miRTarBase - #MIRT564556 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCDC80   
Synonyms DRO1, SSG1, URB, okuribin
Description coiled-coil domain containing 80
Transcript NM_199511   
Other Transcripts NM_199512   
Expression
Putative miRNA Targets on CCDC80
3'UTR of CCDC80
(miRNA target sites are highlighted)
>CCDC80|NM_199511|3'UTR
   1 GCAGAAATATGTAACCTTAGACTCAGCCAGTTTCCTCTGCAGCTGCTAAAACTACATGTGGCCAGCTCCATTCTTCCACA
  81 CTGCGTACTACATTTCCTGCCTTTTTCTTTCAGTGTTTTTCTAAGACTAAATAAATAGCAAACTTTCACCTATTCATGAG
 161 TTATTATTGAAACCTCAAATCATAAAGACATTTAAAAGAATTGTTTTTCTAACTGGAGGGGCTCTAGTGCTAAATAATAG
 241 TACTGAAAATTGATATTATTTTCCTTTTCTTATATGAAGGACCTTATTTGGCATATAAAATTTTATAAAATATGTATTTA
 321 AAGCTTTTTCTTATTTTTTGTATTAATTGGTAAGTGAAAACTCTGTTAAAGATCACACCACAATGTTTTCAAGAAACATC
 401 TGAAAAGATAAAACAAAGAACAAATAACTTATAATACTTACTTAAATTGACACTTTTTGAAATGCCAGTCTGAAAATAAT
 481 TAAGATATCTCTGCTTTGTATGAGTTTCTTTTATGAAACTTGATACCACGGGAGTCCAGTAATATTGGCCACAAAAGCCA
 561 GAGAAAGTACCAAGCCCAGCTTTGTTATCATAGCCACTTCCTGCCCTGCTTCTGTTATTTTTAGTGTTTTTTCAGATATA
 641 AATCGGGGTCCAGGAAATCCTCACCAGAATCTGGCACTGCAGCCAAAGGCGATACTTCCAGAGTTCTAGTAGGCTGCTAT
 721 GGAATTTCTGGCATGAAAATTCTTGACCCCTCACACTTTACCCCCTGTACAGCACAGGCATACCATGGAGATATTACAGG
 801 ATCAGTTCCAGACCACCATAATAAAGTGGATATCGCAATAAAGTGAGTCACACAAAATTTTTGGTTTCTCAGTGCATATA
 881 AAAGTTATGTTTACACTCTTTAGTAGTCTATTAAGTGTATAATAGCTTTATGTCCAAAAAATGTACATGTTTTATTTTAA
 961 AAATACTTTATTGCTAAAAATTGCTAATGATCATAATCTTTTTGCATTGATGTTGATGGCTGCTGAATGAT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUU---GGUAAUACACGACGAu 5'
            ||:|   |:| ||   |||||| 
Target 5' tcCAGAGTTCTAGTAG--GCTGCTa 3'
697 - 719 123.00 -11.70
2
miRNA  3' guguuugGUAA-UAC----A-CGACGAu 5'
                 |||| |||    | |||||| 
Target 5' ctttttgCATTGATGTTGATGGCTGCTg 3'
998 - 1025 121.00 -12.89
3
miRNA  3' guguUUGGU--AA-UACACGACGAu 5'
              |:|||  ||  | ||| ||| 
Target 5' actcAGCCAGTTTCCTCTGCAGCTg 3'
21 - 45 120.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30191095 2 COSMIC
COSN30736237 7 COSMIC
COSN14022501 25 COSMIC
COSN31571551 36 COSMIC
COSN30153639 37 COSMIC
COSN31614279 37 COSMIC
COSN31494525 48 COSMIC
COSN30505120 61 COSMIC
COSN30627844 78 COSMIC
COSN31539286 121 COSMIC
COSN30168498 125 COSMIC
COSN31558496 155 COSMIC
COSN9111739 500 COSMIC
COSN23674564 806 COSMIC
COSN4810157 847 COSMIC
COSN5144618 1228 COSMIC
COSN30071695 1562 COSMIC
COSN4810156 1603 COSMIC
COSN1907035 1708 COSMIC
COSN14797194 1733 COSMIC
COSN1907034 1742 COSMIC
COSN29521722 1798 COSMIC
COSN14459862 1896 COSMIC
COSN9111738 1967 COSMIC
COSN15283221 2174 COSMIC
COSN30554427 2199 COSMIC
COSN1265301 2389 COSMIC
COSN7552860 2575 COSMIC
COSN32176071 2578 COSMIC
COSN20698941 2672 COSMIC
COSN7552859 2706 COSMIC
COSN22902065 2738 COSMIC
COSN1265300 2792 COSMIC
COSN19341329 2797 COSMIC
COSN1265299 3033 COSMIC
COSN15703269 3113 COSMIC
COSN17123173 3261 COSMIC
COSN9111737 3272 COSMIC
COSN29348400 3324 COSMIC
COSN30733535 3332 COSMIC
COSN30554619 3509 COSMIC
COSN30613728 3628 COSMIC
COSN1265298 3665 COSMIC
COSN1907033 3708 COSMIC
COSN30705044 3877 COSMIC
COSN30590903 3881 COSMIC
COSN9734063 4150 COSMIC
COSN16121053 4213 COSMIC
COSN30582543 4272 COSMIC
COSN15664669 4454 COSMIC
COSN21507854 4616 COSMIC
COSN30746853 4733 COSMIC
COSN7552858 4790 COSMIC
COSN30548881 4913 COSMIC
COSN25183935 4941 COSMIC
COSN30640938 5009 COSMIC
COSN9001165 5235 COSMIC
COSN21348231 5378 COSMIC
COSN1907032 5448 COSMIC
COSN7552857 5507 COSMIC
COSN30766988 5534 COSMIC
COSN30611288 5874 COSMIC
COSN20679400 5962 COSMIC
COSN30601030 6325 COSMIC
COSN6744700 6422 COSMIC
COSN30634949 6661 COSMIC
COSN30632716 6684 COSMIC
COSN24012612 6726 COSMIC
COSN17850263 6758 COSMIC
COSN30748633 7063 COSMIC
COSN9111736 7077 COSMIC
COSN6744699 7118 COSMIC
COSN30763367 7158 COSMIC
COSN27998673 7224 COSMIC
COSN27972291 7232 COSMIC
COSN22714171 7387 COSMIC
COSN30733085 7426 COSMIC
COSN25903453 7663 COSMIC
COSN30763115 7866 COSMIC
COSN30724571 7897 COSMIC
COSN6570954 8006 COSMIC
COSN31624377 8167 COSMIC
COSN30667308 8429 COSMIC
COSN30704063 8511 COSMIC
rs145944228 8549 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751139841 6 dbSNP
rs1440171117 10 dbSNP
rs764640755 16 dbSNP
rs1461195127 17 dbSNP
rs1264516805 18 dbSNP
rs1028192465 22 dbSNP
rs80100028 25 dbSNP
rs1480996066 26 dbSNP
rs1317238791 27 dbSNP
rs1255868164 35 dbSNP
rs11547749 36 dbSNP
rs200126089 38 dbSNP
rs759770953 45 dbSNP
rs754016560 49 dbSNP
rs1267473768 57 dbSNP
rs189154488 62 dbSNP
rs552220107 66 dbSNP
rs1481769121 70 dbSNP
rs1396679116 83 dbSNP
rs756608552 84 dbSNP
rs949495448 85 dbSNP
rs1042585832 87 dbSNP
rs376345927 88 dbSNP
rs141112542 90 dbSNP
rs916603698 92 dbSNP
rs1331569112 93 dbSNP
rs1338888211 94 dbSNP
rs1306158119 100 dbSNP
rs1294632777 113 dbSNP
rs990823890 125 dbSNP
rs1222148093 130 dbSNP
rs1390939182 136 dbSNP
rs1348690074 137 dbSNP
rs749908406 143 dbSNP
rs958898127 150 dbSNP
rs1194960351 153 dbSNP
rs1373135742 155 dbSNP
rs1448396548 163 dbSNP
rs1032949410 167 dbSNP
rs868507604 174 dbSNP
rs576153352 183 dbSNP
rs1386962693 187 dbSNP
rs1425240298 193 dbSNP
rs553916905 197 dbSNP
rs978648731 198 dbSNP
rs34541731 210 dbSNP
rs937654460 216 dbSNP
rs1364506189 222 dbSNP
rs1432934664 224 dbSNP
rs926316624 225 dbSNP
rs78231165 239 dbSNP
rs930850514 244 dbSNP
rs184395661 251 dbSNP
rs1029103042 253 dbSNP
