pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-15a |
Genomic Coordinates | chr13: 50049119 - 50049201 |
Synonyms | MIRN15A, hsa-mir-15a, miRNA15A, MIR15A |
Description | Homo sapiens miR-15a stem-loop |
Comment | Reference . |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-15a-5p | ||||||||||||||||||
Sequence | 14| UAGCAGCACAUAAUGGUUUGUG |35 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Cloned | ||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
Circulating MicroRNA Expression Profiling | Circulating MicroRNA Expression Profiling |
---|
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ZBTB16 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | PLZF, ZNF145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | zinc finger and BTB domain containing 16 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_001018011 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_006006 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on ZBTB16 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of ZBTB16 (miRNA target sites are highlighted) |
>ZBTB16|NM_001018011|3'UTR
1 AGGGAGGCCCGCGGCGGTGGAGCCGAGCGGGGAGCCAGGAAAGAAGAGTTGGAGTGAGATGAAGGAAGGACTATGACAAA
81 TAAAAAAGGAAAAGAAAAAAAAAAACAGAAGGAAAAGGAAAAAAAAAAAAA
Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
CLIP-seq Support 1 for dataset GSM545214 | |
Method / RBP | PAR-CLIP / AGO3 |
---|---|
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000335953.4 | 3UTR | AAAUAUCAUUGCUGCUUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545216 | |
Method / RBP | PAR-CLIP / AGO2 |
---|---|
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000335953.4 | 3UTR | UAAAUAUCAUUGCUGCUUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT000280 | BMI1 | BMI1 proto-oncogene, polycomb ring finger | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 3 | |||
MIRT000282 | WNT3A | Wnt family member 3A | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT000283 | MYB | MYB proto-oncogene, transcription factor | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 3 | |||
MIRT000284 | CDC25A | cell division cycle 25A | ![]() |
![]() |
![]() |
![]() |
4 | 4 | ||||
MIRT000285 | CCND2 | cyclin D2 | ![]() |
![]() |
![]() |
![]() |
4 | 7 | ||||
MIRT000804 | RAB9B | RAB9B, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT000806 | ACTR1A | ARP1 actin related protein 1 homolog A | ![]() |
1 | 1 | |||||||
MIRT000808 | TPI1 | triosephosphate isomerase 1 | ![]() |
1 | 1 | |||||||
MIRT000810 | PDCD4 | programmed cell death 4 | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT000812 | RAB21 | RAB21, member RAS oncogene family | ![]() |
![]() |
2 | 1 | ||||||
MIRT000815 | BCL2 | BCL2, apoptosis regulator | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
6 | 13 | ||
MIRT000817 | WT1 | Wilms tumor 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000819 | ASXL2 | additional sex combs like 2, transcriptional regulator | ![]() |
![]() |
2 | 1 | ||||||
MIRT000823 | TMEM251 | transmembrane protein 251 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000825 | CARD8 | caspase recruitment domain family member 8 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000827 | CDC14B | cell division cycle 14B | ![]() |
![]() |
2 | 1 | ||||||
MIRT000829 | CENPJ | centromere protein J | ![]() |
![]() |
2 | 1 | ||||||
MIRT000831 | CEP63 | centrosomal protein 63 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000833 | CREBL2 | cAMP responsive element binding protein like 2 | ![]() |
![]() |
![]() |
![]() |
4 | 5 | ||||
MIRT000835 | ECHDC1 | ethylmalonyl-CoA decarboxylase 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000847 | GOLGA5 | golgin A5 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000849 | GOLPH3L | golgi phosphoprotein 3 like | ![]() |
![]() |
2 | 1 | ||||||
MIRT000851 | GTF2H1 | general transcription factor IIH subunit 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000853 | H3F3B | H3 histone family member 3B | ![]() |
![]() |
2 | 1 | ||||||
MIRT000855 | HACE1 | HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000857 | HDHD2 | haloacid dehalogenase like hydrolase domain containing 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000859 | HERC6 | HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000863 | HRSP12 | reactive intermediate imine deaminase A homolog | ![]() |
