miRTarBase - #MIRT564336 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCNT1   
Synonyms CCNT, CYCT1, HIVE1
Description cyclin T1
Transcript NM_001240   
Expression
Putative miRNA Targets on CCNT1
3'UTR of CCNT1
(miRNA target sites are highlighted)
>CCNT1|NM_001240|3'UTR
   1 AAAAAGAAAAAGAAGAGGAGAAAAAAACTTCTTTAAAAAAACACATAATTTTTCTTTTTTTTTTTTGGACTAAGAAAATT
  81 ACTTATGAAATATGTCATCCTTGGACTAGGGAATAAATTGATATTGAGACATAGTTAGGAGGGTGGTAGAAGGCCTTGGC
 161 TATATATCTGCTGTCTCATGCATTTAACTATTTTCTTACAGTTTTTACTGGTATTAGAGAGGTGTTGAAGCTGTGAAGGA
 241 TTAAGGACACATTCTGAATTCTTGGCCTCTCCACCATCTAATTAGGTTGATTGGAGTTGATATCTTCCCTCTTCTTGCCA
 321 GAGCTGAAAAATGGAGGGTTTCTTGTATCAGACAATTGTGGATCCTTTCGGTGTTTAATATATCAGAAGAGAGGAAGTAT
 401 TTAAACGTCAAATCTTTTAATAGACTTAATAATTTAAAGAAAGTAAGTTATCTGTTTAGTTTTTTTATATAATTGGGAAG
 481 GGGATAGGGATTTTGCTGTGTGTATATGATACATAGCAGTAACTCCTGGTGGGTGGGATTGGAGGGTGGGAATGTGTGAG
 561 GGTGGGTGGGAGGCTAGGTTTTTGGCTAGGAGTTCTGAAATAGGCTCAGGCCACTTTTTTCAGACTTTTAAGTGTGTATG
 641 TAAGTGTGGGTATGTGTGTTTTTAAGTGTGTGTGTTTAAAAATAATGTTTTATCTTCCCTCCCTGTTCCTTACCGTTTTC
 721 ATTTTCCAACAGTCTACTAGAGAAAAACATGGTTGGCCTTGAGAACATAAAGGAAGAGGCATGTATTTGACATGGTATTT
 801 TTCCCTTTCTTTATGTTATAATTGAGTAGTAGCCCTCTAATTTGTAGTTTGGGCAAGTACAGCCAACACCCTGACTCTTA
 881 ACCTTATTATGAGAACTTCCTTTTTACCCCTTTTTTTGTTTTTGTGCAAAACAGAGATGGGGTTGAGGAAGGAGGGTTGG
 961 CGAGCAAGGCCAGCTTCTGCCCTACAGAATTGGGTGTGTCTTTTTTTTCAAGTGAGGCTTTGGGAAAGTGTTCAAATGAG
1041 AGCAGTCTTAAGGTCTCTAAGAGATGGGGAATGTGCTATGTATATCCTGCCTGTGAAAGCCCAAACCATATGGGAGAAGC
1121 TAGAGGATACTAAAAACAATGAAATTGTGATTTGGAAGTTTAGAACATTGTTTTAAAAATTACATTATAAATGTAAGACA
1201 TGCTTTTTATGTGTATATCCGAAGGGAAACAGCTACATCCTCAAGTTTTTGCAGCCTATATGACTTGAGATTGGAGCTTG
1281 TGAATTTAACAGTACTGGTGCCATGAGAATGAGCAAAGCCTAGCCAATGGATACTATTGTGTTTAGATTGTTCATCTTTG
1361 GTAGCTTTAGGTTCTTGATCGAGGTTCTTAAGATTTCTAAGTCCTTTATAAAAATAGGTCAAGAGTCCTGTTGTTATGGA
1441 GGCTTGATTATCCCAGATATTAGGAGTGAACATTTTTAATAAATCTTTCAGAAAATCTTGGCTAGAAAGAATTCTAAGTT
1521 AGTTGTCTAACCACTGAAAACTACCTAGCCAGAGATCATTTAATGAGATATTCTTTGATCTTCATTGCATTTTTTTTGCT
1601 CTGGAAAAGGTGGTTCAATTTGAGTTTGTTTTCATGATTTGATTGCAGCTTACTTCATGCCAAGGATTTTTTAGGGAGAG
1681 GTCGAATTATTTTTCATTTGGAAGTCATAGGGAGACAGGAGTTGTACTTATGCTGCTACTTGCCAGGAACAGGTTGGGAA
1761 GAAAATTGTGGCTGTTGGAATTGATGATGTACTGGCCTAATATAGAAAGGAATTTGTAGGCAGGAGTAAACGTTAACTGA
1841 CGGTGGGTTAGTGCCCTGCATCTTGCATATTTGAACTGTCTAGAGTTCCTGCCATTGCTGGGTATAAAACGAGGAGCTCT
1921 CTGTTGACCTGTAAATCATTAATACTTCTTGACTTAGAGTGTCACTTCACTTTATAGATGACATTTTCCTCTTTCCCCTT
2001 GATATTTTCTATGTTGTGTTAGATAATTGGTAGATATATAGTTGTGGTTTAGTACATTTAGGGCTTCTATTTATTTAGAT
2081 TTTGTTTGTTGGAGTCTGTTTCCAAAAGGGAATGTGCCATTTAGTCTGCATCTGTATCTTTGTGGACTTGATGATCACTG
2161 GTTTGATTTTGAAAAATGTCTTTTCCAGCTTTTAGTTACTCTCATCAAATGTCACATATTTTCTAATCACATGCACTCCT
2241 TTACCACAGAGGCACATAATCATTTGGCCTCATAGCAGTTATCCATGGCCGTACTGTAGTAAAGTTCCTTAGAACTTTGC
2321 CAGGAGTGAACTAGAAAAAAGTGCTTACTAGGGCCTAAGAGTTGCTTTGTGCCGTGTAGTCCGGCCTTTGCACTAGTAGA
2401 TCATTGCTGACATAGGTCAGTTTAGAGACCTTTCTGTGTTAATGCCTCCTGGTACTGTCTTAAGATACGTACAGTGTCTG
2481 TTTTTAGATCTATGCATATGTCATGAAGCTCCTTGTGGGCTCTGCATGAAGCTGCTGCTTTGTTTTTGGGTTAACAGATG
2561 TGCCTGTCAACTAGCATGTGTATTGTCCAAATTCCATAAACTTAAGGTTTTTAAGGGCTGTGTGGTTTCTGAGCTCTATG
2641 TGTCTTTCCTATCCTTGTACCTTCAAAGGGTGAGAAATGAGATTTATACATCCAAAGTTAGTCTGATAAATATGGCTTTT
2721 TGTTTCTCCATGTAACCTAGACTGTCAAAAATAAGTGATGGTGATAAGTAGGCCTGGAGCCTCAGCTTCTGTAAATCTCA
2801 TTCCTAAAATTTTGCTAGACTCGTGTTGGCAAAAACAAATACCTGTGGATTGTCCTTAAGGCTTTTAATCAGATACCTGT
2881 GTTGCTGTTAGCTGAACTGTAGTGAAGCATCGATCCAAATCGGTCTTCTGAAGTATCAGTTATGCTTTTGAGTTTAGAAA
2961 ATACTTAGGTGTTAGTCTAGTCTTCCCATTCATGAATCAGTGTATGTCCATATCAGAGAGCCTCAACTTCTTTTTTCTTC
3041 CTTTTTAAAAATGATTTTAGTGTTTTGATTTAGTGTATACTACATAGTTCAGTATTATTGGCTTTACCAGTGTTGACAGA
3121 AAAATTTTAAATCTCCAGTTGCAAACAGCAATGGATTAGGATATGGAAATAAAATCATGGTGACATCACTGCTGAGTTAT
3201 CTTAAACCTCTGCTACTTAATTCTCCATATTGAAATGCATACTCCTCCACATACATGGCTTCCAAGTAAAGGCAATTGTA