rs995837337 256 dbSNP
rs1253340689 259 dbSNP
rs972620322 267 dbSNP
rs1485111625 268 dbSNP
rs1186060575 271 dbSNP
rs1276280450 272 dbSNP
rs1202005197 273 dbSNP
rs1445161629 274 dbSNP
rs572573022 279 dbSNP
rs1260129089 294 dbSNP
rs1455189840 298 dbSNP
rs1158959781 299 dbSNP
rs1226489818 300 dbSNP
rs559182419 307 dbSNP
rs940912019 308 dbSNP
rs1327164095 321 dbSNP
rs146486433 326 dbSNP
rs1395937695 327 dbSNP
rs1046552102 333 dbSNP
rs953463662 334 dbSNP
rs916652611 335 dbSNP
rs991287496 339 dbSNP
rs1332404334 340 dbSNP
rs1206508562 348 dbSNP
rs1264444011 351 dbSNP
rs1461416200 361 dbSNP
rs1181178078 365 dbSNP
rs1398207514 365 dbSNP
rs1253947612 368 dbSNP
rs936666905 372 dbSNP
rs1032938861 377 dbSNP
rs1000165382 379 dbSNP
rs978681222 382 dbSNP
rs1471729590 385 dbSNP
rs968345772 389 dbSNP
rs967287838 390 dbSNP
rs1413557295 391 dbSNP
rs72942070 392 dbSNP
rs1301191449 394 dbSNP
rs192552023 397 dbSNP
rs538656180 398 dbSNP
rs536650241 399 dbSNP
rs567782945 402 dbSNP
rs1349080048 413 dbSNP
rs1226164024 417 dbSNP
rs1284848801 418 dbSNP
rs987310777 418 dbSNP
rs1442852896 422 dbSNP
rs1208753472 424 dbSNP
rs373359539 425 dbSNP
rs1253750473 429 dbSNP
rs1481535191 432 dbSNP
rs954640410 437 dbSNP
rs896354931 438 dbSNP
rs1270132660 441 dbSNP
rs773564152 445 dbSNP
rs1201363287 461 dbSNP
rs1056615910 464 dbSNP
rs1282703033 470 dbSNP
rs1247256664 483 dbSNP
rs1001915081 487 dbSNP
rs561357780 488 dbSNP
rs548004585 492 dbSNP
rs1369062186 519 dbSNP
rs1407103140 524 dbSNP
rs554520234 529 dbSNP
rs534798511 530 dbSNP
rs1218279830 534 dbSNP
rs74434110 541 dbSNP
rs1036647286 542 dbSNP
rs774231031 547 dbSNP
rs1229018575 552 dbSNP
rs944866048 560 dbSNP
rs578112795 575 dbSNP
rs1224366157 577 dbSNP
rs1269339483 583 dbSNP
rs765090974 590 dbSNP
rs532496779 592 dbSNP
rs1189756991 594 dbSNP
rs953432610 600 dbSNP
rs926057765 604 dbSNP
rs1429236592 628 dbSNP
rs1055221607 629 dbSNP
rs1388804826 634 dbSNP
rs1366741453 638 dbSNP
rs978712983 639 dbSNP
rs967433345 644 dbSNP
rs1021283820 645 dbSNP
rs1372313900 654 dbSNP
rs1363680249 658 dbSNP
rs759458862 663 dbSNP
rs1435134697 667 dbSNP
rs563579341 669 dbSNP
rs1186400717 677 dbSNP
rs1009527058 678 dbSNP
rs1248169886 680 dbSNP
rs1290314638 682 dbSNP
rs1320947197 683 dbSNP
rs1248624473 685 dbSNP
rs960911046 689 dbSNP
rs188874523 690 dbSNP
rs1287735332 691 dbSNP
rs1246264688 692 dbSNP
rs1446966173 693 dbSNP
rs1002052571 710 dbSNP
rs904922007 716 dbSNP
rs945976989 719 dbSNP
rs145407263 720 dbSNP
rs1161767751 721 dbSNP
rs1457450810 729 dbSNP
rs879640605 733 dbSNP
rs1284747453 747 dbSNP
rs142083103 748 dbSNP
rs1036439231 751 dbSNP
rs1226350629 752 dbSNP
rs1226709488 754 dbSNP
rs1286100903 761 dbSNP
rs944939929 762 dbSNP
rs921727417 764 dbSNP
rs1367771770 767 dbSNP
rs1266298859 768 dbSNP
rs974466835 781 dbSNP
rs1210954350 786 dbSNP
rs1237366272 788 dbSNP
rs1436300956 791 dbSNP
rs890713437 796 dbSNP
rs1179256491 799 dbSNP
rs1413245835 800 dbSNP
rs1472707174 806 dbSNP
rs1158028362 817 dbSNP
rs748422967 823 dbSNP
rs963089648 825 dbSNP
rs1347622612 826 dbSNP
rs1015911581 828 dbSNP
rs774693764 830 dbSNP
rs1358445378 832 dbSNP
rs541195744 844 dbSNP
rs950362052 851 dbSNP
rs1025236373 857 dbSNP
rs1227992787 858 dbSNP
rs1286729822 859 dbSNP
rs377365285 860 dbSNP
rs1325956873 874 dbSNP
rs1395381705 877 dbSNP
rs932174990 878 dbSNP
rs1451163302 883 dbSNP
rs1390557593 884 dbSNP
rs1441189725 887 dbSNP
rs926025183 890 dbSNP
rs1252966566 893 dbSNP
rs572581672 895 dbSNP
rs149168955 899 dbSNP
rs895317011 901 dbSNP
rs1409248350 902 dbSNP
rs1055701484 903 dbSNP
rs565377774 906 dbSNP
rs35731133 909 dbSNP
rs369522615 909 dbSNP
rs1412672936 913 dbSNP
rs1330869516 917 dbSNP
rs1274262607 922 dbSNP
rs946037123 928 dbSNP
rs1203274087 931 dbSNP
rs1042438220 939 dbSNP
rs192797121 943 dbSNP
rs573773722 943 dbSNP
rs913193985 945 dbSNP
rs187555431 948 dbSNP
rs1275926800 949 dbSNP
rs146634985 949 dbSNP
rs933194239 959 dbSNP
rs1203379099 964 dbSNP
rs1171195377 969 dbSNP
rs1271495634 971 dbSNP
rs1219179792 972 dbSNP
rs921821625 980 dbSNP
rs1245601298 983 dbSNP
rs749704670 984 dbSNP
rs1034955391 985 dbSNP
rs145232417 1004 dbSNP
rs969241240 1011 dbSNP
rs908983669 1012 dbSNP
rs983133315 1015 dbSNP
rs1392689577 1032 dbSNP
rs1387547756 1039 dbSNP
rs1323192176 1046 dbSNP
rs1027400009 1052 dbSNP
rs1349327244 1054 dbSNP
rs536624092 1056 dbSNP
rs1329600204 1058 dbSNP
rs897575089 1059 dbSNP
rs950419896 1060 dbSNP
rs1298436764 1061 dbSNP
rs1014561073 1063 dbSNP
rs1025019996 1064 dbSNP
rs1226921014 1068 dbSNP
rs1294385076 1073 dbSNP
rs574125470 1079 dbSNP
rs1431184457 1080 dbSNP
rs1210032346 1081 dbSNP
rs150003263 1084 dbSNP
rs1449531242 1085 dbSNP
rs959884394 1087 dbSNP
rs890688998 1088 dbSNP
rs1033878140 1092 dbSNP
rs1412510095 1097 dbSNP
rs1001017829 1100 dbSNP
rs904000815 1108 dbSNP
rs75802134 1109 dbSNP
rs565865316 1111 dbSNP
rs879605104 1121 dbSNP
rs139270462 1123 dbSNP
rs1478435378 1125 dbSNP
rs1321289714 1127 dbSNP
rs933281330 1128 dbSNP
rs147873734 1131 dbSNP
rs1043208650 1132 dbSNP
rs1244454956 1142 dbSNP
rs1282797078 1143 dbSNP
rs1484129618 1143 dbSNP
rs144970369 1151 dbSNP
rs946119437 1152 dbSNP
rs1268184422 1153 dbSNP
rs1464084452 1155 dbSNP
rs1206320871 1175 dbSNP
rs1310788476 1177 dbSNP
rs1186491761 1178 dbSNP
rs1424340610 1178 dbSNP
rs140983212 1180 dbSNP
rs756735811 1190 dbSNP