![]() |
2 | 1 | ||||||
MIRT000865 | HSDL2 | hydroxysteroid dehydrogenase like 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000866 | HSPA1A | heat shock protein family A (Hsp70) member 1A | ![]() |
![]() |
2 | 1 | ||||||
MIRT000868 | JUN | Jun proto-oncogene, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 1 | ||||||
MIRT000878 | MCL1 | MCL1, BCL2 family apoptosis regulator | ![]() |
![]() |
2 | 1 | ||||||
MIRT000880 | MSH2 | mutS homolog 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000884 | OMA1 | OMA1 zinc metallopeptidase | ![]() |
![]() |
2 | 1 | ||||||
MIRT000886 | OSGEPL1 | O-sialoglycoprotein endopeptidase like 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000888 | PDCD6IP | programmed cell death 6 interacting protein | ![]() |
![]() |
2 | 1 | ||||||
MIRT000890 | PHKB | phosphorylase kinase regulatory subunit beta | ![]() |
![]() |
2 | 1 | ||||||
MIRT000892 | PMS1 | PMS1 homolog 1, mismatch repair system component | ![]() |
![]() |
2 | 1 | ||||||
MIRT000894 | PNN | pinin, desmosome associated protein | ![]() |
![]() |
2 | 1 | ||||||
MIRT000896 | PRIM1 | DNA primase subunit 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000898 | RAD51C | RAD51 paralog C | ![]() |
![]() |
2 | 1 | ||||||
MIRT000900 | RHOT1 | ras homolog family member T1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000902 | RNASEL | ribonuclease L | ![]() |
![]() |
2 | 1 | ||||||
MIRT000906 | SLC35A1 | solute carrier family 35 member A1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000908 | SLC35B3 | solute carrier family 35 member B3 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000910 | TIA1 | TIA1 cytotoxic granule associated RNA binding protein | ![]() |
![]() |
2 | 1 | ||||||
MIRT000914 | UGDH | UDP-glucose 6-dehydrogenase | ![]() |
![]() |
2 | 1 | ||||||
MIRT000916 | UGP2 | UDP-glucose pyrophosphorylase 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000922 | ZNF559 | zinc finger protein 559 | ![]() |
![]() |
2 | 1 | ||||||
MIRT001227 | CCND1 | cyclin D1 | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
6 | 8 | ||
MIRT001228 | CCNE1 | cyclin E1 | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
7 | 10 | |
MIRT001802 | BACE1 | beta-secretase 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT002946 | DMTF1 | cyclin D binding myb like transcription factor 1 | ![]() |
![]() |
![]() |
![]() |
4 | 4 | ||||
MIRT003330 | RPS6 | ribosomal protein S6 | 0 | 1 | ||||||||
MIRT003333 | BRCA1 | BRCA1, DNA repair associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT003334 | AKT3 | AKT serine/threonine kinase 3 | ![]() |
![]() |
![]() |
3 | 6 | |||||
MIRT003872 | WIPF1 | WAS/WASL interacting protein family member 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003873 | VPS45 | vacuolar protein sorting 45 homolog | ![]() |
![]() |
2 | 1 | ||||||
MIRT003874 | HSP90B1 | heat shock protein 90 beta family member 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003875 | SKAP2 | src kinase associated phosphoprotein 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003876 | NT5DC1 | 5'-nucleotidase domain containing 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003877 | FAM69A | family with sequence similarity 69 member A | ![]() |
![]() |
2 | 1 | ||||||
MIRT003878 | C2orf74 | chromosome 2 open reading frame 74 | ![]() |
1 | 1 | |||||||
MIRT003879 | FAM122C | family with sequence similarity 122C | ![]() |
![]() |
2 | 1 | ||||||
MIRT003880 | PWWP2A | PWWP domain containing 2A | ![]() |
![]() |
2 | 1 | ||||||
MIRT003881 | C17orf80 | chromosome 17 open reading frame 80 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003882 | CCDC111 | primase and DNA directed polymerase | ![]() |
![]() |
2 | 1 | ||||||
MIRT003883 | C2orf43 | lipid droplet associated hydrolase | ![]() |
![]() |
2 | 1 | ||||||
MIRT003884 | C4orf27 | histone PARylation factor 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003885 | NIPAL2 | NIPA like domain containing 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003886 | TRMT13 | tRNA methyltransferase 13 homolog | ![]() |