3281 GAGGGGCCCTGTCTATCCCAGTATGGTTGGATTTTAAACATATCTGTGTTTCCGTTATTTTGGGAACTGATTAATATTTA
3361 CAATTTTTTTTGTTTATGAGTTATTTTGATACTAAGAAAAGAGAGAATCTAGAACATCTTGCAGTTGAAATACAAATTTT
3441 ATTCTTTTGGTCTTGGGAGAATTTAAGCAGTCTATGCAACTCATCAAATGGTGAGAAATAGCCCTCCGAGGTTCCAGTAA
3521 GCTTTCAGTGACTTTGATACCTCCCCAAGTTTCTTGAGTTGCTGCTTGTTAACACCCAGCTTTTAACTGAGTGTTTGCTC
3601 CTGATGGTTTAGGAGATTTTCATGTTGTATCACACTGTCAAGTTTTATTTTGTCTTTTTATCCCTCCGTGGATGTGAGTT
3681 TGAAACAAGCACGGTACAGTAATCCTGCCTGATAGAGTAGTCTGGAATGAGAATTACTTTTTGGGTGAGAGAGTTCTCCA
3761 TTTTAATGTTTCTAAAGTTTTTCATATGAACTTGGCATTGGAAAAGGGAGGTAAAGAAAAAGGACGTTTACTAAAAGCAG
3841 TGTCTACTCTTCCCCTTTGTGAGTGTTTATTCATGGCTAATGAAAAAAAGAGAAGGACTCTTGGGTTTTGTGTTGCCATG
3921 TTAAGCATGGAGAGGGATGCTTGACAGCATGCTAATTGAAGCCAGAGCAAGTATGTCCTTCATCAGGTAATCAGGAACTC
4001 TTCAGTTGAAGCTGAGGAACTAACTGATTAGTTGTTGATCATAATATAATTGGTTACAAAGTGGAAGTGCCAGCTGGCTT
4081 AAGTACCCAAAGAAAAGAATGCAGCAGCCTAACTTAGTGTTACCATATGTTACTGAATTTGAAACTGACCTTTTTTCCCA
4161 CCCTACTTCACACACCTAAAACTCTTTTCTTGTCAGACCAAAGAGCGAAAAGAAAAAAAAAAGTAAAACACTTTACCAAT
4241 CTGTCACTCAGGTACAATTTTGTGGTGAGATTTTTGTCTGTTCTCTTTGTATTGCTCTTAAGAGTCCTTTCTCAGCATAT
4321 TATTCTGCCATTGCCTCTGTCTTCCTTGGGGCACCTCAGCTCTGGATGCTACCCCTGGGATATCTACTGCTGTTATGTGA
4401 ATGATAGGAGGTAAGTGACCATTATAGTAAGGGCTCTTTGTAAAAAAATTCAAAAAATTTAAAAAGGATGTATACATTTT
4481 ATAGTCTGGCTATCAGTTTGATATCTTGCTGTCAAGTATGTTTCTCAATCTGTATTTATCCATCCCATCAATAAATGTTA
4561 ATGGTAAAACACTCAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUU-GGUAAUAC-ACGACGAu 5'
            |||: :: ||: | ||||||| 
Target 5' ccCAAGTTTCTTGAGTTGCTGCTt 3'
3544 - 3567 152.00 -12.20
2
miRNA  3' guguuugGUAAUAC-ACGACGAu 5'
                 ||| | | ||||||| 
Target 5' ggctctgCATGAAGCTGCTGCTt 3'
2518 - 2540 151.00 -11.40
3
miRNA  3' guguuugguAAUACACGACGAu 5'
                   |||  ||||||| 
Target 5' gagttgtacTTA--TGCTGCTa 3'
1719 - 1738 145.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28152152 20 COSMIC
COSN31611733 20 COSMIC
COSN31882529 39 COSMIC
COSN31609314 48 COSMIC
COSN27312045 55 COSMIC
COSN6616158 506 COSMIC
COSN22584847 2077 COSMIC
COSN15661439 2344 COSMIC
COSN30235204 2925 COSMIC
COSN15013477 3113 COSMIC
COSN25338709 3157 COSMIC
COSN20690205 3756 COSMIC
COSN15663376 4187 COSMIC
COSN1148712 4212 COSMIC
COSN20092563 4467 COSMIC
COSN27941220 4544 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs956070965 2 dbSNP
rs1227243872 6 dbSNP
rs754431414 6 dbSNP
rs764779771 7 dbSNP
rs1242067147 8 dbSNP
rs1208086856 10 dbSNP
rs759022106 15 dbSNP
rs765877767 15 dbSNP
rs1224642295 17 dbSNP
rs1453398858 18 dbSNP
rs1179770127 19 dbSNP
rs1408420120 20 dbSNP
rs1487834903 28 dbSNP
rs762250252 28 dbSNP
rs759182549 30 dbSNP
rs776315666 31 dbSNP
rs1170065566 34 dbSNP
rs1471625586 34 dbSNP
rs770501985 38 dbSNP
rs142753905 39 dbSNP
rs760008891 40 dbSNP
rs754137865 42 dbSNP
rs773847860 42 dbSNP
rs985624541 42 dbSNP
rs1273145348 44 dbSNP
rs758303129 45 dbSNP
rs753220565 46 dbSNP
rs954337307 48 dbSNP
rs1314397521 51 dbSNP
rs1360237664 54 dbSNP
rs1268841410 63 dbSNP
rs1250809827 67 dbSNP
rs1349904204 67 dbSNP
rs397939805 67 dbSNP
rs878876519 67 dbSNP
rs1232957879 68 dbSNP
rs1353769351 69 dbSNP
rs1205465751 70 dbSNP
rs925388258 71 dbSNP
rs1291250716 72 dbSNP
rs755705045 79 dbSNP
rs1186387770 81 dbSNP
rs777085364 86 dbSNP
rs978973449 96 dbSNP
rs968568817 97 dbSNP
rs1445889993 104 dbSNP
rs552696437 117 dbSNP
rs966742950 139 dbSNP
rs1159439691 143 dbSNP
rs1453711582 143 dbSNP
rs1387609032 148 dbSNP
rs1394709278 149 dbSNP
rs1012835886 164 dbSNP
rs1336312915 166 dbSNP
rs1020929805 170 dbSNP
rs959734173 177 dbSNP
rs1288157270 180 dbSNP
rs1013930325 199 dbSNP
rs1035277692 213 dbSNP
rs1390278608 221 dbSNP
rs184485934 222 dbSNP
rs757993014 222 dbSNP
rs770720849 224 dbSNP
rs1460635223 244 dbSNP
rs546725259 259 dbSNP
rs897547796 269 dbSNP
rs750308680 273 dbSNP
rs138269748 275 dbSNP
rs1418944760 280 dbSNP
rs1002064481 296 dbSNP
rs1366123585 300 dbSNP