rs938706564 1198 dbSNP
rs1473685222 1201 dbSNP
rs751016972 1206 dbSNP
rs1387958404 1207 dbSNP
rs929043077 1211 dbSNP
rs182641605 1217 dbSNP
rs980720677 1218 dbSNP
rs917627271 1224 dbSNP
rs777430532 1230 dbSNP
rs1332594407 1235 dbSNP
rs1285846419 1236 dbSNP
rs1352768822 1241 dbSNP
rs1229822037 1244 dbSNP
rs59242272 1250 dbSNP
rs1328075386 1252 dbSNP
rs1225981579 1253 dbSNP
rs1350768443 1259 dbSNP
rs1027453685 1267 dbSNP
rs1257245583 1272 dbSNP
rs867408267 1274 dbSNP
rs547857752 1275 dbSNP
rs1199854677 1276 dbSNP
rs1015109981 1278 dbSNP
rs1033951564 1285 dbSNP
rs1483936070 1286 dbSNP
rs1301873156 1293 dbSNP
rs979652176 1296 dbSNP
rs752448501 1297 dbSNP
rs968216649 1298 dbSNP
rs954412084 1299 dbSNP
rs1029197064 1307 dbSNP
rs1178321210 1314 dbSNP
rs1021095088 1319 dbSNP
rs1456586153 1324 dbSNP
rs1378340505 1329 dbSNP
rs1009694125 1331 dbSNP
rs1411354169 1332 dbSNP
rs891191204 1335 dbSNP
rs1372983726 1336 dbSNP
rs1029686316 1337 dbSNP
rs1410774858 1342 dbSNP
rs996346356 1345 dbSNP
rs1349426493 1346 dbSNP
rs904792214 1350 dbSNP
rs1043202568 1355 dbSNP
rs1312310940 1357 dbSNP
rs1473596999 1359 dbSNP
rs1278051135 1360 dbSNP
rs112005013 1361 dbSNP
rs1205532881 1362 dbSNP
rs1250889500 1365 dbSNP
rs1482190735 1366 dbSNP
rs891861884 1380 dbSNP
rs147303788 1396 dbSNP
rs1181484694 1403 dbSNP
rs938691685 1406 dbSNP
rs1482519806 1412 dbSNP
rs1174077049 1414 dbSNP
rs1239515174 1430 dbSNP
rs899801974 1433 dbSNP
rs1038934791 1434 dbSNP
rs765066966 1436 dbSNP
rs35931975 1444 dbSNP
rs1229747629 1446 dbSNP
rs765694510 1456 dbSNP
rs760293292 1457 dbSNP
rs947920284 1464 dbSNP
rs572978749 1469 dbSNP
rs973240635 1470 dbSNP
rs1047543715 1475 dbSNP
rs929102359 1478 dbSNP
rs917642531 1488 dbSNP
rs1223535423 1489 dbSNP
rs1434320174 1499 dbSNP
rs1386412550 1500 dbSNP
rs531811822 1501 dbSNP
rs1488288681 1507 dbSNP
rs907607623 1508 dbSNP
rs1201542099 1518 dbSNP
rs987665466 1519 dbSNP
rs1450619828 1520 dbSNP
rs562822927 1523 dbSNP
rs954464300 1527 dbSNP
rs1425881542 1529 dbSNP
rs1164356451 1533 dbSNP
rs1165955630 1533 dbSNP
rs926244732 1543 dbSNP
rs72942068 1544 dbSNP
rs995812526 1545 dbSNP
rs1184551606 1551 dbSNP
rs968919151 1553 dbSNP
rs1359813465 1563 dbSNP
rs1229766228 1579 dbSNP
rs1022320122 1581 dbSNP
rs1449216880 1590 dbSNP
rs1021168647 1595 dbSNP
rs1246784539 1602 dbSNP
rs1211117949 1613 dbSNP
rs1465429886 1614 dbSNP
rs1208217666 1619 dbSNP
rs988696938 1634 dbSNP
rs1474066923 1635 dbSNP
rs1182735604 1636 dbSNP
rs1413607725 1650 dbSNP
rs1464957760 1656 dbSNP
rs955543852 1658 dbSNP
rs559616145 1665 dbSNP
rs1010392101 1666 dbSNP
rs1457266155 1667 dbSNP
rs996905333 1680 dbSNP
rs1323104598 1687 dbSNP
rs1312946393 1688 dbSNP
rs891996579 1702 dbSNP
rs1057217137 1711 dbSNP
rs1002923125 1712 dbSNP
rs1378231087 1716 dbSNP
rs1231650921 1718 dbSNP
rs1290399481 1719 dbSNP
rs1330108268 1721 dbSNP
rs767754615 1727 dbSNP
rs1362754978 1731 dbSNP
rs66698345 1733 dbSNP
rs931323453 1737 dbSNP
rs1237233947 1740 dbSNP
rs1385786341 1742 dbSNP
rs1484872840 1743 dbSNP
rs920508936 1744 dbSNP
rs1016886865 1748 dbSNP
rs532137957 1761 dbSNP
rs1472718580 1769 dbSNP
rs1164435081 1772 dbSNP
rs1157483340 1776 dbSNP
rs1429587239 1794 dbSNP
rs1416074961 1798 dbSNP
rs1176750596 1808 dbSNP
rs867562422 1809 dbSNP
rs1358535306 1811 dbSNP
rs1309635000 1813 dbSNP
rs369225786 1813 dbSNP
rs887685362 1813 dbSNP
rs1277839089 1814 dbSNP
rs1347269678 1818 dbSNP
rs1388629560 1821 dbSNP
rs1191065275 1824 dbSNP
rs1219919527 1832 dbSNP
rs940532978 1839 dbSNP
rs1346361432 1844 dbSNP
rs907661735 1846 dbSNP
rs1180712408 1848 dbSNP
rs1253073739 1848 dbSNP
rs536388360 1848 dbSNP
rs993756904 1848 dbSNP
rs1478699511 1849 dbSNP
rs1191288471 1850 dbSNP
rs1394339937 1856 dbSNP
rs896293003 1857 dbSNP
rs1056625443 1858 dbSNP
rs1188990226 1860 dbSNP
rs1429314340 1862 dbSNP
rs1333072332 1867 dbSNP
rs937738304 1867 dbSNP
rs1274344908 1869 dbSNP
rs1437213963 1869 dbSNP
rs1369427816 1870 dbSNP
rs1231335571 1873 dbSNP
rs926316640 1874 dbSNP
rs1341943078 1876 dbSNP
rs1194467135 1877 dbSNP
rs1043404963 1879 dbSNP
rs1452984318 1880 dbSNP
rs987330521 1880 dbSNP
rs1452485220 1881 dbSNP
rs954433431 1881 dbSNP
rs921705518 1882 dbSNP
rs1308963049 1887 dbSNP
rs974362169 1887 dbSNP
rs1165955321 1889 dbSNP
rs1276442861 1889 dbSNP
rs1474932163 1889 dbSNP
rs988379797 1891 dbSNP
rs554316271 1892 dbSNP
rs2952321 1894 dbSNP
rs565310360 1895 dbSNP
rs1225623097 1896 dbSNP
rs1437867583 1896 dbSNP
rs922754269 1896 dbSNP
rs989509318 1896 dbSNP
rs1271962886 1902 dbSNP
rs1286322996 1902 dbSNP
rs200895427 1902 dbSNP
rs1210078345 1903 dbSNP
rs1299070039 1904 dbSNP
rs190003772 1906 dbSNP
rs1369810029 1907 dbSNP
rs1446363763 1909 dbSNP
rs1036236509 1912 dbSNP
rs1003058887 1915 dbSNP
rs1303983350 1916 dbSNP
rs1005492649 1918 dbSNP
rs1164535028 1926 dbSNP
rs1415992109 1934 dbSNP
rs868364447 1935 dbSNP
rs1321312124 1943 dbSNP
rs1384788321 1947 dbSNP
rs905926899 1948 dbSNP
rs1429278671 1954 dbSNP
rs1341496638 1976 dbSNP
rs951362289 1977 dbSNP
rs1026664785 1980 dbSNP
rs993395760 1994 dbSNP
rs558633415 1997 dbSNP
rs995498340 1999 dbSNP
rs1056298916 2002 dbSNP
rs1349858871 2003 dbSNP
rs898528170 2006 dbSNP
rs1174562004 2010 dbSNP
rs531689913 2010 dbSNP
rs1434468391 2016 dbSNP
rs1037038172 2019 dbSNP
rs940569932 2029 dbSNP
rs886370727 2030 dbSNP
rs577217867 2031 dbSNP
rs569893265 2036 dbSNP