![]() |
2 | 1 | ||||||
MIRT003887 | ANAPC16 | anaphase promoting complex subunit 16 | ![]() |
![]() |
2 | 1 | ||||||
MIRT003888 | CADM1 | cell adhesion molecule 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003891 | TMEM184B | transmembrane protein 184B | ![]() |
![]() |
2 | 1 | ||||||
MIRT003899 | APP | amyloid beta precursor protein | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT004046 | UCP2 | uncoupling protein 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT004275 | VEGFA | vascular endothelial growth factor A | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
7 | 17 | |
MIRT004680 | TSPYL2 | TSPY like 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT004829 | NFKB1 | nuclear factor kappa B subunit 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT005552 | CHUK | conserved helix-loop-helix ubiquitous kinase | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT005763 | TP53 | tumor protein p53 | ![]() |
1 | 1 | |||||||
MIRT006027 | FGF7 | fibroblast growth factor 7 | ![]() |
![]() |
2 | 1 | ||||||
MIRT006176 | CLCN3 | chloride voltage-gated channel 3 | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT006177 | CRKL | CRK like proto-oncogene, adaptor protein | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
6 | 3 | ||
MIRT006181 | MN1 | MN1 proto-oncogene, transcriptional regulator | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT006658 | Ccnd1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT006801 | HMGA1 | high mobility group AT-hook 1 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT006805 | HMGA2 | high mobility group AT-hook 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT006913 | IFNG | interferon gamma | ![]() |
![]() |
2 | 1 | ||||||
MIRT006998 | PURA | purine rich element binding protein A | ![]() |
![]() |
2 | 2 | ||||||
MIRT007090 | RECK | reversion inducing cysteine rich protein with kazal motifs | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT032077 | DLK1 | delta like non-canonical Notch ligand 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT051311 | PLA2G2D | phospholipase A2 group IID | ![]() |
1 | 1 | |||||||
MIRT051312 | ACVR1B | activin A receptor type 1B | ![]() |
1 | 1 | |||||||
MIRT051313 | IKBKG | inhibitor of nuclear factor kappa B kinase subunit gamma | ![]() |
1 | 1 | |||||||
MIRT051314 | GCLM | glutamate-cysteine ligase modifier subunit | ![]() |
1 | 1 | |||||||
MIRT051315 | PCF11 | PCF11 cleavage and polyadenylation factor subunit | ![]() |
1 | 1 | |||||||
MIRT051316 | HIST1H2BK | histone cluster 1 H2B family member k | ![]() |
1 | 1 | |||||||
MIRT051317 | ODC1 | ornithine decarboxylase 1 | ![]() |
1 | 1 | |||||||
MIRT051318 | CALD1 | caldesmon 1 | ![]() |
1 | 1 | |||||||
MIRT051319 | RPP30 | ribonuclease P/MRP subunit p30 | ![]() |
1 | 1 | |||||||
MIRT051320 | ASNSD1 | asparagine synthetase domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT051321 | CCNYL1 | cyclin Y like 1 | ![]() |
1 | 1 | |||||||
MIRT051322 | RGPD5 | RANBP2-like and GRIP domain containing 5 | ![]() |
1 | 1 | |||||||
MIRT051323 | PREB | prolactin regulatory element binding | ![]() |
1 | 1 | |||||||
MIRT051324 | PDHX | pyruvate dehydrogenase complex component X | ![]() |
1 | 1 | |||||||
MIRT051325 | SNX6 | sorting nexin 6 | ![]() |
1 | 1 | |||||||
MIRT051326 | CNN3 | calponin 3 | ![]() |
1 | 1 | |||||||
MIRT051327 | KIF1A | kinesin family member 1A | ![]() |
1 | 1 | |||||||
MIRT051328 | NAB1 | NGFI-A binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT051329 | CCT6B | chaperonin containing TCP1 subunit 6B | ![]() |
1 | 1 | |||||||
MIRT051330 | CHD4 | chromodomain helicase DNA binding protein 4 | ![]() |
1 | 1 | |||||||
MIRT051331 | CLCC1 | chloride channel CLIC like 1 | ![]() |
1 | 1 | |||||||
MIRT051332 | GDI2 | GDP dissociation inhibitor 2 | ![]() |
1 | 1 | |||||||
MIRT051333 | BRWD1 | bromodomain and WD repeat domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT051334 | MAPK6 | mitogen-activated protein kinase 6 | ![]() |
1 | 1 | |||||||
MIRT051335 | PSMC4 | proteasome 26S subunit, ATPase 4 | ![]() |
1 | 1 | |||||||
MIRT051336 | ATF2 | activating transcription factor 2 |