rs1464827041 310 dbSNP
rs1190080072 315 dbSNP
rs887597034 317 dbSNP
rs1407067688 324 dbSNP
rs1048830327 329 dbSNP
rs993205381 334 dbSNP
rs1006156437 337 dbSNP
rs1392104634 338 dbSNP
rs897497406 351 dbSNP
rs1185350987 356 dbSNP
rs1039981889 363 dbSNP
rs75963962 368 dbSNP
rs944306932 369 dbSNP
rs1050463784 371 dbSNP
rs1487127322 374 dbSNP
rs1197075496 380 dbSNP
rs181579571 382 dbSNP
rs932854676 391 dbSNP
rs571512363 406 dbSNP
rs1430447657 407 dbSNP
rs922601078 411 dbSNP
rs1333001794 425 dbSNP
rs1041044581 427 dbSNP
rs563300797 428 dbSNP
rs934746086 432 dbSNP
rs1354209431 438 dbSNP
rs924718565 446 dbSNP
rs1299993091 448 dbSNP
rs979517640 449 dbSNP
rs1197322041 451 dbSNP
rs1303469476 454 dbSNP
rs1294569000 463 dbSNP
rs1380508979 466 dbSNP
rs1216639096 467 dbSNP
rs1367232259 469 dbSNP
rs1307759833 472 dbSNP
rs945410217 473 dbSNP
rs978852810 481 dbSNP
rs1489987520 483 dbSNP
rs1222384790 484 dbSNP
rs1270323317 489 dbSNP
rs1439459632 490 dbSNP
rs968997680 500 dbSNP
rs1185195093 501 dbSNP
rs557973500 513 dbSNP
rs915112863 517 dbSNP
rs1164575877 520 dbSNP
rs560229433 525 dbSNP
rs1429373090 533 dbSNP
rs1172537159 543 dbSNP
rs1383475405 546 dbSNP
rs1424159645 547 dbSNP
rs188369000 551 dbSNP
rs991825034 558 dbSNP
rs1458095816 559 dbSNP
rs1397881811 561 dbSNP
rs1372921390 563 dbSNP
rs1168744555 567 dbSNP
rs959923227 589 dbSNP
rs1035330153 591 dbSNP
rs111669929 612 dbSNP
rs961669712 618 dbSNP
rs1383578662 621 dbSNP
rs1310213538 626 dbSNP
rs1358105596 629 dbSNP
rs546695894 632 dbSNP
rs868442853 634 dbSNP
rs1249144587 637 dbSNP
rs1193109658 639 dbSNP
rs536685216 640 dbSNP
rs10545793 643 dbSNP
rs868763268 643 dbSNP
rs1005962771 656 dbSNP
rs888619863 666 dbSNP
rs1486283887 667 dbSNP
rs1210725072 670 dbSNP
rs1241602832 671 dbSNP
rs1049882444 672 dbSNP
rs1164348240 685 dbSNP
rs1027404418 686 dbSNP
rs997120737 692 dbSNP
rs567531785 693 dbSNP
rs1224918207 703 dbSNP
rs993215228 705 dbSNP
rs1158035100 708 dbSNP
rs1345555895 709 dbSNP
rs551101767 714 dbSNP
rs901397373 715 dbSNP
rs530903602 721 dbSNP
rs565144701 724 dbSNP
rs867930879 729 dbSNP
rs1019093446 737 dbSNP
rs1344259283 741 dbSNP
rs1298176602 744 dbSNP
rs1232940471 745 dbSNP
rs777211682 749 dbSNP
rs1368241899 767 dbSNP
rs1452669068 775 dbSNP
rs1316575869 776 dbSNP
rs1385531884 781 dbSNP
rs1041305877 787 dbSNP
rs1324935230 809 dbSNP
rs1284246003 813 dbSNP
rs1317891114 814 dbSNP
rs934672695 821 dbSNP
rs771593385 828 dbSNP
rs888772190 832 dbSNP
rs1050051944 833 dbSNP
rs1043570678 837 dbSNP
rs1184240918 846 dbSNP
rs1395277153 854 dbSNP
rs947461736 860 dbSNP
rs904031963 862 dbSNP
rs1391338549 868 dbSNP
rs551512371 869 dbSNP
rs1173487452 874 dbSNP
rs141566764 878 dbSNP
rs991252083 882 dbSNP
rs914010337 890 dbSNP
rs1469999989 891 dbSNP
rs528780844 893 dbSNP
rs559961563 897 dbSNP
rs928577546 908 dbSNP
rs971951507 910 dbSNP
rs962048584 911 dbSNP
rs1374754444 912 dbSNP
rs1202783693 914 dbSNP
rs111954157 918 dbSNP
rs980716560 918 dbSNP
rs1483877790 924 dbSNP
rs1275089069 926 dbSNP
rs1265307356 927 dbSNP
rs1203980551 938 dbSNP
rs951929786 938 dbSNP
rs542932891 947 dbSNP
rs1471137481 950 dbSNP
rs971897186 954 dbSNP
rs1428356439 955 dbSNP
rs1342753031 956 dbSNP
rs184070660 961 dbSNP
rs1408837188 962 dbSNP
rs1328969055 963 dbSNP
rs1233285904 966 dbSNP
rs1355581023 966 dbSNP
rs1334824653 970 dbSNP
rs1345272355 972 dbSNP
rs953133715 973 dbSNP
rs1028923523 984 dbSNP
rs1304340006 985 dbSNP
rs1224557293 988 dbSNP
rs1276809686 996 dbSNP
rs191148777 999 dbSNP
rs1018730433 1000 dbSNP
rs1273814227 1002 dbSNP
rs79499694 1008 dbSNP
rs1312639165 1009 dbSNP
rs997045723 1013 dbSNP
rs754873184 1017 dbSNP
rs1201378480 1019 dbSNP
rs1029045483 1029 dbSNP
rs1404933172 1033 dbSNP
rs537193448 1035 dbSNP
rs189312399 1043 dbSNP
rs17123259 1044 dbSNP
rs1162191687 1046 dbSNP
rs1184697200 1050 dbSNP
rs945555538 1053 dbSNP
rs1324840288 1054 dbSNP
rs1473036129 1055 dbSNP