rs1253751430 2041 dbSNP
rs1159991936 2043 dbSNP
rs1363355227 2044 dbSNP
rs1452234269 2049 dbSNP
rs1196203370 2051 dbSNP
rs1174869497 2065 dbSNP
rs1403567777 2069 dbSNP
rs1414487236 2071 dbSNP
rs933179981 2077 dbSNP
rs1353178368 2082 dbSNP
rs1411343068 2085 dbSNP
rs185935646 2095 dbSNP
rs1235235095 2096 dbSNP
rs1257635663 2098 dbSNP
rs1325770680 2100 dbSNP
rs1345640683 2101 dbSNP
rs1283945549 2105 dbSNP
rs1409477695 2108 dbSNP
rs946377913 2122 dbSNP
rs182715379 2124 dbSNP
rs567644921 2125 dbSNP
rs763179994 2146 dbSNP
rs947073014 2148 dbSNP
rs1417355625 2150 dbSNP
rs914186117 2155 dbSNP
rs1053119260 2157 dbSNP
rs1434716401 2163 dbSNP
rs191559579 2164 dbSNP
rs922794046 2165 dbSNP
rs1392395464 2166 dbSNP
rs112126392 2168 dbSNP
rs964121632 2169 dbSNP
rs1298357840 2170 dbSNP
rs6780780 2173 dbSNP
rs984142754 2174 dbSNP
rs1371630745 2177 dbSNP
rs372277356 2180 dbSNP
rs1344092502 2182 dbSNP
rs1157726308 2190 dbSNP
rs1204998821 2190 dbSNP
rs1471308174 2196 dbSNP
rs972430804 2200 dbSNP
rs970247092 2204 dbSNP
rs1035294728 2207 dbSNP
rs1454203976 2208 dbSNP
rs200165106 2208 dbSNP
rs1392607002 2216 dbSNP
rs1441635976 2220 dbSNP
rs6780504 2242 dbSNP
rs1202126783 2244 dbSNP
rs1460208710 2246 dbSNP
rs562786219 2254 dbSNP
rs1394642074 2255 dbSNP
rs898587477 2256 dbSNP
rs1323762096 2259 dbSNP
rs11715976 2262 dbSNP
rs1214873107 2282 dbSNP
rs543009236 2290 dbSNP
rs1294675105 2291 dbSNP
rs1004236084 2293 dbSNP
rs1247323017 2295 dbSNP
rs1267392309 2304 dbSNP
rs1010619898 2308 dbSNP
rs1327146739 2310 dbSNP
rs1281560411 2314 dbSNP
rs1239953353 2316 dbSNP
rs886338553 2319 dbSNP
rs892163277 2322 dbSNP
rs1398342196 2325 dbSNP
rs1417883406 2340 dbSNP
rs2705514 2343 dbSNP
rs1166521883 2350 dbSNP
rs933149023 2352 dbSNP
rs900384263 2354 dbSNP
rs61686198 2356 dbSNP
rs947093225 2366 dbSNP
rs1323313799 2371 dbSNP
rs914343008 2373 dbSNP
rs1158797393 2376 dbSNP
rs1039911335 2390 dbSNP
rs1053178674 2391 dbSNP
rs1472229917 2395 dbSNP
rs1294084819 2397 dbSNP
rs1334463075 2399 dbSNP
rs781731734 2400 dbSNP
rs910021005 2405 dbSNP
rs928862386 2411 dbSNP
rs1318031066 2417 dbSNP
rs1215763426 2423 dbSNP
rs1240687247 2425 dbSNP
rs981728071 2425 dbSNP
rs149268935 2426 dbSNP
rs2705515 2446 dbSNP
rs916046443 2450 dbSNP
rs1463606526 2452 dbSNP
rs1286361778 2461 dbSNP
rs1205968570 2465 dbSNP
rs960932349 2473 dbSNP
rs1343391292 2475 dbSNP
rs545724130 2475 dbSNP
rs1467339852 2476 dbSNP
rs1282617457 2477 dbSNP
rs1034956274 2494 dbSNP
rs1355051784 2501 dbSNP
rs200523144 2504 dbSNP
rs1290264228 2512 dbSNP
rs1374195383 2514 dbSNP
rs963095160 2517 dbSNP
rs1248693514 2518 dbSNP
rs187630054 2533 dbSNP
rs980650272 2541 dbSNP
rs969211538 2542 dbSNP
rs1211963220 2550 dbSNP
rs1297512616 2557 dbSNP
rs201665915 2558 dbSNP
rs545157487 2571 dbSNP
rs1485127269 2575 dbSNP
rs1004609192 2584 dbSNP
rs746525241 2586 dbSNP
rs1318358060 2588 dbSNP
rs1470152650 2597 dbSNP
rs1176136144 2598 dbSNP
rs1404210116 2605 dbSNP
rs1416173150 2611 dbSNP
rs777207010 2620 dbSNP
rs955436801 2626 dbSNP
rs768634087 2635 dbSNP
rs997351137 2639 dbSNP
rs1186612347 2647 dbSNP
rs900438022 2652 dbSNP
rs1277859772 2654 dbSNP
rs182022105 2657 dbSNP
rs752389572 2663 dbSNP
rs778614416 2667 dbSNP
rs1346117543 2669 dbSNP
rs892862593 2670 dbSNP
rs1451091499 2674 dbSNP
rs1438047761 2676 dbSNP
rs1203197125 2679 dbSNP
rs900808001 2685 dbSNP
rs11715040 2700 dbSNP
rs1455518323 2707 dbSNP
rs1288065137 2715 dbSNP
rs1225005835 2718 dbSNP
rs1360631299 2723 dbSNP
rs1169442718 2731 dbSNP
rs754782573 2735 dbSNP
rs1274303798 2741 dbSNP
rs1409675280 2746 dbSNP
rs1039942163 2752 dbSNP
rs1351726779 2759 dbSNP
rs1441772844 2766 dbSNP
rs753527866 2774 dbSNP
rs1364744374 2780 dbSNP
rs1325760993 2789 dbSNP
rs1023682166 2797 dbSNP
rs562934126 2808 dbSNP
rs1230982541 2809 dbSNP
rs1435201767 2810 dbSNP
rs562530075 2816 dbSNP
rs1213681782 2819 dbSNP
rs189569066 2830 dbSNP
rs1469389156 2834 dbSNP
rs2101632 2841 dbSNP
rs1369742792 2852 dbSNP
rs760626079 2858 dbSNP
rs1045433769 2863 dbSNP
rs185837542 2868 dbSNP
rs1195055649 2870 dbSNP
rs11923569 2872 dbSNP
rs1475189935 2873 dbSNP
rs1166328533 2879 dbSNP
rs138552948 2894 dbSNP
rs1461977008 2897 dbSNP
rs962939869 2898 dbSNP
rs938704357 2904 dbSNP
rs1477780485 2905 dbSNP
rs908613355 2917 dbSNP
rs982928455 2918 dbSNP
rs1326254912 2920 dbSNP
rs1201885669 2926 dbSNP
rs1490562221 2927 dbSNP
rs980722461 2933 dbSNP
rs1251314169 2943 dbSNP
rs1233294365 2944 dbSNP
rs551454778 2948 dbSNP
rs1029585720 2949 dbSNP
rs1332573232 2950 dbSNP
rs915105497 2956 dbSNP
rs1262379596 2991 dbSNP
rs1446161667 2998 dbSNP
rs996818802 2999 dbSNP
rs964577575 3008 dbSNP
rs1259788822 3021 dbSNP
rs1475694241 3026 dbSNP
rs1017501892 3038 dbSNP
rs144565739 3041 dbSNP
rs893007112 3056 dbSNP
rs1159615806 3058 dbSNP
rs542938281 3063 dbSNP
rs181325953 3064 dbSNP
rs1349538194 3067 dbSNP
rs1315188687 3068 dbSNP
rs763155058 3070 dbSNP
rs1356971240 3072 dbSNP
rs906963824 3079 dbSNP
rs1415081398 3086 dbSNP
rs1045400920 3091 dbSNP
rs948391057 3099 dbSNP
rs1305777886 3105 dbSNP
rs1444194734 3106 dbSNP
rs75570880 3112 dbSNP
rs529506518 3115 dbSNP
rs1261177844 3121 dbSNP
rs1349872638 3123 dbSNP
rs1203152609 3127 dbSNP
rs965077756 3129 dbSNP
rs775756071 3130 dbSNP
rs1210492520 3133 dbSNP
rs1412632903 3136 dbSNP
rs1038650015 3138 dbSNP
rs1182641357 3144 dbSNP
rs1363663236 3160 dbSNP
