATTTCTTCTGTCTAAACTGTTTCTATAGCATTTTCTAAACAAAAAAAATGGTTTT
2881 TTTCTTTGCCTTGTAATAAGATTGTAAATCCATTTCCTGCTTGTGTTCTTAGTGGGCATGATTGTGAGTGTGTGTGGGGT
2961 GCTCACACGCGTGCCAGTCTTTTTGTACTGTAACTACCTCATGGTTTGAATGATGATTGTACTGCTGGTTGTGTTAACAG
3041 AGCACATTTTGTTGGGTGAGTCCTATGTGATTTTTTTCATGTTTGTTTTATCTGGGGGTTGTTCATGAAACTGACAGATG
3121 TTTTTCTAAAAAGGACTATTATCAGTTTCCAAATACAATACTTCTCTCTTCTGGTTTTTCCTGAATGAGCCTGATTTTGT
3201 TGCTGGTTTTCATCATCTATGAGGGTAAAACGAGTACCCTTAAAATCCCTGTGGCCAGTTTGAACACCCCTGTTGTATTC
3281 TTTTCTCTGTTCAGTGTGTCAGCTATTTTGTGAAGATGCTTAGATGTATAGTTTTGATAACCACAGTTTTAAATCTTTTA
3361 TCTGTGCATAATAAAAAGATATATATCAGTTATTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU----AA-UACACGACGAu 5'
            || :|||    || |  ||||||| 
Target 5' caCATGCCAGTTTTTAAAATGCTGCTt 3'
294 - 320 150.00 -14.66
2
miRNA  3' guGUUUGG--UAAUACACGACGAu 5'
            ::|:||  ||| | ||:|||| 
Target 5' aaTGAGCCTGATT-T-TGTTGCTg 3'
3184 - 3205 136.00 -11.90
3
miRNA  3' guguuuGGUAAUA--CACGACGau 5'
                || | ||  |||||||  
Target 5' tgtgtcCCTTGATGGGTGCTGCcc 3'
562 - 585 134.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31526311 18 COSMIC
COSN30163684 21 COSMIC
COSN30135965 37 COSMIC
COSN31541833 42 COSMIC
COSN1463407 105 COSMIC
COSN23764580 144 COSMIC
COSN26557220 258 COSMIC
COSN31536325 259 COSMIC
COSN31577325 270 COSMIC
COSN31513060 424 COSMIC
COSN31541763 425 COSMIC
COSN31479838 474 COSMIC
COSN31595602 551 COSMIC
COSN30003012 567 COSMIC
COSN8521326 580 COSMIC
COSN31556105 710 COSMIC
COSN24886198 955 COSMIC
COSN29034372 1034 COSMIC
COSN1463406 1263 COSMIC
COSN17429273 1311 COSMIC
COSN29513495 1368 COSMIC
COSN5745360 1631 COSMIC
COSN28971011 1682 COSMIC
COSN26714224 1913 COSMIC
COSN21589230 2141 COSMIC
COSN21235486 2321 COSMIC
COSN27144824 2865 COSMIC
COSN28253075 3071 COSMIC
COSN29878468 3193 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1312480141 8 dbSNP
rs202191737 9 dbSNP
rs375168931 15 dbSNP
rs371085991 17 dbSNP
rs542197544 18 dbSNP
rs1131243 19 dbSNP
rs777459811 19 dbSNP
rs562004206 20 dbSNP
rs774746910 21 dbSNP
rs1000838892 23 dbSNP
rs1465013405 24 dbSNP
rs768750878 25 dbSNP
rs1427302997 26 dbSNP
rs749386034 27 dbSNP
rs1298050370 29 dbSNP
rs769235100 29 dbSNP
rs1480903440 30 dbSNP
rs1251509916 32 dbSNP
rs1175899984 34 dbSNP
rs758963836 35 dbSNP
rs767580175 35 dbSNP
rs780383881 35 dbSNP
rs1481899606 39 dbSNP
rs750939024 39 dbSNP
rs781184201 39 dbSNP
rs1420703234 40 dbSNP
rs540918983 40 dbSNP
rs902596823 41 dbSNP
rs757760206 42 dbSNP
rs746960035 43 dbSNP
rs777492809 44 dbSNP
rs758217785 50 dbSNP
rs754058860 53 dbSNP
rs1309878191 55 dbSNP
rs752312414 56 dbSNP
rs1223707398 58 dbSNP
rs754474478 71 dbSNP
rs751156484 72 dbSNP
rs576526609 75 dbSNP
rs573184725 77 dbSNP
rs895636610 78 dbSNP
rs780119636 81 dbSNP
rs937276095 84 dbSNP
rs765920731 85 dbSNP
rs1403947506 86 dbSNP
rs1036694652 90 dbSNP
rs940987648 94 dbSNP
rs1262393159 97 dbSNP
rs1411582080 103 dbSNP
rs1281566629 116 dbSNP
rs1157368132 119 dbSNP
rs1048543317 123 dbSNP
rs564491881 126 dbSNP
rs199503452 136 dbSNP
rs761208990 147 dbSNP
rs1181741503 151 dbSNP
rs1460397732 154 dbSNP
rs1805115 157 dbSNP
rs767955261 171 dbSNP
rs1328038605 174 dbSNP
rs1258510012 178 dbSNP
rs1289278545 179 dbSNP
rs1184791581 180 dbSNP
rs574788524 183 dbSNP
rs575782942 184 dbSNP
rs1240760818 185 dbSNP
rs1317240649 192 dbSNP
rs1311777904 194 dbSNP
rs1394183892 197 dbSNP
rs1805116 200 dbSNP
rs1406159552 205 dbSNP
rs1338769702 207 dbSNP
rs765016060 208 dbSNP
rs534907849 213 dbSNP