rs576045244 1061 dbSNP
rs1344400558 1064 dbSNP
rs1186915843 1069 dbSNP
rs1056589890 1073 dbSNP
rs1280585329 1084 dbSNP
rs1200545579 1106 dbSNP
rs1360095517 1106 dbSNP
rs1259401160 1127 dbSNP
rs185599019 1131 dbSNP
rs554581346 1132 dbSNP
rs1055786840 1141 dbSNP
rs1442220744 1145 dbSNP
rs930628379 1146 dbSNP
rs1385114840 1154 dbSNP
rs148383623 1161 dbSNP
rs1425851092 1166 dbSNP
rs1165306881 1167 dbSNP
rs1383245623 1170 dbSNP
rs1400558210 1176 dbSNP
rs535198860 1181 dbSNP
rs535848554 1190 dbSNP
rs1450476881 1192 dbSNP
rs535382520 1193 dbSNP
rs911677354 1200 dbSNP
rs765865940 1210 dbSNP
rs953220768 1219 dbSNP
rs1413268957 1220 dbSNP
rs193149143 1221 dbSNP
rs908889478 1229 dbSNP
rs1202413799 1230 dbSNP
rs1459729978 1230 dbSNP
rs984445019 1233 dbSNP
rs1335362013 1235 dbSNP
rs953149815 1237 dbSNP
rs565307133 1244 dbSNP
rs777138809 1258 dbSNP
rs1159532206 1262 dbSNP
rs766845004 1267 dbSNP
rs1400630452 1271 dbSNP
rs1336094920 1274 dbSNP
rs965571993 1280 dbSNP
rs1019761379 1283 dbSNP
rs763680659 1286 dbSNP
rs1304760078 1290 dbSNP
rs760326715 1290 dbSNP
rs1161428659 1296 dbSNP
rs1009817801 1300 dbSNP
rs999112771 1301 dbSNP
rs1417373708 1314 dbSNP
rs1289988434 1316 dbSNP
rs1057001067 1322 dbSNP
rs903414253 1327 dbSNP
rs1022279187 1333 dbSNP
rs1003642394 1335 dbSNP
rs1483928192 1336 dbSNP
rs1193620722 1341 dbSNP
rs1248973699 1347 dbSNP
rs113694883 1355 dbSNP
rs537149587 1362 dbSNP
rs1183255284 1365 dbSNP
rs1479692612 1370 dbSNP
rs775792534 1371 dbSNP
rs1239140639 1379 dbSNP
rs1175968051 1380 dbSNP
rs1430309126 1384 dbSNP
rs1467608168 1390 dbSNP
rs1296559669 1393 dbSNP
rs571378291 1399 dbSNP
rs1188245849 1404 dbSNP
rs1395608380 1405 dbSNP
rs1446344834 1407 dbSNP
rs1309841219 1410 dbSNP
rs1245721117 1418 dbSNP
rs551573925 1427 dbSNP
rs894463311 1430 dbSNP
rs1222714374 1437 dbSNP
rs1210013991 1443 dbSNP
rs1329457793 1446 dbSNP
rs1283498587 1455 dbSNP
rs1313610258 1459 dbSNP
rs1055839468 1460 dbSNP
rs1226966858 1466 dbSNP
rs938733403 1467 dbSNP
rs907047693 1472 dbSNP
rs930680743 1473 dbSNP
rs920593610 1476 dbSNP
rs1489956314 1479 dbSNP
rs1199179664 1485 dbSNP
rs528717959 1488 dbSNP
rs559667124 1489 dbSNP
rs1285138070 1501 dbSNP
rs17123255 1502 dbSNP
rs547304984 1504 dbSNP
rs1170382393 1505 dbSNP
rs1363689197 1506 dbSNP
rs987688496 1528 dbSNP
rs529550110 1531 dbSNP
rs1369199508 1532 dbSNP
rs1380179469 1533 dbSNP
rs953222125 1545 dbSNP
rs1230024118 1554 dbSNP
rs114935451 1558 dbSNP
rs1357971383 1568 dbSNP
rs978498239 1569 dbSNP
rs931706688 1571 dbSNP
rs921592195 1580 dbSNP
rs1184994920 1584 dbSNP
rs1019920819 1585 dbSNP
rs1261350561 1586 dbSNP
rs1407291748 1598 dbSNP
rs975838632 1600 dbSNP
rs1415768261 1601 dbSNP
rs1163600785 1618 dbSNP
rs965749284 1620 dbSNP
rs1423934597 1627 dbSNP
rs957148639 1630 dbSNP
rs772894669 1631 dbSNP
rs1287890185 1632 dbSNP
rs145173258 1634 dbSNP
rs1381155390 1637 dbSNP
rs1245867153 1639 dbSNP
rs1189955398 1647 dbSNP
rs967929274 1651 dbSNP
rs1021915972 1652 dbSNP
rs1218998808 1653 dbSNP
rs1452949737 1654 dbSNP
rs1260310841 1664 dbSNP
rs1291080121 1665 dbSNP
rs1465538564 1666 dbSNP
rs927899419 1670 dbSNP
rs1241372803 1673 dbSNP
rs905352986 1676 dbSNP
rs1182367123 1677 dbSNP
rs958706161 1681 dbSNP
rs1034273359 1684 dbSNP
rs1002930802 1690 dbSNP
rs1158148052 1693 dbSNP
rs71439461 1695 dbSNP
rs1229242309 1697 dbSNP
rs1458505425 1706 dbSNP
rs577466299 1708 dbSNP
rs1404717896 1713 dbSNP
rs1036392839 1731 dbSNP
rs1004743290 1742 dbSNP
rs887606056 1745 dbSNP
rs1285281773 1747 dbSNP
rs1291846180 1750 dbSNP
rs182881550 1751 dbSNP
rs1350655054 1762 dbSNP
rs1306740578 1766 dbSNP
rs931859161 1768 dbSNP
rs1204835362 1775 dbSNP
rs564206791 1779 dbSNP
rs1460900205 1781 dbSNP
rs921602121 1788 dbSNP
rs541108641 1793 dbSNP
rs1428800186 1798 dbSNP
rs1210970705 1801 dbSNP
rs1040041027 1802 dbSNP
rs572252794 1803 dbSNP
rs771519239 1807 dbSNP
rs747727988 1809 dbSNP
rs1176358233 1814 dbSNP