rs1469115477 3164 dbSNP
rs188521401 3166 dbSNP
rs1376495829 3179 dbSNP
rs759973673 3183 dbSNP
rs554257650 3187 dbSNP
rs908672128 3190 dbSNP
rs1480790075 3193 dbSNP
rs547298516 3194 dbSNP
rs776910751 3208 dbSNP
rs527276217 3209 dbSNP
rs1180283504 3220 dbSNP
rs1335077817 3223 dbSNP
rs1237928343 3224 dbSNP
rs771439075 3228 dbSNP
rs1348282102 3229 dbSNP
rs1431430242 3238 dbSNP
rs1057218886 3239 dbSNP
rs1278394751 3241 dbSNP
rs938762195 3243 dbSNP
rs927312248 3244 dbSNP
rs975370030 3245 dbSNP
rs747499866 3258 dbSNP
rs964045864 3261 dbSNP
rs1044402315 3267 dbSNP
rs564913634 3278 dbSNP
rs538906889 3280 dbSNP
rs1454062320 3282 dbSNP
rs1172167920 3284 dbSNP
rs1441152379 3288 dbSNP
rs1375565038 3293 dbSNP
rs1265508936 3301 dbSNP
rs545118502 3313 dbSNP
rs772774829 3315 dbSNP
rs576158744 3317 dbSNP
rs957523717 3318 dbSNP
rs1031474973 3328 dbSNP
rs570020220 3329 dbSNP
rs1371661604 3331 dbSNP
rs1233212954 3337 dbSNP
rs999113010 3338 dbSNP
rs1299012824 3345 dbSNP
rs1309471408 3349 dbSNP
rs1225049008 3350 dbSNP
rs562579296 3358 dbSNP
rs976570791 3363 dbSNP
rs965495079 3367 dbSNP
rs1017924661 3385 dbSNP
rs1254100014 3406 dbSNP
rs1006495384 3428 dbSNP
rs952359421 3428 dbSNP
rs1024089931 3438 dbSNP
rs1429892065 3444 dbSNP
rs866680978 3449 dbSNP
rs1012581779 3454 dbSNP
rs1027200680 3460 dbSNP
rs894187278 3461 dbSNP
rs1445495922 3462 dbSNP
rs1038448950 3466 dbSNP
rs34588510 3473 dbSNP
rs397875755 3473 dbSNP
rs1166476573 3474 dbSNP
rs142671512 3486 dbSNP
rs1057481546 3492 dbSNP
rs1291549939 3494 dbSNP
rs1002985849 3495 dbSNP
rs905926683 3496 dbSNP
rs746102625 3500 dbSNP
rs1316298749 3515 dbSNP
rs947381049 3516 dbSNP
rs1053713328 3517 dbSNP
rs914544520 3517 dbSNP
rs935245229 3527 dbSNP
rs1486371999 3529 dbSNP
rs1186314654 3530 dbSNP
rs1260529346 3553 dbSNP
rs887372935 3559 dbSNP
rs771540961 3567 dbSNP
rs1189433536 3569 dbSNP
rs1418013310 3578 dbSNP
rs1460829802 3580 dbSNP
rs1162552914 3582 dbSNP
rs1047207012 3583 dbSNP
rs934187243 3585 dbSNP
rs922678803 3586 dbSNP
rs1454061453 3592 dbSNP
rs923834027 3592 dbSNP
rs1338696350 3603 dbSNP
rs781440594 3611 dbSNP
rs942789137 3620 dbSNP
rs915211020 3623 dbSNP
rs778651766 3631 dbSNP
rs1354854395 3635 dbSNP
rs1226708478 3637 dbSNP
rs573809079 3638 dbSNP
rs1318055287 3640 dbSNP
rs1215519474 3643 dbSNP
rs1284397372 3648 dbSNP
rs754548675 3650 dbSNP
rs1443141845 3656 dbSNP
rs535801329 3657 dbSNP
rs1472144177 3666 dbSNP
rs977239458 3673 dbSNP
rs1410061731 3674 dbSNP
rs553768869 3676 dbSNP
rs1419659600 3689 dbSNP
rs1158072315 3690 dbSNP
rs147341020 3699 dbSNP
rs534136667 3699 dbSNP
rs577611905 3700 dbSNP
rs386664702 3701 dbSNP
rs1204862115 3706 dbSNP
rs1464055788 3707 dbSNP
rs369835065 3708 dbSNP
rs1374678377 3709 dbSNP
rs1223766257 3712 dbSNP
rs73231340 3712 dbSNP
rs1307494563 3713 dbSNP
rs1350455926 3714 dbSNP
rs77378928 3715 dbSNP
rs1280515475 3716 dbSNP
rs796810259 3717 dbSNP
rs1234160541 3718 dbSNP
rs200950735 3718 dbSNP
rs3083431 3718 dbSNP
rs397755734 3718 dbSNP
rs869194222 3718 dbSNP
rs763722069 3720 dbSNP
rs767380051 3720 dbSNP
rs777667704 3720 dbSNP
rs796094277 3720 dbSNP
rs79919677 3720 dbSNP
rs1491300405 3721 dbSNP
rs775255842 3721 dbSNP
rs780325962 3721 dbSNP
rs1016573240 3722 dbSNP
rs1491339603 3722 dbSNP
rs1288670019 3723 dbSNP
rs1329849156 3723 dbSNP
rs1226452286 3724 dbSNP
rs1442091499 3724 dbSNP
rs1005650809 3725 dbSNP
rs1303206385 3725 dbSNP
rs1384720372 3726 dbSNP
rs1016120633 3727 dbSNP
rs1315647555 3727 dbSNP
rs1197470017 3728 dbSNP
rs1194019114 3729 dbSNP
rs1236221889 3729 dbSNP
rs887352065 3729 dbSNP
rs1245964700 3732 dbSNP
rs1477145375 3732 dbSNP
rs2638040 3732 dbSNP
rs1434204584 3733 dbSNP
rs1168700673 3734 dbSNP
rs1364575012 3734 dbSNP
rs1287150728 3735 dbSNP
rs372607190 3736 dbSNP
rs1325611391 3737 dbSNP
rs1346067383 3737 dbSNP
rs1433349687 3738 dbSNP
rs1164333188 3739 dbSNP
rs1217480583 3740 dbSNP
rs1222061287 3740 dbSNP
rs1255675214 3740 dbSNP
rs1336831765 3740 dbSNP
rs1362235285 3740 dbSNP
rs1389220182 3740 dbSNP
rs71633304 3740 dbSNP
rs13061026 3741 dbSNP
rs1402733171 3741 dbSNP
rs1423210908 3742 dbSNP
rs1387400786 3744 dbSNP
rs573852188 3752 dbSNP
rs1360755679 3755 dbSNP
rs1399069030 3756 dbSNP
rs749117127 3757 dbSNP
rs1275726261 3762 dbSNP
rs1047794662 3769 dbSNP
rs1233391981 3775 dbSNP
rs1283469273 3777 dbSNP
rs998305063 3799 dbSNP
rs1449348894 3800 dbSNP
rs952383826 3813 dbSNP
rs866315919 3826 dbSNP
rs1260216714 3829 dbSNP
rs2952320 3830 dbSNP
rs1214676117 3837 dbSNP
rs1259898499 3842 dbSNP
rs973043607 3847 dbSNP
rs1186935279 3857 dbSNP
rs1367228720 3858 dbSNP
rs1471476461 3866 dbSNP
rs138093451 3879 dbSNP
rs1035884481 3885 dbSNP
rs1003468234 3892 dbSNP
rs1218836260 3899 dbSNP
rs906000516 3900 dbSNP
rs1396040591 3906 dbSNP
rs1023061699 3913 dbSNP
rs1292168749 3916 dbSNP
rs942758186 3924 dbSNP
rs567086248 3936 dbSNP
rs915329357 3937 dbSNP
rs1280097596 3951 dbSNP
rs756182967 3953 dbSNP
rs1340020551 3962 dbSNP
rs1053773568 3963 dbSNP
rs150355542 3969 dbSNP
rs1282653282 3972 dbSNP
rs533725192 3975 dbSNP
rs1362749388 3980 dbSNP
rs564772862 3983 dbSNP
rs1254229646 3985 dbSNP
rs1293167658 3988 dbSNP
rs1440033334 3993 dbSNP
rs1403278305 4002 dbSNP
rs1053523586 4013 dbSNP
rs759042418 4016 dbSNP
rs764315400 4018 dbSNP
rs1175924075 4019 dbSNP
rs1367878738 4021 dbSNP
rs1164650866 4028 dbSNP
rs902410673 4030 dbSNP