rs1156990479 214 dbSNP
rs1402814968 215 dbSNP
rs1455563476 218 dbSNP
rs1364701516 224 dbSNP
rs1224613967 239 dbSNP
rs1277241289 242 dbSNP
rs1357917139 243 dbSNP
rs1164568067 249 dbSNP
rs774611037 252 dbSNP
rs927443369 253 dbSNP
rs375927498 255 dbSNP
rs1387703462 257 dbSNP
rs1253026088 258 dbSNP
rs182999308 260 dbSNP
rs971472508 261 dbSNP
rs1239282464 262 dbSNP
rs1464000091 264 dbSNP
rs1259081813 267 dbSNP
rs763239975 270 dbSNP
rs1473129089 277 dbSNP
rs1486012381 279 dbSNP
rs1050619 285 dbSNP
rs985564756 288 dbSNP
rs865790178 290 dbSNP
rs1183078933 294 dbSNP
rs1383572391 296 dbSNP
rs1170218759 297 dbSNP
rs565585559 297 dbSNP
rs573873791 298 dbSNP
rs556859031 302 dbSNP
rs954449737 303 dbSNP
rs769937561 306 dbSNP
rs1315566711 313 dbSNP
rs1227596232 318 dbSNP
rs1364490675 319 dbSNP
rs1316356845 322 dbSNP
rs1384108192 332 dbSNP
rs1326845411 340 dbSNP
rs1386018978 345 dbSNP
rs1293298130 349 dbSNP
rs555742735 351 dbSNP
rs979878221 357 dbSNP
rs1164720340 363 dbSNP
rs966727059 365 dbSNP
rs1301652907 367 dbSNP
rs1370810243 368 dbSNP
rs1194758047 373 dbSNP
rs1230208051 375 dbSNP
rs1428735299 378 dbSNP
rs1266317661 387 dbSNP
rs1219804243 395 dbSNP
rs1339215532 396 dbSNP
rs764740196 401 dbSNP
rs1292260546 404 dbSNP
rs1443525232 404 dbSNP
rs1006781143 406 dbSNP
rs1189515455 407 dbSNP
rs1337416951 408 dbSNP
rs1373423936 409 dbSNP
rs749899080 410 dbSNP
rs1013660300 416 dbSNP
rs1165949974 418 dbSNP
rs960758763 423 dbSNP
rs761525685 424 dbSNP
rs1327105314 425 dbSNP
rs192924147 426 dbSNP
rs764253029 432 dbSNP
rs1422948211 434 dbSNP
rs778627082 439 dbSNP
rs1403326633 444 dbSNP
rs1347728785 445 dbSNP
rs1304173641 450 dbSNP
rs1429647320 452 dbSNP
rs566376747 454 dbSNP
rs1805117 457 dbSNP
rs1461993595 461 dbSNP
rs539179739 466 dbSNP
rs1196776895 468 dbSNP
rs138858788 470 dbSNP
rs1197896898 471 dbSNP
rs1269297802 474 dbSNP
rs1225637613 477 dbSNP
rs1181250327 478 dbSNP
rs896901893 479 dbSNP
rs1436001505 482 dbSNP
rs41313401 487 dbSNP
rs768188215 488 dbSNP
rs1291591611 492 dbSNP
rs762263808 494 dbSNP
rs1466360462 499 dbSNP
rs550771540 500 dbSNP
rs1193664231 501 dbSNP
rs529485848 503 dbSNP
rs1221880373 508 dbSNP
rs751804044 514 dbSNP
rs1258106554 515 dbSNP
rs941020330 516 dbSNP
rs1442021984 520 dbSNP
rs1334359977 522 dbSNP
rs909524269 523 dbSNP
rs1480708600 525 dbSNP
rs1050620 526 dbSNP
rs1392502673 537 dbSNP
rs1400827947 541 dbSNP
rs561926024 542 dbSNP
rs1458306821 553 dbSNP
rs1288964346 557 dbSNP
rs772550023 560 dbSNP
rs1429631596 563 dbSNP
rs1157962437 566 dbSNP
rs764530840 567 dbSNP
rs1234413458 568 dbSNP
rs912279397 569 dbSNP
rs1050621 570 dbSNP
rs1050623 571 dbSNP
rs763034502 573 dbSNP
rs547012723 577 dbSNP
rs932830931 583 dbSNP
rs1346605961 584 dbSNP
rs775809577 587 dbSNP
rs764419888 589 dbSNP
rs145038062 596 dbSNP
rs564347164 598 dbSNP
rs1223444813 604 dbSNP
rs1348925385 606 dbSNP
rs1239796504 624 dbSNP
rs1050624 627 dbSNP
rs1260250186 628 dbSNP
rs950217198 644 dbSNP
rs966722021 645 dbSNP
rs570933377 650 dbSNP
rs1454051498 653 dbSNP
rs1270759823 656 dbSNP
rs1406187513 664 dbSNP
rs1317132797 666 dbSNP
rs1398623141 668 dbSNP
rs992132366 674 dbSNP
rs1409848601 675 dbSNP
rs1158980146 679 dbSNP
rs1198439554 684 dbSNP
rs1266625168 685 dbSNP
rs960791387 692 dbSNP
rs1472418837 694 dbSNP
rs1473550295 698 dbSNP
rs1159159629 704 dbSNP
rs773116819 710 dbSNP
rs1033725764 711 dbSNP
rs1001813427 715 dbSNP
rs1467176628 724 dbSNP
rs772068416 727 dbSNP
rs186509687 729 dbSNP
rs985375547 732 dbSNP
rs182258756 733 dbSNP