rs1412425970 1815 dbSNP
rs1473489199 1817 dbSNP
rs1449987873 1819 dbSNP
rs1394002222 1831 dbSNP
rs1428229769 1832 dbSNP
rs1414497160 1838 dbSNP
rs1188914031 1840 dbSNP
rs1335656268 1841 dbSNP
rs1478826302 1842 dbSNP
rs1440661323 1845 dbSNP
rs1347810956 1847 dbSNP
rs1351482655 1848 dbSNP
rs931839529 1853 dbSNP
rs1281587093 1867 dbSNP
rs1204288176 1882 dbSNP
rs967603784 1899 dbSNP
rs1219820241 1903 dbSNP
rs914691203 1910 dbSNP
rs990417839 1911 dbSNP
rs1203727444 1929 dbSNP
rs1252506983 1936 dbSNP
rs555264142 1949 dbSNP
rs1483903198 1957 dbSNP
rs1277209477 1960 dbSNP
rs1267687897 1963 dbSNP
rs1206575982 1978 dbSNP
rs1478153029 1988 dbSNP
rs921758527 1991 dbSNP
rs1299334464 1995 dbSNP
rs978508130 1997 dbSNP
rs958924174 2002 dbSNP
rs1034325896 2003 dbSNP
rs1220969414 2004 dbSNP
rs141179863 2011 dbSNP
rs1412009658 2015 dbSNP
rs1279114782 2016 dbSNP
rs1330685786 2025 dbSNP
rs912914859 2029 dbSNP
rs576208410 2030 dbSNP
rs959714858 2037 dbSNP
rs1015050395 2038 dbSNP
rs982382639 2040 dbSNP
rs1344270831 2078 dbSNP
rs1219889599 2079 dbSNP
rs1290773514 2085 dbSNP
rs1452021468 2087 dbSNP
rs1309595314 2101 dbSNP
rs1200539504 2102 dbSNP
rs969964722 2109 dbSNP
rs1474781756 2110 dbSNP
rs1188664920 2111 dbSNP
rs1391280213 2112 dbSNP
rs1005369675 2116 dbSNP
rs1432185658 2119 dbSNP
rs1162287116 2134 dbSNP
rs887627694 2142 dbSNP
rs1390461748 2145 dbSNP
rs1023725775 2148 dbSNP
rs1325752107 2156 dbSNP
rs538504170 2156 dbSNP
rs1434416177 2158 dbSNP
rs556956418 2169 dbSNP
rs1298431777 2171 dbSNP
rs192159892 2174 dbSNP
rs1014945551 2178 dbSNP
rs779891847 2186 dbSNP
rs1005323631 2187 dbSNP
rs749892587 2194 dbSNP
rs1040295098 2199 dbSNP
rs1211467626 2200 dbSNP
rs944391424 2201 dbSNP
rs1446096411 2203 dbSNP
rs902172458 2204 dbSNP
rs755925225 2206 dbSNP
rs1176336621 2210 dbSNP
rs931878127 2212 dbSNP
rs1182252514 2214 dbSNP
rs1368450310 2216 dbSNP
rs747246915 2228 dbSNP
rs914763063 2234 dbSNP
rs990693943 2236 dbSNP
rs1456925734 2238 dbSNP
rs1321533327 2255 dbSNP
rs1042881533 2256 dbSNP
rs1183310633 2258 dbSNP
rs1485649511 2263 dbSNP
rs1333404380 2267 dbSNP
rs947137645 2268 dbSNP
rs1254712619 2273 dbSNP
rs937497090 2275 dbSNP
rs927573930 2278 dbSNP
rs981657278 2282 dbSNP
rs778026321 2285 dbSNP
rs1269674596 2286 dbSNP
rs1259281563 2288 dbSNP
rs758499311 2290 dbSNP
rs571155600 2297 dbSNP
rs746283567 2299 dbSNP
rs1015306227 2303 dbSNP
rs1256026428 2305 dbSNP
rs983560060 2312 dbSNP
rs1377844038 2315 dbSNP
rs1226843380 2319 dbSNP
rs952206332 2322 dbSNP
rs1027504971 2339 dbSNP
rs1352522989 2341 dbSNP
rs996041187 2345 dbSNP
rs1160135488 2347 dbSNP
rs900332524 2359 dbSNP
rs1414522820 2362 dbSNP
rs1290013824 2365 dbSNP
rs1468253530 2366 dbSNP
rs187056944 2374 dbSNP
rs1397725790 2381 dbSNP
rs3803025 2382 dbSNP
rs1349619418 2383 dbSNP
rs1410260408 2384 dbSNP
rs1289784174 2386 dbSNP
rs138221824 2390 dbSNP
rs1231807220 2392 dbSNP
rs1256092962 2393 dbSNP
rs1450125634 2398 dbSNP
rs1346577468 2405 dbSNP
rs566301791 2407 dbSNP
rs549267897 2420 dbSNP
rs529615479 2425 dbSNP
rs1359295409 2432 dbSNP
rs1183381078 2445 dbSNP
rs1254197793 2448 dbSNP
rs1479580533 2450 dbSNP
rs1157746414 2459 dbSNP
rs1198177809 2467 dbSNP
rs371132684 2468 dbSNP
rs1166067522 2469 dbSNP
rs1467685265 2469 dbSNP
rs946500098 2472 dbSNP
rs1369899810 2474 dbSNP
rs755608554 2487 dbSNP
rs369179582 2492 dbSNP
rs1160385935 2496 dbSNP
rs937549632 2511 dbSNP
rs182722589 2526 dbSNP
rs190961154 2536 dbSNP
rs1184169464 2543 dbSNP
rs1224668881 2544 dbSNP
rs1483850487 2548 dbSNP
rs1241634174 2560 dbSNP
rs1342113133 2564 dbSNP
rs766894237 2570 dbSNP
rs564070563 2577 dbSNP
rs761067066 2580 dbSNP
rs983830815 2581 dbSNP
rs1487742106 2587 dbSNP
rs749576150 2593 dbSNP
rs952069303 2596 dbSNP
rs1004964442 2598 dbSNP
rs1186792851 2601 dbSNP
rs1389412077 2607 dbSNP
rs1450022952 2618 dbSNP
rs1170478161 2620 dbSNP
rs1028191568 2622 dbSNP
rs974815362 2625 dbSNP