rs971307863 4031 dbSNP
rs1466275148 4037 dbSNP
rs917054984 4038 dbSNP
rs991306663 4044 dbSNP
rs1371907738 4047 dbSNP
rs1173154624 4048 dbSNP
rs1428597204 4049 dbSNP
rs943888146 4063 dbSNP
rs117256510 4065 dbSNP
rs1017069002 4066 dbSNP
rs559864588 4074 dbSNP
rs1444299409 4076 dbSNP
rs1490726580 4077 dbSNP
rs1269117728 4080 dbSNP
rs1005228086 4081 dbSNP
rs951082041 4088 dbSNP
rs1479529491 4091 dbSNP
rs931056322 4097 dbSNP
rs758522557 4098 dbSNP
rs998429410 4102 dbSNP
rs1196470497 4116 dbSNP
rs1238034595 4117 dbSNP
rs79789489 4117 dbSNP
rs1308170807 4121 dbSNP
rs1195867648 4122 dbSNP
rs1039873673 4123 dbSNP
rs1254062629 4124 dbSNP
rs553394946 4130 dbSNP
rs752677404 4133 dbSNP
rs562539150 4136 dbSNP
rs1375580914 4142 dbSNP
rs114975851 4144 dbSNP
rs961046020 4145 dbSNP
rs1399439058 4150 dbSNP
rs1036365451 4151 dbSNP
rs1327638284 4153 dbSNP
rs1303967214 4166 dbSNP
rs1409668755 4170 dbSNP
rs1386034263 4179 dbSNP
rs1394699306 4184 dbSNP
rs981654433 4187 dbSNP
rs1328431471 4197 dbSNP
rs1300431216 4201 dbSNP
rs1219322733 4202 dbSNP
rs1257571969 4203 dbSNP
rs1316559401 4203 dbSNP
rs1216052233 4216 dbSNP
rs759618725 4221 dbSNP
rs1462901731 4224 dbSNP
rs1488326359 4232 dbSNP
rs1376604931 4234 dbSNP
rs1189840830 4236 dbSNP
rs1173687966 4237 dbSNP
rs1054245536 4246 dbSNP
rs970219009 4247 dbSNP
rs567588083 4261 dbSNP
rs1429629164 4271 dbSNP
rs1422346584 4274 dbSNP
rs184553009 4284 dbSNP
rs1046422816 4285 dbSNP
rs1350413009 4286 dbSNP
rs1457161633 4290 dbSNP
rs949975961 4294 dbSNP
rs1291637053 4298 dbSNP
rs917151079 4302 dbSNP
rs1252338194 4303 dbSNP
rs540056659 4303 dbSNP
rs893199336 4304 dbSNP
rs991336437 4305 dbSNP
rs1031696036 4313 dbSNP
rs999280032 4316 dbSNP
rs1482865807 4334 dbSNP
rs1261150490 4335 dbSNP
rs1262914963 4347 dbSNP
rs1201909553 4349 dbSNP
rs958753173 4357 dbSNP
rs371358082 4368 dbSNP
rs192338466 4370 dbSNP
rs1284166369 4371 dbSNP
rs1486991824 4372 dbSNP
rs1189451762 4380 dbSNP
rs984318336 4383 dbSNP
rs951156635 4386 dbSNP
rs1350892825 4389 dbSNP
rs1041368782 4391 dbSNP
rs1162408023 4395 dbSNP
rs1334373902 4396 dbSNP
rs1025294711 4399 dbSNP
rs943955181 4399 dbSNP
rs997789273 4400 dbSNP
rs1416691529 4403 dbSNP
rs72942057 4406 dbSNP
rs889649474 4406 dbSNP
rs1018452749 4411 dbSNP
rs140327297 4413 dbSNP
rs1354808391 4414 dbSNP
rs893927124 4423 dbSNP
rs919686824 4430 dbSNP
rs1406096353 4431 dbSNP
rs761209778 4443 dbSNP
rs1000050615 4444 dbSNP
rs1211604952 4450 dbSNP
rs902585708 4452 dbSNP
rs1036751706 4457 dbSNP
rs189953046 4458 dbSNP
rs949339632 4462 dbSNP
rs981731318 4463 dbSNP
rs895746076 4464 dbSNP
rs1055683721 4465 dbSNP
rs1436867268 4473 dbSNP
rs970291317 4474 dbSNP
rs916113368 4476 dbSNP
rs937273831 4477 dbSNP
rs1445945989 4489 dbSNP
rs909743100 4496 dbSNP
rs983958766 4497 dbSNP
rs1446508910 4505 dbSNP
rs1307609236 4509 dbSNP
rs151190864 4514 dbSNP
rs957537730 4519 dbSNP
rs929740725 4526 dbSNP
rs566947053 4533 dbSNP
rs1423010799 4543 dbSNP
rs538545515 4551 dbSNP
rs1241270556 4554 dbSNP
rs185834084 4562 dbSNP
rs1207414668 4569 dbSNP
rs918312702 4571 dbSNP
rs1458203764 4574 dbSNP
rs1462720921 4580 dbSNP
rs2705517 4581 dbSNP
rs1204806722 4586 dbSNP
rs1348861309 4591 dbSNP
rs143731063 4596 dbSNP
rs1478903286 4598 dbSNP
rs1018891959 4609 dbSNP
rs1424741164 4610 dbSNP
rs1008127666 4613 dbSNP
rs1412767138 4613 dbSNP
rs551316478 4621 dbSNP
rs1240283468 4625 dbSNP
rs1382492731 4629 dbSNP
rs1401649122 4633 dbSNP
rs1313562933 4635 dbSNP
rs1329692510 4638 dbSNP
rs1373582019 4639 dbSNP
rs1454998406 4651 dbSNP
rs889680757 4658 dbSNP
rs193064549 4664 dbSNP
rs1018483672 4668 dbSNP
rs568913935 4669 dbSNP
rs958306262 4670 dbSNP
rs1158778897 4671 dbSNP
rs747726127 4675 dbSNP
rs543998318 4676 dbSNP
rs548802245 4676 dbSNP
rs939785570 4688 dbSNP
rs773670197 4692 dbSNP
rs1222037462 4693 dbSNP
rs1383088477 4694 dbSNP
rs1165416136 4699 dbSNP
rs1477198484 4705 dbSNP
rs902616352 4713 dbSNP
rs1025032513 4725 dbSNP
rs1013597983 4728 dbSNP
rs1477555741 4739 dbSNP
rs1045415354 4740 dbSNP
rs112146331 4742 dbSNP
rs528936534 4746 dbSNP
rs1323375665 4749 dbSNP
rs1348917793 4750 dbSNP
rs1433898993 4751 dbSNP
rs1279729155 4755 dbSNP
rs937285797 4757 dbSNP
rs916185203 4759 dbSNP
rs1358468918 4761 dbSNP
rs888353584 4765 dbSNP
rs990372500 4771 dbSNP
rs1450054543 4773 dbSNP
rs750047625 4773 dbSNP
rs1219027092 4778 dbSNP
rs11712849 4780 dbSNP
rs924765386 4785 dbSNP
rs1191677467 4790 dbSNP
rs929782729 4794 dbSNP
rs977941725 4795 dbSNP
rs918343664 4798 dbSNP
rs1338539629 4800 dbSNP
rs1163004969 4804 dbSNP
rs66791711 4812 dbSNP
rs1248844706 4813 dbSNP
rs780065882 4820 dbSNP
rs1007532871 4821 dbSNP
rs1398844543 4822 dbSNP
rs755944992 4830 dbSNP
rs1342175711 4831 dbSNP
rs1245486365 4833 dbSNP
rs761355656 4843 dbSNP
rs546023641 4846 dbSNP
rs187961316 4847 dbSNP
rs1242053896 4850 dbSNP
rs958553768 4852 dbSNP
rs898361077 4853 dbSNP
rs1327605664 4867 dbSNP
rs1032570720 4869 dbSNP
rs1214507947 4869 dbSNP
rs978677211 4872 dbSNP
rs1187395187 4880 dbSNP
rs66848262 4880 dbSNP
rs72145269 4880 dbSNP
rs759366862 4880 dbSNP
rs1363517584 4883 dbSNP
rs1004400193 4897 dbSNP
rs1159701996 4898 dbSNP
rs966831891 4900 dbSNP
rs1025148527 4909 dbSNP
rs2705518 4910 dbSNP
rs959433108 4912 dbSNP
rs1377998333 4921 dbSNP
rs1389541903 4921 dbSNP
rs948381252 4924 dbSNP
rs763560968 4926 dbSNP
rs1166085534 4934 dbSNP
rs1403676073 4944 dbSNP
rs1396131336 4945 dbSNP
rs760359563 4946 dbSNP
rs116096948 4958 dbSNP
rs1309769005 4960 dbSNP
rs1376398186 4966 dbSNP
rs1238192560 4990 dbSNP
rs1194198586 4991 dbSNP
rs1258006394 4998 dbSNP
rs1006200111 5007 dbSNP
rs1490237118 5009 dbSNP
rs888375459 5015 dbSNP
rs1199949256 5016 dbSNP
rs1048274528 5017 dbSNP
rs1225254554 5020 dbSNP
rs1459524594 5021 dbSNP
rs575222829 5021 dbSNP
rs757072749 5022 dbSNP
rs1438265202 5023 dbSNP
rs897033458 5028 dbSNP
rs73853917 5032 dbSNP
rs943818013 5036 dbSNP
rs1340885686 5040 dbSNP
rs910955405 5043 dbSNP
rs944846607 5050 dbSNP
rs1270230268 5052 dbSNP
rs1467154900 5055 dbSNP
rs911987585 5059 dbSNP
rs1222339069 5060 dbSNP
rs1049878463 5066 dbSNP
rs1303592041 5070 dbSNP
rs953380342 5071 dbSNP
rs1232607948 5073 dbSNP
rs1304566821 5085 dbSNP
rs558239700 5092 dbSNP
rs1027608727 5099 dbSNP
rs1258009692 5100 dbSNP
rs936319294 5103 dbSNP
rs1353638330 5111 dbSNP
rs974433449 5121 dbSNP
rs148953854 5127 dbSNP
rs1197508782 5133 dbSNP
rs1398771815 5135 dbSNP
rs1478529648 5137 dbSNP
rs962646672 5139 dbSNP
rs1015868973 5145 dbSNP
rs1004070786 5148 dbSNP
rs115702773 5156 dbSNP
rs978381893 5161 dbSNP
rs1391695290 5176 dbSNP
rs1386463345 5183 dbSNP
rs1301562885 5198 dbSNP
rs553207296 5201 dbSNP
rs540009900 5208 dbSNP
rs571082880 5210 dbSNP
rs532419897 5216 dbSNP
rs879467079 5221 dbSNP
rs992310886 5226 dbSNP
rs1480974089 5234 dbSNP
rs894187217 5239 dbSNP
rs1232613446 5244 dbSNP
rs557679306 5257 dbSNP
rs1244598305 5290 dbSNP
rs1033741027 5306 dbSNP
rs1208819624 5308 dbSNP
rs72942055 5314 dbSNP
rs1193833357 5315 dbSNP
rs903453135 5316 dbSNP
rs1426713366 5319 dbSNP
rs138309363 5351 dbSNP
rs1274295786 5352 dbSNP
rs1026730459 5356 dbSNP
rs1202549170 5357 dbSNP
rs944881615 5363 dbSNP
rs1400690054 5379 dbSNP
rs1297709913 5400 dbSNP
rs912019986 5410 dbSNP
rs1398259707 5413 dbSNP
rs994079042 5414 dbSNP
rs897064467 5419 dbSNP
rs1284812890 5420 dbSNP
rs1040880307 5421 dbSNP
rs1483140814 5422 dbSNP
rs1321438651 5424 dbSNP
rs1244240744 5426 dbSNP
rs376713444 5430 dbSNP
rs1355483121 5438 dbSNP
rs1372377653 5449 dbSNP
rs1277519462 5452 dbSNP
rs1444073051 5454 dbSNP
rs914857033 5461 dbSNP
rs1355095062 5464 dbSNP
rs1335991908 5469 dbSNP
rs769511816 5473 dbSNP
rs1241057176 5475 dbSNP
rs986217056 5481 dbSNP
rs1183480490 5504 dbSNP
rs1469355553 5509 dbSNP
rs889545884 5510 dbSNP
rs1049454669 5511 dbSNP
rs932059056 5519 dbSNP
rs1178876474 5524 dbSNP
rs1420583213 5525 dbSNP
rs920626311 5526 dbSNP
rs936334833 5537 dbSNP
rs1467659120 5543 dbSNP
rs1407490995 5549 dbSNP
rs962333153 5550 dbSNP
rs1015526664 5564 dbSNP
rs1311985674 5567 dbSNP
rs1471353683 5570 dbSNP
rs1234037817 5571 dbSNP
rs529537823 5572 dbSNP
rs560487922 5572 dbSNP
rs1283147537 5575 dbSNP
rs528900627 5576 dbSNP
rs1264434081 5579 dbSNP
rs1211628104 5580 dbSNP
rs1203948238 5581 dbSNP
rs1315997003 5585 dbSNP
rs1042065111 5587 dbSNP
rs1181490287 5590 dbSNP
rs1239725226 5592 dbSNP
rs1440099736 5612 dbSNP
rs1176774525 5614 dbSNP
rs945635574 5619 dbSNP
rs191684954 5626 dbSNP
rs551843403 5632 dbSNP
rs1434974279 5648 dbSNP
rs868295404 5658 dbSNP
rs1359074996 5663 dbSNP
rs992341867 5663 dbSNP
rs959535228 5669 dbSNP
rs958425237 5670 dbSNP
rs1033151578 5689 dbSNP
rs1333991831 5694 dbSNP
rs1401421927 5701 dbSNP
rs77236075 5703 dbSNP
rs926702545 5704 dbSNP
rs1446528772 5712 dbSNP
rs984932649 5713 dbSNP
rs1370818709 5714 dbSNP
rs1380731064 5723 dbSNP
rs952219482 5730 dbSNP
rs546407724 5740 dbSNP
rs972019888 5744 dbSNP
rs1322250942 5750 dbSNP
rs74938887 5754 dbSNP
rs1019459566 5755 dbSNP
rs1203640579 5760 dbSNP
rs1231382060 5762 dbSNP
rs1479156391 5769 dbSNP
rs1008021627 5770 dbSNP
rs1009099506 5796 dbSNP
rs889586116 5798 dbSNP
rs1028569474 5801 dbSNP
rs1424978546 5802 dbSNP
rs761050314 5805 dbSNP
rs1327342780 5808 dbSNP
rs147879635 5809 dbSNP
rs1163561242 5812 dbSNP
rs1352383556 5819 dbSNP
rs1438114845 5822 dbSNP
rs903584396 5823 dbSNP
rs1443287351 5825 dbSNP
rs187179388 5828 dbSNP
rs115738288 5833 dbSNP
rs117868230 5838 dbSNP
rs1213748715 5839 dbSNP
rs1270673200 5847 dbSNP
rs768074538 5851 dbSNP
rs1222524864 5853 dbSNP
rs144586237 5854 dbSNP
rs542172438 5857 dbSNP
rs1217485832 5858 dbSNP
rs1264520593 5861 dbSNP
rs182484546 5862 dbSNP
rs1166690124 5869 dbSNP
rs369569457 5873 dbSNP
rs926845788 5874 dbSNP
rs111441899 5879 dbSNP
rs77532706 5879 dbSNP
rs1299552397 5885 dbSNP
rs958498561 5889 dbSNP
rs1032769800 5894 dbSNP
rs78446749 5897 dbSNP
rs1361533480 5898 dbSNP
rs1228679311 5903 dbSNP
rs1291317199 5913 dbSNP
rs1357634994 5918 dbSNP
rs546266595 5919 dbSNP
rs768050571 5925 dbSNP
rs1446519339 5932 dbSNP
rs1396682461 5935 dbSNP
rs1191587156 5938 dbSNP
rs192009964 5939 dbSNP
rs775301312 5940 dbSNP
rs868812136 5943 dbSNP
rs769526780 5944 dbSNP
rs1183425346 5953 dbSNP
rs1020361075 5955 dbSNP
rs1422404870 5962 dbSNP
rs1287396920 5967 dbSNP
rs1009130827 5968 dbSNP
rs928759017 5978 dbSNP
rs537651577 5979 dbSNP
rs1019490602 5989 dbSNP
rs1361617406 6002 dbSNP
rs1316055426 6015 dbSNP
rs1050614873 6028 dbSNP
rs1302955657 6031 dbSNP
rs1423073692 6035 dbSNP
rs1380822972 6040 dbSNP
rs996315654 6043 dbSNP
rs1349960359 6047 dbSNP
rs899297840 6049 dbSNP
rs1281330703 6050 dbSNP
rs986772936 6052 dbSNP
rs1203400571 6055 dbSNP
rs1037793502 6066 dbSNP
rs575045649 6067 dbSNP
rs1028183203 6074 dbSNP
rs1427473876 6084 dbSNP