rs1215283010 737 dbSNP
rs1445539304 740 dbSNP
rs1029950115 768 dbSNP
rs998012817 772 dbSNP
rs1224747566 775 dbSNP
rs1359349511 777 dbSNP
rs1313478384 779 dbSNP
rs563815973 780 dbSNP
rs1247093075 783 dbSNP
rs374704929 790 dbSNP
rs1292703045 792 dbSNP
rs1248825782 794 dbSNP
rs1382831733 798 dbSNP
rs773962728 809 dbSNP
rs1428187981 810 dbSNP
rs1359024076 816 dbSNP
rs1346655181 817 dbSNP
rs542342250 819 dbSNP
rs1179271138 828 dbSNP
rs1221411965 834 dbSNP
rs1423686459 835 dbSNP
rs897048176 842 dbSNP
rs1363501966 845 dbSNP
rs760097803 846 dbSNP
rs1238316838 849 dbSNP
rs1165340344 851 dbSNP
rs896928381 855 dbSNP
rs573907130 857 dbSNP
rs555519876 858 dbSNP
rs1186057664 863 dbSNP
rs1474543567 864 dbSNP
rs1416722027 866 dbSNP
rs1244125141 867 dbSNP
rs1216784012 869 dbSNP
rs1277137357 869 dbSNP
rs190787610 876 dbSNP
rs1423637541 877 dbSNP
rs374069443 882 dbSNP
rs1162022314 889 dbSNP
rs1372846625 895 dbSNP
rs890912642 899 dbSNP
rs1049481220 900 dbSNP
rs771282350 907 dbSNP
rs932840587 910 dbSNP
rs1360852154 923 dbSNP
rs755664359 925 dbSNP
rs1298172355 926 dbSNP
rs1371830768 934 dbSNP
rs904000217 935 dbSNP
rs1212358015 949 dbSNP
rs186173500 961 dbSNP
rs1270356189 965 dbSNP
rs1244122755 968 dbSNP
rs780853579 974 dbSNP
rs1276946361 981 dbSNP
rs1309111584 982 dbSNP
rs1343371282 991 dbSNP
rs1204966320 992 dbSNP
rs1304775127 994 dbSNP
rs557470398 999 dbSNP
rs1353925152 1004 dbSNP
rs1169827015 1006 dbSNP
rs149171541 1008 dbSNP
rs1376427600 1011 dbSNP
rs1421763281 1016 dbSNP
rs568502404 1019 dbSNP
rs1194601788 1020 dbSNP
rs1480254105 1031 dbSNP
rs1449104416 1032 dbSNP
rs1357447163 1033 dbSNP
rs1333459775 1034 dbSNP
rs1414939013 1037 dbSNP
rs760799851 1044 dbSNP
rs1427063991 1045 dbSNP
rs145149335 1045 dbSNP
rs992164901 1047 dbSNP
rs780868960 1052 dbSNP
rs1202117828 1055 dbSNP
rs990 1060 dbSNP
rs1490654558 1065 dbSNP
rs768112880 1067 dbSNP
rs1251180166 1068 dbSNP
rs902 1069 dbSNP
rs1380535960 1070 dbSNP
rs746505769 1073 dbSNP
rs1273137391 1080 dbSNP
rs568332656 1089 dbSNP
rs1405517532 1096 dbSNP
rs1321034276 1101 dbSNP
rs752837120 1102 dbSNP
rs1405403782 1105 dbSNP
rs926735036 1109 dbSNP
rs1372357299 1110 dbSNP
rs1296326704 1120 dbSNP
rs1444325874 1121 dbSNP
rs149986478 1123 dbSNP
rs1459608945 1125 dbSNP
rs1356321411 1133 dbSNP
rs1171533062 1138 dbSNP
rs1469468558 1142 dbSNP
rs1427542028 1143 dbSNP
rs140877088 1144 dbSNP
rs1434066607 1145 dbSNP
rs765497918 1146 dbSNP
rs1175951165 1148 dbSNP
rs970319607 1150 dbSNP
rs1238230906 1155 dbSNP
rs1202553852 1158 dbSNP
rs1459699115 1160 dbSNP
rs1264545563 1169 dbSNP
rs1026831860 1170 dbSNP
rs913361987 1171 dbSNP
rs759611426 1173 dbSNP
rs1243442735 1175 dbSNP
rs1316072972 1181 dbSNP
rs528786379 1182 dbSNP
rs1304645643 1189 dbSNP
rs973842190 1206 dbSNP
rs776629862 1209 dbSNP
rs988911167 1210 dbSNP
rs961279435 1213 dbSNP
rs779777966 1226 dbSNP
rs1186262763 1237 dbSNP
rs564763331 1238 dbSNP
rs936029681 1239 dbSNP
rs147653232 1246 dbSNP
rs1332121428 1247 dbSNP
rs1451918373 1250 dbSNP
rs1404018131 1257 dbSNP
rs1177877988 1258 dbSNP
rs766463714 1260 dbSNP
rs1466774093 1266 dbSNP
rs1363553594 1268 dbSNP
rs1015462425 1272 dbSNP
rs1157441911 1276 dbSNP
rs1804506 1283 dbSNP
rs925950489 1284 dbSNP
rs1320391312 1285 dbSNP
rs1345968465 1286 dbSNP
rs1353363607 1290 dbSNP
rs1381550881 1293 dbSNP
rs774378714 1296 dbSNP
rs563648018 1301 dbSNP
rs985449139 1303 dbSNP
rs890776311 1304 dbSNP
rs887401863 1306 dbSNP
rs954124488 1307 dbSNP
rs1242527241 1309 dbSNP
rs34978889 1309 dbSNP