rs1457251358 2626 dbSNP
rs1228788366 2638 dbSNP
rs1392454934 2640 dbSNP
rs964546464 2642 dbSNP
rs1379987078 2644 dbSNP
rs1296232846 2646 dbSNP
rs867460146 2653 dbSNP
rs541170093 2657 dbSNP
rs890454262 2670 dbSNP
rs527358040 2676 dbSNP
rs567785685 2687 dbSNP
rs145665036 2689 dbSNP
rs1320270732 2697 dbSNP
rs996508950 2702 dbSNP
rs866111319 2712 dbSNP
rs902399278 2720 dbSNP
rs900396187 2727 dbSNP
rs1206843582 2730 dbSNP
rs1230008808 2731 dbSNP
rs1020857006 2738 dbSNP
rs1190396106 2742 dbSNP
rs1011011712 2748 dbSNP
rs1319340988 2755 dbSNP
rs1432202949 2757 dbSNP
rs767225494 2763 dbSNP
rs1165253661 2764 dbSNP
rs1054835657 2770 dbSNP
rs1053283303 2788 dbSNP
rs1457082603 2791 dbSNP
rs1319541460 2793 dbSNP
rs77043611 2822 dbSNP
rs761316939 2823 dbSNP
rs534417750 2835 dbSNP
rs1167306984 2842 dbSNP
rs770145540 2843 dbSNP
rs375338924 2850 dbSNP
rs1313905713 2851 dbSNP
rs1045854351 2864 dbSNP
rs1044045075 2873 dbSNP
rs202167920 2876 dbSNP
rs1267781559 2877 dbSNP
rs950344890 2880 dbSNP
rs1465383914 2897 dbSNP
rs771525615 2905 dbSNP
rs916861263 2907 dbSNP
rs1482888107 2908 dbSNP
rs973619792 2909 dbSNP
rs908151351 2911 dbSNP
rs371745671 2912 dbSNP
rs1047960628 2915 dbSNP
rs1157931517 2920 dbSNP
rs930669803 2921 dbSNP
rs920570958 2922 dbSNP
rs1173351391 2933 dbSNP
rs1466260378 2933 dbSNP
rs1183544178 2935 dbSNP
rs1447933446 2936 dbSNP
rs907994737 2942 dbSNP
rs1381759508 2971 dbSNP
rs974825380 2977 dbSNP
rs1287908494 2982 dbSNP
rs964765347 2985 dbSNP
rs1330114465 2989 dbSNP
rs1230230051 2998 dbSNP
rs954786145 3001 dbSNP
rs911740717 3004 dbSNP
rs1030765223 3006 dbSNP
rs1487615893 3015 dbSNP
rs773859630 3016 dbSNP
rs1263500002 3026 dbSNP
rs1210720748 3031 dbSNP
rs1257728483 3032 dbSNP
rs1481923577 3036 dbSNP
rs1181229453 3052 dbSNP
rs1246666146 3059 dbSNP
rs1252003973 3074 dbSNP
rs966550899 3075 dbSNP
rs768154945 3082 dbSNP
rs749283185 3091 dbSNP
rs996201830 3098 dbSNP
rs1177392193 3100 dbSNP
rs1377819683 3116 dbSNP
rs957950908 3117 dbSNP
rs1021586618 3138 dbSNP
rs1351277348 3146 dbSNP
rs1366808788 3151 dbSNP
rs549431665 3152 dbSNP
rs891643085 3161 dbSNP
rs1001929105 3178 dbSNP
rs906264844 3184 dbSNP
rs1388078315 3189 dbSNP
rs1339980859 3200 dbSNP
rs769519862 3212 dbSNP
rs1046120648 3226 dbSNP
rs1014862882 3230 dbSNP
rs1044527803 3231 dbSNP
rs886599548 3235 dbSNP
rs1048454584 3238 dbSNP
rs745708792 3249 dbSNP
rs1218892727 3255 dbSNP
rs541629906 3258 dbSNP
rs186152414 3263 dbSNP
rs1167338973 3274 dbSNP
rs184025116 3284 dbSNP
rs1478039496 3295 dbSNP
rs369046953 3298 dbSNP
rs1192455209 3299 dbSNP
rs1451868079 3307 dbSNP
rs1039023505 3310 dbSNP
rs796509306 3320 dbSNP
rs1037917369 3323 dbSNP
rs1390923281 3328 dbSNP
rs1371551744 3333 dbSNP
rs942251742 3334 dbSNP
rs1431694528 3346 dbSNP
rs191827760 3347 dbSNP
rs1349550040 3361 dbSNP
rs1437200430 3362 dbSNP
rs577661603 3363 dbSNP
rs1490471106 3364 dbSNP
rs987550355 3366 dbSNP
rs1298295539 3372 dbSNP
rs574489987 3372 dbSNP
rs772341343 3372 dbSNP
rs955025489 3375 dbSNP
rs1344184224 3378 dbSNP
rs1274771322 3382 dbSNP
rs1451824151 3384 dbSNP
rs1231822175 3391 dbSNP
rs913701329 3395 dbSNP
rs756360737 3399 dbSNP
rs557720629 3403 dbSNP
rs535127012 3405 dbSNP
rs758093004 3407 dbSNP
rs1386991591 3408 dbSNP
rs1350318683 3411 dbSNP
rs3209584 3422 dbSNP
rs1391378413 3430 dbSNP
rs779191696 3435 dbSNP
rs1161833630 3444 dbSNP
rs974815747 3452 dbSNP
rs1371672086 3457 dbSNP
rs1172090422 3474 dbSNP
rs140634346 3476 dbSNP
rs535704894 3478 dbSNP
rs1001856836 3479 dbSNP
rs1379439829 3482 dbSNP
rs1328257702 3485 dbSNP
rs1386507443 3498 dbSNP
rs755083656 3507 dbSNP
rs1321090630 3508 dbSNP
rs970351010 3541 dbSNP
rs1472372814 3543 dbSNP
rs77981706 3545 dbSNP
rs1031989859 3549 dbSNP
rs1356855881 3555 dbSNP
rs1234742726 3556 dbSNP
rs1265895877 3569 dbSNP
rs1484006469 3571 dbSNP
rs1208832109 3575 dbSNP
rs1249118277 3576 dbSNP
rs1003930128 3579 dbSNP
rs1186123221 3580 dbSNP