rs1364026463 6085 dbSNP
rs1469179596 6093 dbSNP
rs1156366826 6094 dbSNP
rs144508333 6099 dbSNP
rs1404242713 6101 dbSNP
rs1470288258 6113 dbSNP
rs563228856 6117 dbSNP
rs745660387 6127 dbSNP
rs2280066 6130 dbSNP
rs1020682899 6133 dbSNP
rs188287965 6152 dbSNP
rs1307969878 6158 dbSNP
rs1187943388 6159 dbSNP
rs1236942631 6161 dbSNP
rs1276727711 6165 dbSNP
rs770957597 6172 dbSNP
rs1203535715 6181 dbSNP
rs1261831518 6183 dbSNP
rs896192769 6186 dbSNP
rs991370496 6198 dbSNP
rs184129190 6200 dbSNP
rs958565971 6201 dbSNP
rs566380737 6203 dbSNP
rs1490760438 6204 dbSNP
rs905424394 6219 dbSNP
rs978566658 6224 dbSNP
rs1226588068 6226 dbSNP
rs1427193278 6236 dbSNP
rs1466978018 6239 dbSNP
rs967517424 6247 dbSNP
rs1049246903 6262 dbSNP
rs1389849215 6265 dbSNP
rs1019973602 6268 dbSNP
rs930777593 6269 dbSNP
rs1346167989 6270 dbSNP
rs373034808 6277 dbSNP
rs1281925744 6279 dbSNP
rs1320693754 6297 dbSNP
rs746914027 6324 dbSNP
rs1251148878 6326 dbSNP
rs1341383780 6327 dbSNP
rs987117236 6327 dbSNP
rs954351959 6328 dbSNP
rs1269021037 6339 dbSNP
rs1490368221 6340 dbSNP
rs919348228 6345 dbSNP
rs1266654647 6348 dbSNP
rs1403493016 6353 dbSNP
rs1367839262 6354 dbSNP
rs1171096335 6376 dbSNP
rs1294684566 6378 dbSNP
rs1461896083 6380 dbSNP
rs779089166 6381 dbSNP
rs533502265 6389 dbSNP
rs944788250 6394 dbSNP
rs1460289237 6397 dbSNP
rs1165152058 6400 dbSNP
rs771243648 6415 dbSNP
rs1366504529 6417 dbSNP
rs911923767 6424 dbSNP
rs1353230302 6428 dbSNP
rs1342905747 6434 dbSNP
rs899371052 6436 dbSNP
rs1295533425 6439 dbSNP
rs539191910 6444 dbSNP
rs1247524121 6445 dbSNP
rs570212788 6452 dbSNP
rs1293469820 6466 dbSNP
rs550317364 6471 dbSNP
rs1359771604 6475 dbSNP
rs1004998856 6477 dbSNP
rs1288908064 6489 dbSNP
rs1196834373 6498 dbSNP
rs1488997111 6499 dbSNP
rs755027620 6503 dbSNP
rs1481329204 6514 dbSNP
rs1426514791 6524 dbSNP
rs1189432345 6525 dbSNP
rs1386072321 6526 dbSNP
rs1424310545 6531 dbSNP
rs1267760781 6547 dbSNP
rs986521263 6548 dbSNP
rs954007923 6562 dbSNP
rs753866212 6564 dbSNP
rs147753427 6569 dbSNP
rs1288788620 6571 dbSNP
rs1360555889 6574 dbSNP
rs1479634717 6584 dbSNP
rs921153179 6596 dbSNP
rs1316216762 6598 dbSNP
rs1252949362 6603 dbSNP
rs560610086 6606 dbSNP
rs1312479953 6613 dbSNP
rs542307978 6616 dbSNP
rs1215971178 6617 dbSNP
rs1260061514 6618 dbSNP
rs1318613111 6622 dbSNP
rs1020797517 6627 dbSNP
rs1243489548 6629 dbSNP
rs1221894235 6633 dbSNP
rs574350937 6635 dbSNP
rs1313209782 6643 dbSNP
rs1382465805 6649 dbSNP
rs780286776 6656 dbSNP
rs1343913098 6657 dbSNP
rs771626974 6657 dbSNP
rs986883 6660 dbSNP
rs561988885 6667 dbSNP
rs905456147 6669 dbSNP
rs150057748 6672 dbSNP
rs1334280786 6674 dbSNP
rs1375149229 6677 dbSNP
rs750802387 6681 dbSNP
rs898034872 6686 dbSNP
rs1036479137 6696 dbSNP
rs944818021 6699 dbSNP
rs772227494 6706 dbSNP
rs911956314 6708 dbSNP
rs1201592886 6719 dbSNP
rs1234791993 6720 dbSNP
rs1050464237 6723 dbSNP
rs1176869510 6731 dbSNP
rs767763643 6736 dbSNP
rs1404706250 6737 dbSNP
rs945878706 6744 dbSNP
rs528470428 6749 dbSNP
rs1177711038 6754 dbSNP
rs1429275268 6761 dbSNP
rs117651366 6763 dbSNP
rs1333835700 6766 dbSNP
rs1377800716 6771 dbSNP
rs921194452 6774 dbSNP
rs762452382 6775 dbSNP
rs1370452409 6778 dbSNP
rs1406254907 6782 dbSNP
rs1283848935 6787 dbSNP
rs1322790149 6789 dbSNP
rs979798443 6789 dbSNP
rs967950036 6794 dbSNP
rs1221445375 6796 dbSNP
rs954381363 6811 dbSNP
rs913766794 6823 dbSNP
rs1028616187 6824 dbSNP
rs987953908 6828 dbSNP
rs975002336 6838 dbSNP
rs960463180 6853 dbSNP
rs2668223 6856 dbSNP
rs763713054 6857 dbSNP
rs969418856 6869 dbSNP
rs1170169076 6871 dbSNP
rs1238786958 6877 dbSNP
rs1420615785 6881 dbSNP
rs1315503062 6882 dbSNP
rs1027317740 6884 dbSNP
rs995081929 6888 dbSNP
rs1025063744 6899 dbSNP
rs577371765 6901 dbSNP
rs1344350502 6905 dbSNP
rs1036508863 6914 dbSNP
rs1008993079 6919 dbSNP
rs1362327801 6920 dbSNP
rs1454069300 6924 dbSNP
rs1402484346 6925 dbSNP
rs1271141703 6926 dbSNP
rs1361914114 6940 dbSNP
rs538662112 6944 dbSNP
rs1223287567 6946 dbSNP
rs1291066611 6948 dbSNP
rs762580125 6953 dbSNP
rs1289202947 6962 dbSNP
rs2172196 6973 dbSNP
rs937296701 6974 dbSNP
rs904458800 6980 dbSNP
rs1426116773 6984 dbSNP
rs1163865509 6999 dbSNP
rs544007026 7000 dbSNP
rs1403111882 7002 dbSNP
rs1320192221 7005 dbSNP
rs1358538418 7009 dbSNP
rs1345784938 7010 dbSNP
rs1429729707 7012 dbSNP
rs1268249524 7032 dbSNP
rs574964009 7033 dbSNP
rs1246934126 7034 dbSNP
rs1181841912 7037 dbSNP
rs945879516 7044 dbSNP
rs913027705 7048 dbSNP
rs1285565858 7061 dbSNP
rs1446986944 7069 dbSNP
rs932082992 7076 dbSNP
rs933065668 7084 dbSNP
rs1445626473 7086 dbSNP
rs1444138880 7095 dbSNP
rs925981272 7098 dbSNP
rs921634114 7105 dbSNP
rs1043049195 7107 dbSNP
rs974797902 7109 dbSNP
rs1408595336 7111 dbSNP
rs1204760733 7113 dbSNP
rs191838487 7124 dbSNP
rs1318493219 7126 dbSNP
rs1407938425 7130 dbSNP
rs563841774 7131 dbSNP
rs913796494 7140 dbSNP
rs769582201 7145 dbSNP
rs909461666 7149 dbSNP
rs1380935341 7150 dbSNP
rs1241251080 7175 dbSNP
rs1280165066 7176 dbSNP
rs1350088831 7181 dbSNP
rs1222501525 7184 dbSNP
rs983680540 7185 dbSNP
rs139379693 7196 dbSNP
rs1444728684 7200 dbSNP
rs1462036815 7200 dbSNP
rs927735703 7201 dbSNP
rs980967171 7202 dbSNP
rs969155541 7210 dbSNP
rs1440386500 7216 dbSNP
rs1183563358 7220 dbSNP
rs1027761118 7229 dbSNP
rs1469184521 7237 dbSNP
rs1313481586 7245