rs1221113641 1311 dbSNP
rs768305985 1311 dbSNP
rs749158044 1313 dbSNP
rs368181429 1314 dbSNP
rs59188054 1314 dbSNP
rs1479758126 1320 dbSNP
rs1160339731 1324 dbSNP
rs1448741588 1328 dbSNP
rs1028512535 1329 dbSNP
rs1200641341 1329 dbSNP
rs1360821473 1330 dbSNP
rs769504166 1330 dbSNP
rs762750274 1331 dbSNP
rs76721579 1331 dbSNP
rs1418883334 1332 dbSNP
rs1485366963 1333 dbSNP
rs1491444980 1334 dbSNP
rs1029568541 1335 dbSNP
rs1280775002 1335 dbSNP
rs1303568719 1335 dbSNP
rs1344770090 1335 dbSNP
rs1352834970 1335 dbSNP
rs1434279565 1335 dbSNP
rs200216410 1335 dbSNP
rs746377582 1335 dbSNP
rs768087199 1335 dbSNP
rs780727991 1335 dbSNP
rs779579345 1336 dbSNP
rs1217761774 1337 dbSNP
rs977048629 1337 dbSNP
rs757633551 1338 dbSNP
rs996625270 1342 dbSNP
rs17883810 1343 dbSNP
rs1314220880 1344 dbSNP
rs1005267026 1346 dbSNP
rs903574510 1347 dbSNP
rs1364797478 1348 dbSNP
rs888189952 1349 dbSNP
rs1043910228 1350 dbSNP
rs1380625220 1352 dbSNP
rs1317303612 1355 dbSNP
rs1396807108 1356 dbSNP
rs1442361731 1361 dbSNP
rs745527810 1371 dbSNP
rs72714407 1375 dbSNP
rs28394336 1380 dbSNP
rs1056723569 1381 dbSNP
rs1361591685 1383 dbSNP
rs530180883 1387 dbSNP
rs1443365560 1389 dbSNP
rs778737112 1398 dbSNP
rs926626793 1402 dbSNP
rs1427548059 1406 dbSNP
rs1040121924 1411 dbSNP
rs1187915640 1421 dbSNP
rs184187810 1428 dbSNP
rs28698523 1432 dbSNP
rs111695686 1436 dbSNP
rs1488183596 1449 dbSNP
rs891963323 1450 dbSNP
rs1220118608 1462 dbSNP
rs920636840 1463 dbSNP
rs778390099 1465 dbSNP
rs1245702092 1479 dbSNP
rs540375214 1494 dbSNP
rs936103253 1499 dbSNP
rs758672781 1502 dbSNP
rs1293632070 1503 dbSNP
rs1384161959 1505 dbSNP
rs973915904 1506 dbSNP
rs1287148281 1510 dbSNP
rs1383626037 1513 dbSNP
rs753168518 1514 dbSNP
rs1302971537 1515 dbSNP
rs1320127908 1521 dbSNP
rs573063340 1522 dbSNP
rs1368077245 1523 dbSNP
rs1312182016 1524 dbSNP
rs1164345941 1525 dbSNP
rs1460991935 1526 dbSNP
rs1370865905 1528 dbSNP
rs1194827047 1538 dbSNP
rs765594185 1544 dbSNP
rs1228966971 1546 dbSNP
rs1452907697 1549 dbSNP
rs755139754 1551 dbSNP
rs926009658 1555 dbSNP
rs1381357165 1556 dbSNP
rs558071969 1556 dbSNP
rs766408784 1558 dbSNP
rs1490819634 1560 dbSNP
rs1267896056 1562 dbSNP
rs1195174710 1568 dbSNP
rs1338776422 1569 dbSNP
rs1249727539 1571 dbSNP
rs760851199 1574 dbSNP
rs1271180037 1575 dbSNP
rs1318937553 1578 dbSNP
rs1283032647 1581 dbSNP
rs1015491811 1582 dbSNP
rs1339279636 1584 dbSNP
rs75861863 1586 dbSNP
rs1333203392 1588 dbSNP
rs191543210 1597 dbSNP
rs1461775133 1612 dbSNP
rs556505387 1613 dbSNP
rs1391353789 1614 dbSNP
rs1203130363 1623 dbSNP
rs1241475180 1623 dbSNP
rs762651450 1630 dbSNP
rs922574615 1631 dbSNP
rs1465807392 1633 dbSNP
rs1028004611 1634 dbSNP
rs996883803 1635 dbSNP
rs775366817 1638 dbSNP
rs1173822891 1643 dbSNP
rs1481263893 1644 dbSNP
rs1475034345 1645 dbSNP
rs1378014897 1648 dbSNP
rs976700065 1652 dbSNP
rs1436055293 1654 dbSNP
rs1248487212 1656 dbSNP
rs961555556 1661 dbSNP
rs375232472 1663 dbSNP
rs903607114 1665 dbSNP
rs370676839 1668 dbSNP
rs1262681746 1673 dbSNP
rs1319375520 1677 dbSNP
rs1221934483 1679 dbSNP
rs1022463466 1682 dbSNP
rs952487089 1684 dbSNP
rs1324913503 1685 dbSNP
rs1222944153 1688 dbSNP
rs1033375502 1692 dbSNP
rs1275851712 1693 dbSNP
rs756338808 1694 dbSNP
rs778095946 1694 dbSNP
rs759221609 1696 dbSNP
rs1334572696 1698 dbSNP
rs756382683 1701 dbSNP
rs368850678 1702 dbSNP
rs1056757523 1703 dbSNP
rs1404742867 1719 dbSNP
rs1265096375 1727 dbSNP
rs1334234834 1728 dbSNP
rs139697752 1734 dbSNP
rs905409365 1736 dbSNP
rs1406603431 1746 dbSNP
rs1000353943 1747 dbSNP
rs1468528468 1751 dbSNP
rs770321440 1753 dbSNP
rs1179191816 1756 dbSNP
rs1440340062 1758 dbSNP
rs746584073 1763 dbSNP
rs904665364 1765 dbSNP
rs1201973764 1773 dbSNP
rs1049859859 1783 dbSNP
rs932688980 1786 dbSNP
rs1279768967 1788 dbSNP
rs1204984522 1792 dbSNP
rs922635899 1793 dbSNP
rs74923072 1801 dbSNP
rs1312027924 1802 dbSNP
rs1045073763 1806 dbSNP
rs778134022 1813 dbSNP
rs1381356011 1823 dbSNP
rs752764596 1826 dbSNP
rs75692888 1828 dbSNP
rs74896573 1830 dbSNP
rs1384868635 1831 dbSNP
rs201044103 1839 dbSNP
rs752904515 1839 dbSNP
rs1190611661 1847 dbSNP
rs1265191117 1852 dbSNP
rs1293780173 1856 dbSNP
rs1036389795 1860 dbSNP
rs1181935422 1861 dbSNP
rs1359445220 1864 dbSNP
rs939878076 1868 dbSNP
rs1317197557 1873 dbSNP
rs908401123 1874 dbSNP
rs908447240 1877 dbSNP
rs553301669 1879 dbSNP
rs1398797516 1881 dbSNP
rs1362197677 1882 dbSNP
rs1159222597 1894 dbSNP
rs1423884307 1896 dbSNP
rs1384711156 1897 dbSNP
rs1181769051 1903 dbSNP
rs986565888 1907 dbSNP
rs955327756 1909 dbSNP
rs376306385 1913 dbSNP
rs1192725833 1914 dbSNP
rs975147355 1915 dbSNP
rs1288557684 1917 dbSNP
rs1424974818 1918 dbSNP
rs952560102 1921 dbSNP
rs1359282126 1927 dbSNP
rs968112857 1928 dbSNP
rs1248518842 1937 dbSNP
rs1316886071 1947 dbSNP
rs1288970398 1954 dbSNP
rs1022083307 1962 dbSNP
rs772559613 1964 dbSNP
rs1269284631 1977 dbSNP
rs111911073 1978 dbSNP
rs956421223 1979 dbSNP
rs1428180601 1981 dbSNP
rs186980840 1989 dbSNP
rs554390769 1990 dbSNP
rs1404272096 1991 dbSNP
rs552935952 1994 dbSNP
rs905482451 1999 dbSNP
rs1024675733 2004 dbSNP
rs767531327 2007 dbSNP
rs1009642832 2016 dbSNP
rs1414595527 2023 dbSNP
rs1167596537 2025 dbSNP
rs1476939491 2026 dbSNP
rs796264375 2032 dbSNP
rs1375244089 2057 dbSNP
rs1045716858 2062 dbSNP
rs1462980803 2062 dbSNP
rs767630579 2065 dbSNP
rs1490288553 2071 dbSNP
rs1267455343 2072 dbSNP
rs1224402759 2080 dbSNP
rs1031943670 2106 dbSNP
rs1321840184 2107 dbSNP
rs779202869 2108 dbSNP
rs994874540 2111 dbSNP
rs755370800 2112 dbSNP
rs899140859 2122 dbSNP
rs1036295833 2128 dbSNP
rs1278613589 2135 dbSNP
rs371215513 2144 dbSNP
rs538787765 2145 dbSNP
rs1295269424 2151 dbSNP
rs1456021541 2154 dbSNP
rs1243318763 2155 dbSNP
rs1437067086 2155 dbSNP
rs1482740971 2158 dbSNP
rs911944835 2159 dbSNP
rs1050889249 2161 dbSNP
rs1180447740 2165 dbSNP
rs534412268 2175 dbSNP
rs1464271282 2177 dbSNP
rs1220650299 2188 dbSNP
rs1479451407 2190 dbSNP
rs921227296 2196 dbSNP
rs1000427685 2197 dbSNP
rs1422126917 2198 dbSNP
rs1171639813 2199 dbSNP
rs1480344037 2203 dbSNP
rs1446901667 2208 dbSNP
rs1423468319 2211 dbSNP
rs1470969587 2213 dbSNP
rs1193459853 2225 dbSNP
rs780305406 2226 dbSNP
rs975722763 2228 dbSNP
rs967763925 2229 dbSNP
rs1231828755 2235 dbSNP
rs1177287881 2249 dbSNP
rs756134998 2251 dbSNP
rs750584816 2252 dbSNP
rs377444926 2261 dbSNP
rs1258369145 2265 dbSNP
rs1222498094 2267 dbSNP
rs1446158135 2273 dbSNP
rs914930449 2277 dbSNP
rs1401780311 2281 dbSNP
rs1363888400 2283 dbSNP
rs1382573326 2296 dbSNP
rs1300453132 2304 dbSNP
rs1321203076 2313 dbSNP
rs1303082400 2314 dbSNP
rs1316010646 2317 dbSNP
rs373115808 2321 dbSNP
rs1219759024 2322 dbSNP
rs1311228741 2328 dbSNP
rs987777752 2330 dbSNP
rs1372451962 2337 dbSNP
rs1279034089 2340 dbSNP
rs1486365352 2344 dbSNP
rs751440711 2344 dbSNP
rs755707185 2344 dbSNP
rs376113740 2345 dbSNP
rs996975677 2345 dbSNP
rs181125491 2348 dbSNP
rs1332348921 2350 dbSNP
rs1469450230 2352 dbSNP
rs940001915 2352 dbSNP
rs887080850 2354 dbSNP
rs759637948 2356 dbSNP
rs1003748491 2357 dbSNP
rs1297386044 2364 dbSNP
rs1407978253 2365 dbSNP
rs1177298923 2370 dbSNP
rs1441052490 2371 dbSNP
rs1406747466 2372 dbSNP
rs762898642 2373 dbSNP
rs931191679 2375 dbSNP
rs6669888 2379 dbSNP
rs1023911330 2381 dbSNP
rs766308427 2385 dbSNP
rs1317175187 2386 dbSNP
rs1256436119 2399 dbSNP
rs17571088 2406 dbSNP
rs1304851559 2411 dbSNP
rs763355562 2413 dbSNP
rs917639230 2414 dbSNP
rs773508844 2416 dbSNP
rs1452211186 2424 dbSNP
rs1377166904 2425 dbSNP
rs1004801942 2426 dbSNP
rs1223967893 2430 dbSNP
rs759450328 2436 dbSNP
rs1466927950 2440 dbSNP
rs1246648474 2445 dbSNP
rs545353127 2446 dbSNP
rs746593487 2448 dbSNP
rs776406969 2449 dbSNP
rs147408871 2453 dbSNP
rs1182376769 2454 dbSNP
rs1051792537 2456 dbSNP
rs1257915378 2460 dbSNP
rs1157806418 2466 dbSNP
rs1358453096 2470 dbSNP
rs775295275 2478 dbSNP
rs899646256 2479 dbSNP
rs1283572499 2480 dbSNP
rs748205328 2483 dbSNP
rs1354257980 2484 dbSNP
rs1286835196 2485 dbSNP
rs1245425213 2486 dbSNP
rs1319987628 2487 dbSNP
rs745400222 2492 dbSNP
rs1349247386 2493 dbSNP
rs1315164511 2494 dbSNP
rs1280821533 2495 dbSNP
rs1396793011 2499 dbSNP
rs1377151299 2507 dbSNP
rs1361735670 2509 dbSNP
rs1296681772 2513 dbSNP
rs1436989660 2514 dbSNP
rs1358973700 2519 dbSNP
rs1239049448 2521 dbSNP
rs968954409 2523 dbSNP
rs946639945 2527 dbSNP
rs1361950815 2533 dbSNP
rs915120549 2548 dbSNP
rs1223712185 2552 dbSNP
rs1361653988 2553 dbSNP
rs1163496540 2562 dbSNP
rs531865952 2566 dbSNP
rs373652155 2572 dbSNP
rs1455980052 2575 dbSNP
rs188735272 2577 dbSNP
rs1165081166 2578 dbSNP
rs1233574319 2581 dbSNP
rs1365664015 2583 dbSNP
rs541156474 2585 dbSNP
rs528335137 2586 dbSNP
rs1446178489 2587 dbSNP
rs1195497735 2589 dbSNP
rs1488492429 2590 dbSNP
rs901284830 2592 dbSNP
rs771508847 2595 dbSNP
rs1020128274 2601 dbSNP
rs1354381528 2611 dbSNP
rs778876583 2615 dbSNP
rs1245825681 2618 dbSNP
rs1400472431 2620 dbSNP
rs1317457948 2621 dbSNP
rs55667079 2625 dbSNP
rs1212874544 2627 dbSNP
rs887110350 2629 dbSNP
rs1487203780 2635 dbSNP
rs1245939768 2637 dbSNP
rs545708974 2639 dbSNP
rs1284018634 2641 dbSNP
rs779439568 2643 dbSNP
rs1354837017 2662 dbSNP
rs1048348656 2663 dbSNP
rs757188919 2664 dbSNP
rs56404248 2666 dbSNP
rs1303126299 2670 dbSNP
rs185197797 2671 dbSNP
rs1245153865 2674 dbSNP
rs749712255 2678 dbSNP
rs541386059 2684 dbSNP
rs949256749 2689 dbSNP
rs917735277 2691 dbSNP
rs34364530 2707 dbSNP
rs1172357817 2708 dbSNP
rs756293851 2710 dbSNP
rs750631155 2715 dbSNP
rs1428300686 2716 dbSNP
rs1196704782 2719 dbSNP
rs1453205428 2733 dbSNP
rs1004875520 2734 dbSNP
rs890444995 2739 dbSNP
rs1210436262 2744 dbSNP
rs1424260454 2745 dbSNP
rs762695050 2752 dbSNP
rs1340488985 2753 dbSNP
rs781291511 2756 dbSNP
rs1200729809 2759 dbSNP
rs757318985 2764 dbSNP
rs1274582500 2765 dbSNP
rs1231728706 2766 dbSNP
rs752658461 2769 dbSNP
rs1302584141 2773 dbSNP
rs900556970 2777 dbSNP
rs79001261 2780 dbSNP
rs1332997275 2781 dbSNP
rs1465782624 2790 dbSNP
rs946528410 2794 dbSNP
rs759398951 2803 dbSNP
rs1478969173 2804 dbSNP
rs1378197534 2806 dbSNP
rs893761266 2812 dbSNP
rs1052339015 2821 dbSNP
rs1387420117 2825 dbSNP
rs1440418989 2828 dbSNP
rs534401333 2839 dbSNP
rs1236393318 2843 dbSNP
rs927630456 2847 dbSNP
rs1477479544 2848 dbSNP
rs755904238 2854 dbSNP
rs1190031375 2856 dbSNP
rs1458341551 2868 dbSNP
rs1278371397 2870 dbSNP
rs376911402 2874 dbSNP
rs765062293 2874 dbSNP
rs947802603 2876 dbSNP
rs752872500 2878 dbSNP
rs1004259743 2879 dbSNP
rs1347566389 2884 dbSNP
rs1257147904 2888 dbSNP
rs1240018564 2889 dbSNP
rs1374056391 2890 dbSNP
rs1448451021 2900 dbSNP
rs767762057 2902 dbSNP
rs866467632 2908 dbSNP
rs1398757115 2912 dbSNP
rs1447076437 2914 dbSNP
rs1285263481 2923 dbSNP
rs1339441407 2928 dbSNP
rs766096612 2930 dbSNP
rs916291099 2932 dbSNP
rs746829560 2935 dbSNP
rs1273247982 2936 dbSNP
rs1402610717 2938 dbSNP
rs77378509 2939 dbSNP
rs1417737738 2940 dbSNP
rs1378565275 2947 dbSNP
rs1286538692 2951 dbSNP
rs1235734780 2952 dbSNP
rs1180516799 2953 dbSNP
rs1316587322 2955 dbSNP
rs1440394708 2958 dbSNP
rs1237179929 2959 dbSNP
rs1185663701 2960 dbSNP
rs1185683928 2960 dbSNP
rs113200221 2961 dbSNP
rs1197577306 2963 dbSNP
rs1257253070 2964 dbSNP
rs1401004363 2967 dbSNP
rs116500181 2968 dbSNP
rs761363032 2969 dbSNP
rs1287546090 2970 dbSNP
rs376434814 2971 dbSNP
rs1355018189 2972 dbSNP
rs1013464589 2973 dbSNP
rs996159873 2975 dbSNP
rs1392106481 2985 dbSNP
rs1449723045 2988 dbSNP
rs1340871789 2989 dbSNP
rs1297293558 2997 dbSNP
rs1386247242 3000 dbSNP
rs1398080645 3009 dbSNP
rs1362457082 3013 dbSNP
rs1159167998 3015 dbSNP
rs113820201 3017 dbSNP
rs1413129335 3018 dbSNP
rs1161712201 3020 dbSNP
rs1309711211 3022 dbSNP
rs1352629827 3024 dbSNP
rs1464062899 3025 dbSNP
rs1237704407 3027 dbSNP
rs1267093176 3035 dbSNP
rs1488789349 3035 dbSNP
rs1208703607 3038 dbSNP
rs1473869540 3040 dbSNP
rs1369423557 3041 dbSNP
rs1193312609 3042 dbSNP
rs1487508072 3043 dbSNP
rs1458810996 3044 dbSNP
rs1021703296 3045 dbSNP
rs1052259733 3051 dbSNP
rs1266042438 3054 dbSNP
rs1010773453 3058 dbSNP
rs763437847 3062 dbSNP
rs1052241666 3065 dbSNP
rs1438163619 3066 dbSNP
rs1450578314 3068 dbSNP
rs774838846 3073 dbSNP
rs1229693216 3075 dbSNP
rs1043442464 3078 dbSNP
rs1291847292 3078 dbSNP
rs1398816013 3079 dbSNP
rs1356535041 3080 dbSNP
rs1277179630 3087 dbSNP
rs1216634502 3092 dbSNP
rs570314767 3096 dbSNP
rs906414274 3098 dbSNP
rs1435624732 3099 dbSNP
rs1374984185 3101 dbSNP
rs1349392384 3102 dbSNP
rs1244729635 3103 dbSNP
rs1321605539 3104 dbSNP
rs1407298990 3106 dbSNP
rs749801851 3107 dbSNP
rs1170218004 3111 dbSNP
rs761492490 3116 dbSNP
rs56247486 3117 dbSNP
rs1426186512 3128 dbSNP
rs1046489373 3129 dbSNP
rs931647332 3131 dbSNP
rs1477956817 3133 dbSNP
rs921589760 3134 dbSNP
rs770086149 3135 dbSNP
rs773775119 3136 dbSNP
rs1257087945 3146 dbSNP
rs965621544 3147 dbSNP
rs912756470 3156 dbSNP
rs1237144229 3160 dbSNP
rs1196331854 3162 dbSNP
rs878963168 3170 dbSNP
rs746070050 3185 dbSNP
rs1451805024 3190 dbSNP
rs1183946333 3194 dbSNP
rs1257375012 3197 dbSNP
rs1278551562 3203 dbSNP
rs982909415 3206 dbSNP
rs951487610 3212 dbSNP
rs1276541472 3219 dbSNP
rs1438768566 3226 dbSNP
rs1456886918 3229 dbSNP
rs1395275804 3230 dbSNP
rs373535351 3231 dbSNP
rs781316968 3232 dbSNP
rs180780531 3233 dbSNP
rs1464225128 3235 dbSNP
rs995526681 3237 dbSNP
rs757995859 3238 dbSNP
rs548611386 3239 dbSNP
rs1414260679 3240 dbSNP
rs1423756873 3246 dbSNP
rs1193407456 3247 dbSNP
rs1023602296 3248 dbSNP
rs1236993115 3251 dbSNP
rs1176419784 3253 dbSNP
rs188411829 3254 dbSNP
rs1310426544 3255 dbSNP
rs1044001746 3256 dbSNP
rs1342321545 3267 dbSNP
rs565936194 3268 dbSNP
rs765639657 3270 dbSNP
rs896402675 3277 dbSNP
rs1256927510 3278 dbSNP
rs1315673930 3279 dbSNP
rs1310204305 3280 dbSNP
rs1280708442 3290 dbSNP
rs1211887066 3291 dbSNP
rs1219702767 3293 dbSNP
rs1371853781 3296 dbSNP
rs754901024 3297 dbSNP
rs1444849724 3302 dbSNP
rs1202165770 3306 dbSNP
rs762290500 3310 dbSNP
rs1180503068 3314 dbSNP
rs1265925488 3319 dbSNP