rs1237261748 3583 dbSNP
rs886607062 3587 dbSNP
rs550541787 3599 dbSNP
rs1456734878 3609 dbSNP
rs1342348652 3615 dbSNP
rs995509319 3616 dbSNP
rs117737983 3624 dbSNP
rs1012579311 3627 dbSNP
rs1333502618 3629 dbSNP
rs1340811067 3629 dbSNP
rs75041092 3633 dbSNP
rs1416441287 3634 dbSNP
rs186272071 3638 dbSNP
rs898172205 3645 dbSNP
rs1328016527 3646 dbSNP
rs1286881232 3650 dbSNP
rs1412013515 3654 dbSNP
rs1347327543 3662 dbSNP
rs578248524 3666 dbSNP
rs1228410491 3667 dbSNP
rs1261960724 3668 dbSNP
rs1037971162 3669 dbSNP
rs942304034 3673 dbSNP
rs878999348 3683 dbSNP
rs1039284882 3690 dbSNP
rs943390007 3692 dbSNP
rs1404502225 3693 dbSNP
rs1190556730 3711 dbSNP
rs570473408 3717 dbSNP
rs933537847 3718 dbSNP
rs547033220 3726 dbSNP
rs1173200581 3743 dbSNP
rs923431154 3752 dbSNP
rs1409964158 3754 dbSNP
rs1464642681 3758 dbSNP
rs1156699532 3759 dbSNP
rs527402380 3768 dbSNP
rs1402848713 3769 dbSNP
rs1436311182 3774 dbSNP
rs1305970437 3778 dbSNP
rs1473409973 3795 dbSNP
rs1410052950 3798 dbSNP
rs974831951 3819 dbSNP
rs1328827143 3821 dbSNP
rs561592476 3826 dbSNP
rs943406248 3835 dbSNP
rs990174689 3839 dbSNP
rs1273230425 3841 dbSNP
rs879925661 3844 dbSNP
rs1196571790 3846 dbSNP
rs956223925 3852 dbSNP
rs1052288835 3854 dbSNP
rs1198288180 3859 dbSNP
rs945442136 3860 dbSNP
rs1203704211 3866 dbSNP
rs3832822 3866 dbSNP
rs1455523374 3873 dbSNP
rs1166714908 3875 dbSNP
rs1031624106 3879 dbSNP
rs756533253 3882 dbSNP
rs981766328 3883 dbSNP
rs913744777 3890 dbSNP
rs541890554 3895 dbSNP
rs989300774 3905 dbSNP
rs531428488 3909 dbSNP
rs1385672948 3919 dbSNP
rs1351921375 3920 dbSNP
rs926567178 3925 dbSNP
rs980655640 3926 dbSNP
rs1372609093 3930 dbSNP
rs1283948399 3932 dbSNP
rs1022717642 3937 dbSNP
rs1012631328 3948 dbSNP
rs1341867143 3949 dbSNP
rs1228639674 3969 dbSNP
rs970372232 3975 dbSNP
rs1024555512 3978 dbSNP
rs114681197 3980 dbSNP
rs1334948996 3982 dbSNP
rs59636982 3985 dbSNP
rs145558136 4002 dbSNP
rs1336689217 4006 dbSNP
rs1366295636 4017 dbSNP
rs1457081210 4029 dbSNP
rs1163545430 4032 dbSNP
rs1395991528 4035 dbSNP
rs1432319618 4040 dbSNP
rs1319070710 4047 dbSNP
rs995039011 4049 dbSNP
rs553030828 4056 dbSNP
rs1298170453 4057 dbSNP
rs750815451 4060 dbSNP
rs1244297222 4079 dbSNP
rs1274095977 4083 dbSNP
rs1336982321 4100 dbSNP
rs1408505627 4100 dbSNP
rs1017904086 4104 dbSNP
rs767710835 4107 dbSNP
rs1039197938 4109 dbSNP
rs1188264712 4120 dbSNP
rs879442314 4127 dbSNP
rs761596594 4151 dbSNP
rs1165166149 4156 dbSNP
rs914690141 4157 dbSNP
rs564141470 4162 dbSNP
rs1345057670 4165 dbSNP
rs1454759308 4179 dbSNP
rs1291187236 4184 dbSNP
rs1377404602 4185 dbSNP
rs201778022 4186 dbSNP
rs1357613460 4189 dbSNP
rs71705013 4189 dbSNP
rs572390129 4191 dbSNP
rs1226592486 4192 dbSNP
rs1183684532 4203 dbSNP
rs1267575852 4204 dbSNP
rs1448284340 4206 dbSNP
rs1245662559 4207 dbSNP
rs201323703 4212 dbSNP
rs1447182849 4215 dbSNP
rs141046791 4223 dbSNP
rs1482776656 4223 dbSNP
rs199803393 4223 dbSNP
rs372764511 4223 dbSNP
rs386362992 4223 dbSNP
rs386376443 4223 dbSNP
rs386376444 4223 dbSNP
rs1471413215 4224 dbSNP
rs201902874 4224 dbSNP
rs200689100 4225 dbSNP
rs936550312 4226 dbSNP
rs1181095519 4229 dbSNP
rs1408035825 4230 dbSNP
rs1161854658 4235 dbSNP
rs934719803 4235 dbSNP
rs1357962051 4236 dbSNP
rs763643861 4239 dbSNP
rs1313887218 4241 dbSNP
rs981387988 4241 dbSNP
rs181443511 4245 dbSNP
rs373802619 4245 dbSNP
rs1399454716 4247 dbSNP
rs1374115838 4250 dbSNP
rs576114924 4253 dbSNP
rs1299051963 4254 dbSNP
rs1311536981 4265 dbSNP
rs1316259857 4266 dbSNP
rs1228304018 4276 dbSNP
rs1363193085 4278 dbSNP
rs1481973423 4280 dbSNP
rs917585424 4281 dbSNP
rs774941876 4297 dbSNP
rs951099990 4311 dbSNP
rs1454019621 4314 dbSNP
rs35877228 4333 dbSNP
rs1470855757 4335 dbSNP
rs1188954260 4342 dbSNP
rs1423608505 4345 dbSNP
rs15105 4351 dbSNP
rs1174887464 4354 dbSNP
rs1397241517 4359 dbSNP
rs1428279721 4365 dbSNP
rs189000751 4370 dbSNP