rs1052292511 3323 dbSNP
rs999349218 3342 dbSNP
rs1465901350 3345 dbSNP
rs1421660792 3355 dbSNP
rs547898508 3361 dbSNP
rs776209113 3364 dbSNP
rs1176983444 3373 dbSNP
rs1435834197 3377 dbSNP
rs1358824147 3378 dbSNP
rs1465321696 3378 dbSNP
rs954966881 3378 dbSNP
rs766162194 3379 dbSNP
rs1277017391 3381 dbSNP
rs532466392 3382 dbSNP
rs964728278 3384 dbSNP
rs564328488 3387 dbSNP
rs551908322 3388 dbSNP
rs74103025 3389 dbSNP
rs1250867487 3391 dbSNP
rs1180897301 3392 dbSNP
rs1288672647 3396 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   | |  ||||||| 
Target 5' -----uuuuUAAAAUGCUGCUu 3'
1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000212355.4 | 3UTR | UUUUUAAAAUGCUGCUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.519 5.6e-3 0.475 1.1e-2 23 Click to see details
GSE38226 Liver fibrosis -0.512 8.8e-3 -0.461 1.8e-2 21 Click to see details
GSE27834 Pluripotent stem cells -0.561 1.2e-2 -0.526 1.8e-2 16 Click to see details
GSE17306 Multiple myeloma -0.271 3.0e-2 -0.224 6.1e-2 49 Click to see details
GSE32688 Pancreatic cancer -0.297 4.9e-2 -0.234 9.9e-2 32 Click to see details
GSE19536 Breast cancer 0.152 6.6e-2 0.125 1.1e-1 100 Click to see details
GSE19783 ER- ER- breast cancer 0.139 1.1e-1 0.134 1.2e-1 79 Click to see details
GSE21032 Prostate cancer 0.127 1.3e-1 0.071 2.6e-1 83 Click to see details
GSE21849 B cell lymphoma -0.206 1.4e-1 0.239 1.1e-1 29 Click to see details
GSE19350 CNS germ cell tumors 0.3 1.7e-1 0.350 1.3e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.115 1.8e-1 0.102 2.1e-1 64 Click to see details
GSE17498 Multiple myeloma -0.141 1.9e-1 0.025 4.4e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.122 3.0e-1 -0.128 3.0e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.075 3.6e-1 0.161 2.2e-1 25 Click to see details
GSE28544 Breast cancer -0.075 3.6e-1 0.054 4.0e-1 24 Click to see details
GSE14794 Lymphoblastoid cells 0.026 4.0e-1 0.008 4.7e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.037 4.3e-1 -0.058 3.9e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.028 4.5e-1 0.075 3.6e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.025 4.6e-1 0.009 4.8e-1 20 Click to see details
GSE28260 Renal cortex and medulla -0.026 4.7e-1 0.000 5.0e-1 13 Click to see details
GSE28260 Renal cortex and medulla -0.026 4.7e-1 0.000 5.0e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.756 0 -0.791 0 32 Click to see details
HNSC -0.448 0 -0.471 0 42 Click to see details
THCA -0.245 0.03 -0.213 0.05 59 Click to see details
BLCA -0.321 0.1 -0.356 0.07 18 Click to see details
KICH 0.267 0.1 0.198 0.17 25 Click to see details
PRAD -0.184 0.1 -0.186 0.1 50 Click to see details
KIRP 0.2 0.14 0.039 0.42 32 Click to see details
BRCA 0.112 0.16 0.133 0.11 84 Click to see details
COAD -0.383 0.17 -0.405 0.16 8 Click to see details
UCEC 0.2 0.21 0.023 0.46 19 Click to see details
LUSC 0.125 0.23 0.110 0.26 38 Click to see details
PAAD 0.255 0.37 0.600 0.2 4 Click to see details
LUAD 0.087 0.39 0.091 0.39 12 Click to see details
PCPG 0.267 0.41 0.500 0.33 3 Click to see details
KIRC 0.026 0.42 0.041 0.37 68 Click to see details
ESCA -0.06 0.43 0.236 0.24 11 Click to see details
LIHC 0.023 0.44 -0.007 0.48 49 Click to see details
CHOL 0.031 0.47 -0.100 0.4 9 Click to see details
CESC -0.055 0.48 -0.500 0.33 3 Click to see details
CESC -0.055 0.48 -0.500 0.33 3 Click to see details
CESC -0.055 0.48 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2