rs1328384307 4382 dbSNP
rs1355372954 4396 dbSNP
rs11534 4397 dbSNP
rs181368863 4410 dbSNP
rs571133765 4415 dbSNP
rs1305599094 4424 dbSNP
rs1339747195 4432 dbSNP
rs1227431730 4441 dbSNP
rs759322622 4446 dbSNP
rs1029714287 4449 dbSNP
rs1218998704 4451 dbSNP
rs149727152 4454 dbSNP
rs1030981167 4455 dbSNP
rs1468570601 4460 dbSNP
rs535909125 4467 dbSNP
rs189442046 4470 dbSNP
rs140842557 4475 dbSNP
rs1167704780 4476 dbSNP
rs1420423247 4486 dbSNP
rs1387824578 4500 dbSNP
rs1053912101 4515 dbSNP
rs1039291633 4528 dbSNP
rs1441762304 4529 dbSNP
rs770617784 4530 dbSNP
rs1000874448 4531 dbSNP
rs1258128484 4532 dbSNP
rs151001424 4546 dbSNP
rs1429691103 4557 dbSNP
rs1270534224 4573 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000261900.3 | 3UTR | ACAGGAGUUGUACUUAUGCUGCUACUUGCCAGGAACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000261900.3 | 3UTR | ACAGGAGUUGUACUUAUGCUGCUACUUGCCAGGAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000261900.3 | 3UTR | ACAGGAGUUGUACUUAUGCUGCUACUUGCCAGGAACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.386 1.6e-4 0.295 3.4e-3 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.682 4.6e-4 0.838 2.0e-6 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.55 3.3e-3 0.457 1.4e-2 23 Click to see details
GSE19783 ER+ ER+ breast cancer -0.417 3.4e-2 -0.457 2.1e-2 20 Click to see details
GSE21687 Ependynoma primary tumors -0.197 5.9e-2 -0.085 2.5e-1 64 Click to see details
GSE19783 ER- ER- breast cancer 0.175 6.1e-2 0.174 6.3e-2 79 Click to see details
GSE21849 B cell lymphoma -0.237 1.1e-1 0.011 4.8e-1 29 Click to see details
GSE28260 Renal cortex and medulla -0.364 1.1e-1 -0.346 1.2e-1 13 Click to see details
GSE19536 Breast cancer 0.121 1.2e-1 0.055 2.9e-1 100 Click to see details
GSE26953 Aortic valvular endothelial cells -0.241 1.3e-1 -0.373 3.6e-2 24 Click to see details
GSE14794 Lymphoblastoid cells 0.105 1.6e-1 0.134 1.0e-1 90 Click to see details
GSE17306 Multiple myeloma 0.116 2.1e-1 0.137 1.7e-1 49 Click to see details
GSE27834 Pluripotent stem cells -0.182 2.5e-1 -0.082 3.8e-1 16 Click to see details
GSE28544 Breast cancer -0.114 3.0e-1 -0.377 3.5e-2 24 Click to see details
GSE17498 Multiple myeloma 0.045 3.9e-1 0.106 2.6e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.047 4.1e-1 -0.097 3.2e-1 25 Click to see details
GSE38226 Liver fibrosis 0.035 4.4e-1 0.142 2.7e-1 21 Click to see details
GSE19350 CNS germ cell tumors -0.033 4.6e-1 -0.545 3.3e-2 12 Click to see details
GSE32688 Pancreatic cancer 0.011 4.8e-1 0.109 2.8e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.01 4.8e-1 0.133 2.6e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.01 4.8e-1 0.133 2.6e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.434 0.01 -0.383 0.02 32 Click to see details
PAAD 0.984 0.01 1.000 0.5 4 Click to see details
CHOL -0.73 0.01 -0.650 0.03 9 Click to see details
KIRP -0.321 0.04 -0.309 0.04 32 Click to see details
LUAD 0.423 0.09 0.483 0.06 12 Click to see details
BLCA -0.26 0.15 -0.216 0.19 18 Click to see details
THCA -0.133 0.16 -0.218 0.05 59 Click to see details
LUSC 0.149 0.19 0.177 0.14 38 Click to see details
LIHC -0.117 0.21 -0.188 0.1 49 Click to see details
UCEC 0.164 0.25 0.053 0.41 19 Click to see details
PRAD 0.075 0.3 -0.032 0.41 50 Click to see details
HNSC -0.072 0.33 -0.043 0.39 42 Click to see details
PCPG -0.511 0.33 -0.500 0.33 3 Click to see details
KICH 0.081 0.35 0.136 0.26 25 Click to see details
CESC 0.419 0.36 0.500 0.33 3 Click to see details
BRCA 0.032 0.39 0.044 0.35 84 Click to see details
KIRC -0.035 0.39 -0.080 0.26 68 Click to see details
ESCA -0.049 0.44 -0.218 0.26 11 Click to see details
COAD -0.008 0.49 -0.167 0.35 8 Click to see details
COAD -0.008 0.49 -0.167 0.35 8 Click to see details
COAD -0.008 0.49 -0.167 0.35 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL1