miRTarBase - #MIRT563900 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAPH1   
Synonyms ALS2CR18, ALS2CR9, LPD, PREL-2, PREL2, RMO1, RalGDS/AF-6
Description Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Transcript NM_213589   
Other Transcripts NM_203365   
Expression
Putative miRNA Targets on RAPH1
3'UTR of RAPH1
(miRNA target sites are highlighted)
>RAPH1|NM_213589|3'UTR
   1 CCACCATAGGACTTTATTTTCATGATATCTGTAATCACTGCTACAATCAGCTCACCTGATCATCTGTGAATTCAGGTGTT
  81 CAGAGCCTCCTGGTATGATGTTATTCAGGTAGTGTCCAGCTATATGTGTATGTGTGTGTGTACACGTGCATGTACACACA
 161 GCTGTACAGTGTGTGTATATATGTATACATATATGTATGTGTATGTGTATATAGAGAGAGAGCTGAGAGTTATTCTATTT
 241 ATTCCTTTTCTCTCCTAATCTGAAAATGGGTGTTCTGTATTTTGGGTGGAAGAGGCATAGAAGGGGATGTGTGTTGTCTC
 321 TTAAGATTTCTATATCATGTGGATTGGACCAAAAACTTCTAATCACTTATTTAGAAGGTATTTATAAGTGTCTGTCCATG
 401 TGTAGCCTATTCGTGCATGTTGTGTATTATATAACTAAGGAATAGATGTAGAATGTGCTATTTCTGGTTGAGAAAAATCA
 481 CCAGAATGTTTGGTGTATCTATAAGGCTTTTGTGTTTGTTTTTCCCCAGTTGGCTGAAGTTAGAATTGCTTGACTGACAC
 561 TTCATTGCTATACATGAAGGGGCACTTTAAATCAGGAAAATCTCTCAGCTTCATAGAACGGGTAACTAGTGCAGGATGGG
 641 GAAATGTTCACAGACATCATCTGTATGTGGTTGTGCATAGAAAGTAAATACATGGCGTAATTAACTCAGCTGTTCTAGCT
 721 GCAGTACTGCTGCAGTGATCCACCCACATTTAGGATGTGCTGACAGATAAGCTCTTTGCCTACAATACATGGATAATTAG
 801 TGCTATAATTCTGGATAGTTCCTTTTTAGTACTGTTTTATGAAGCTTTATCAACTTGGCTTCATGATCCTCACTTTGATT
 881 GATTTTAAGAGGATGGATAACACAGTTATCTCTGTAATGTTCTGTCCCAGTATGTCTTTGGGTCACCAGTTACCTTCTTA
 961 AAATATGTGCTTTAGGTAGGTGTTATTACATATCTGTAGACAATTGGTATATGAAATATACACATCCTGTGCCCCAATAT
1041 GGTGCATTATGAAAAACAAAATCATTTTCTAAAATGCATTTTTTGAGCATTGCTCTATAGAAGGGAAGGGTGATGAGAGA
1121 ACAGAACTGGCCCCTGTACAGGTGTCATTAATCTGGTTGTATATGGGTTATAATATGTAATACAAAAAGCTCATTAAGTA
1201 TGGGACTACATGGAGAGGGAAGACAGTTTCATTTATAGCTACTGGGGCTACCAGGACCCTTGCTGACTGCAGCCTGGTTG
1281 TGATTAGTTCAGGTTACTAGGTGTTCTGATGGAGTGGGACAGTCCAAGTCCAGTAACTGACATTACGTTTTATGCGTGTG
1361 CAGTTTGGTATAACGTGGAGTCAGTGCTCTAACGACACACTATACTTCTATATGCTTTTTTCTGTGAATTTTCCTTGGTA
1441 CATGAGAGAAATAAGTACTCTCATCAACTTATGATAAATTGGACTATTAGGAATAAAACAATCTCAGAGCAGCTCCTAAA
1521 CAAGAGAATAAAAATGGGCCATCCCAGCACTTATAAGGGGAGCACATCTTGTAATGAAAGTCTGTGCCTATTGTTAATGA
1601 TTACCAATGCAAACTGCAGAAATCAGTTGACATTGTCCCACAAGGAAAAAGTGATGCCAGTAAAGTGGGGGAAGAGATGG
1681 TAAATAATTCTAGAATGAGCAAAAGTGCTTAATTAGTACAGTATACTCAAGGTCTTGCATAACCCACACTCCACGAAAAC
1761 CGCATCGTAAACAGAGAGTGAACAGCACCTCTCCATTGCTACATCTCCAGAATATTGTTCGGTTATGTTCATGTGGTTAT
1841 GGAGCAATAAGAATATATACCATTAATTTTTAGGTCTTTCAAATTGTTCACCAAGTTTTGTGTTTGATATTTATGAAGTG
1921 ATCTTTAACACATCTGCATTGTTAATTTAAGCATGCACAGAAATTTGGGTAATGTTTGAGTAGATTGCCAAGCGCTACTG
2001 TGATTCATGAATGAATTTCTCATAGTCTTCTGCCTGCAGTTTTATAGTTTGAGGGGCACCCATATTTGTGGGTTAGAGTT
2081 AGTAAGAATATGAATCCAGTTATCAAAGTATTCATCCCTGAGGTTTTGAGTTTTATTGTGGTGGTGATTTTCTCATGAGA
2161 AGGTAGACAACACTTCAGTTTTTCTTGAGGGGGAAAAAATGTACCCGCTAACCTTTTTTCACCCATGATTTGAGCCCTAA
2241 AACAACAGCCTTTATGTTTTCAGTGCAGGATTTCTTGGAATTTCTTGCTTGTATCAATCCTGATGATAGCCATCCTGAAC
2321 AGATGCTTCTGGTCTGTTTTCCTGGAATAGCAGACATCCTTTTGAACACTAATGATGCCAGGAAGAGAGTAAGGCTAGAG
2401 GAGGAGACTCATTTTAACCCCAGTCCAGTGGCTTGTCCGACAACAGGCCATTTCCCTTTACATTCCTCCACAGACAGAAA
2481 TGGCTATTAAAAATGTTTTAACCTCATGTATGAACTGAATTTAAAAAACCACTAAAGTGATACTTTATACTTCTGTTTTA
2561 CTCCCTAGTGGGTTTTCTTTAATTTGGATTTTTGTTGGGATGTAGCTTTTCCTAGACTGTATTTCTGTAGCTCTTTTTCT
2641 CTGGTGTATTCATGGAAAGCATCTACTGCCGCACGACACTAGTACTGTGCCTTCTTTCACTGCCCTCTGCTCTGCAGCTC
2721 TCACCCAGCTTGGCTGCTTCAAGTCTGTGCAGTTGACTTGGCTGTACTGAAAAGTGAACAGCATGGATTAACTCATCCTG
2801 CTGCTGAGGGCAGTGCAAACAGGTGCTTATTAGAGGTAGTGACTTGCTTAATTAGTGACACTCCTAATTTCTACTATGGA
2881 TAATTTCAAAGTAGAATCACTCTATGCTTAGAGTTTTGGCACCAATGCTGTAGGGCAGCAGAATCTATTCTCAGTAAAAT
2961 AACTTATGGTTTATTAGATATTCTGTATTGGATTTTACCAGCTTGACTTTTACTGCTCAGATGCTTTCTTTCCCCCCCTT
3041 AGACGCTGTAATTCTCTTGGGAAGAGTAACTATTCTTAAGGTTTTTACAGATACCCACCTTAGTTGTAAATTGGATAGTT
3121 TATATTTCTGGGACTTTTTAAATGAAAATGTGGAATGTTAAGTTACAAAAGACTTTTCATCAGAAAATTTCAAACAAAGT
3201 AAACATGGCGTTTTATAGTCCTCTAAAATCTAGGTGCTCCCACCCACCAAAGGCATATCCTGCAAAGGGCTGTGAACTAT
3281 CTTGGTGAACTGTCTTGGGTCCCCTTTCCATGTATGTTTTCTTGTCACTGAAAACAAACAACGCTGAGTTTATCAAGAAA
3361 ATTTAAATTGGGGGATCATAATAATTCCAACCAAGTGACAACTCTGACATCAAGGTTATTAGGAGCTGTACATCCAATTC
3441 AAGTTTTATTTGCTGCTATTCTGGGAGAATAAACTTGTATATGGAGAATAAACTAATAAACTTGTATCGAGGAAATCCAT
3521 AAAGTTATAAATTAGCCTGAAAAATATTTCAGGTAATGGTGTGGATTGGCCTGCTTTGACTCTCAGCCACCAACAGAAAT
3601 CTTTGTCACCTTTGTTCCTCAGCTAAAAGTAATTTTGTTATAAACACAAAGTGACTTTAAACAGGTAAAAAACCCATTCC
3681 TATTTTTGTACATTACCAAAAGTTTTTCATATACCTACAGAGCTAACTAATTACAACTGATTTAATCCACTCAAGTTTAG
3761 ACCAGTTAAACCCATAGGATCCTGTATGGTTATCAATGTGATGCCTTGCTTTTCATAAAATAGGTATAATTGGGTCATAC
3841 ACTTGACGAGAGGGTGACTGTTTCTAGGGGAAGAAAACCCTTTAGATTGCAGGTAACTTTCACTTTTTTTTTTTTAATAT
3921 ACACTTTACATTTGTATAAATTATGCAGGGTACTCCTAACCCTGTAGAAATGTATGACCTCTCACAAAGTTGAGATTTGA
4001 TCCAAAGAGAAATGCAAGTATAAAAGAATTAGATACTTATTATCTTTTAAGGTTTTTTTTTTTTTTTGGTAGAGATGGGG
4081 GTCTCACTGTGTTGCCCAGGCTGGTCTCAAACTCCTGGCCACAAGTGATCTTCCTGCCTCAGCCTCCCAAAATGCTGAGA
4161 TTACAGGCATGAGCCACTGTACCCAGCCTTTCCTTATAAAATTCAAAGAGAAAATTTCTACACCTTTATCCCTCAAATAA
4241 AACAAGTGCTCAGTTCTTACCGTGCCCTTGCAAGGTCTATATGTAAAAGAAATCTGAAATTTAGCTGTAGAATAAAACTT
4321 GATAAATAAAAAGAAAAAACATACATTTCTCCAGTTGGTTTGCTCTTTGCTTGTTGAAGTAATAAACCGTTTTAAAGAGA
4401 AAATACTTGCTGTAAACCCCCAGTGCCTTCAACTCTTTTGGCAGAATATTTTTAAAGAAATCCAGCAAGCAAACTTTGAG
4481 GTGCTAATGAAAGTAAAGGAAGGTGGTATTTCTAGTTTTGGCAGAAATGAAAAGTGTCTCACAAGAGACATCACTACCCA
4561 CGTGGGGTCTGGCTGCTTTCTACCAAAGACATTTAGAGAAGTGAATTGAGTCAGGGTGATGGTGAACACTACATATTTTA
4641 TAGATGGTTAAGTTGAGAATTAATTATGTTTATCATGGATGGCTACTAATACCAAGCTCATGATTGTTGCAGCCTCAACG
4721 TCTTAGGCAGTAAAACTTGTCTGCAGCACTAAAGGGGGAGAAACCCTTATATTTTGCAAACTGTCCATTCGTTAAATTTA
4801 TTGTAACCTAATACCAAAAACTGCCGTTTTTCATATTATTTCCCCACCTCCTACTTTTTTTTTTTTTTTTGCTACTTGTA
4881 AAATAACCCCTTCTAGAAAATAAGCATTAACTGGAATGTTTCAAACAATTTTGCTTCATTTTACTATCAGCCACTAGTGA
4961 ACTCTTACAGAGATGTACATTTAAGATAAAATTAGCTTGTGCTAAGTGTTTTAAAAACATTGTTTACTGTTAAAGGGGAA
5041 TTGCACATTATATTTAACTGGGATTGCTCCCTCCCTCAGTTCTTTAAAAAACAAGAGTCAAGGCTCACACCAACTTGTAG
5121 GCTGTGGGAGCTTTGCCATAGGTAGATACAATGTAGAAGTATACTTTTTTAAAGCATGAAGAAGACAAGGAACTTCATTA
5201 TAATGTACCAGGTAGAGGACATTATTATTCAAAGGATTATGCACAGCTCAGTGAAGATGAAGTTACAATTTTTCTCGCAG
5281 CTTTGTTGCTATTATTTTCTTCTGCATAAATGTATGCTCATTTCATTATGTGCCTTGCTCCCTGATTGTGCAAAGCTATA
5361 TATATATATATATATATATAGATAGATAGATAGATATATGAGAGAGATATATTCAGTACTACTGAGGATGTTTTTCTGAG
5441 GATGTTTTTGTTCTGCTGGATTAAGTTATTTTCCAAGTTACTCTTGCCAGTTATGTCAGTAAACTATTGTAATGGCTTAG
5521 CACACTAGTCGTACAGTCAGTGTAAATGTTTTTCATTTACATGTTTTCATTATATCAGCTTATCAAATCCTTAATAAAAA
5601 AAATTCATAGATTTCATTTAAACATGGGGACTTTGAGTGTTTGTGGATCGGCACCATTAAGAATCTGGTTTTGCATTTCA
5681 TGTCAGGGTACCCAAAACATAGGCCATACACAGAAGAAATTAAGTGTGGTAAATAAACTAGTTTGATATGTTCAAAAAAA
5761 AAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |||::: |||| ||||||| 
Target 5' ttCAAGTT-TTATTTGCTGCTa 3'
3438 - 3458 167.00 -16.20
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|| :|||    ||||||| 
Target 5' atTAACTCAT--CCTGCTGCTg 3'
2787 - 2806 148.00 -11.70
3
miRNA  3' guGUUUGGUAAUACACG--ACGAu 5'
            ||  :||||||||||  |||| 
Target 5' ctCATTTCATTATGTGCCTTGCTc 3'
5317 - 5340 140.00 -17.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31508714 36 COSMIC
COSN30512532 62 COSMIC
COSN30115522 89 COSMIC
COSN30125283 100 COSMIC
COSN30477788 134 COSMIC
COSN31563217 142 COSMIC
COSN31592171 184 COSMIC
COSN19189814 214 COSMIC
COSN16987372 397 COSMIC
COSN32062756 470 COSMIC
COSN28790339 556 COSMIC
COSN9304653 693 COSMIC
COSN26679154 922 COSMIC
COSN27905113 1041 COSMIC
COSN30176502 1042 COSMIC
COSN28865121 1050 COSMIC
COSN519080 1257 COSMIC
COSN30454708 1258 COSMIC
COSN30511543 1259 COSMIC
COSN30448467 1317 COSMIC
COSN5787575 1462 COSMIC
COSN1819352 1620 COSMIC
COSN27773161 1767 COSMIC
COSN6933093 1853 COSMIC
COSN6164696 1999 COSMIC
COSN32065642 2128 COSMIC
COSN20097715 2408 COSMIC
COSN9304652 2523 COSMIC
COSN21728114 2901 COSMIC
COSN19587147 3362 COSMIC
COSN25807794 3887 COSMIC
COSN28926565 3903 COSMIC
COSN27199656 3904 COSMIC
COSN6164695 3977 COSMIC
COSN23735586 4051 COSMIC
COSN20097709 4053 COSMIC
COSN16907248 4177 COSMIC
COSN31571045 4342 COSMIC
COSN31539549 4426 COSMIC
COSN26555540 4474 COSMIC
COSN30174998 4540 COSMIC
COSN15033829 4639 COSMIC
COSN5494786 4672 COSMIC
COSN6164693 4741 COSMIC
COSN31570546 4760 COSMIC
COSN9871791 4837 COSMIC
COSN29019989 4854 COSMIC
COSN20097707 4855 COSMIC
COSN27276014 4855 COSMIC
COSN31480758 4970 COSMIC
COSN1819350 5147 COSMIC
COSN6933092 5231 COSMIC
COSN20097706 5377 COSMIC
COSN32064211 5377 COSMIC
COSN28828667 5393 COSMIC
COSN8344857 5415 COSMIC
COSN28201346 5496 COSMIC
COSN5787574 5498 COSMIC
COSN31514086 5531 COSMIC
COSN20097704 5596 COSMIC
COSN1819348 5684 COSMIC
rs77589546 4653 GWAS
rs2264901 5358 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1356757755 2 dbSNP
rs368238304 8 dbSNP
rs1174755416 12 dbSNP
rs1395740798 13 dbSNP
rs1351538263 16 dbSNP
rs1443564644 18 dbSNP
rs1363282547 19 dbSNP
rs757247612 22 dbSNP
rs747010470 25 dbSNP
rs1359958186 27 dbSNP
rs777308611 31 dbSNP
rs374277521 34 dbSNP
rs752277388 35 dbSNP
rs1389293531 37 dbSNP
rs1163828747 38 dbSNP
rs764761421 45 dbSNP
rs754633959 46 dbSNP
rs1184671693 50 dbSNP
rs1287388696 52 dbSNP
rs1234999377 53 dbSNP
rs983354196 60 dbSNP
rs1261027980 70 dbSNP
rs1284843198 75 dbSNP
rs1311476759 84 dbSNP
rs554932025 98 dbSNP
rs757573574 100 dbSNP
rs974108559 101 dbSNP
rs1479720780 103 dbSNP
rs1181701831 104 dbSNP
rs1333574373 108 dbSNP
rs1269808620 122 dbSNP
rs754313535 124 dbSNP
rs1197624783 126 dbSNP
rs920471327 128 dbSNP
rs138812687 130 dbSNP
rs368201180 134 dbSNP
rs1355754293 139 dbSNP
rs922472861 142 dbSNP
rs955193896 142 dbSNP
rs959173318 145 dbSNP
rs976133693 146 dbSNP
rs1281128297 148 dbSNP
rs1366732996 153 dbSNP
rs1413959678 153 dbSNP
rs569361906 159 dbSNP
rs1305716745 161 dbSNP
rs1204473731 164 dbSNP
rs1292591254 166 dbSNP
rs1490884237 167 dbSNP
rs1197603530 168 dbSNP
rs1246481918 169 dbSNP
rs1475975457 170 dbSNP
rs750608011 171 dbSNP
rs1321224870 177 dbSNP
rs1449404595 177 dbSNP
rs199698487 177 dbSNP
rs775393224 177 dbSNP
rs879620570 177 dbSNP
rs1035155089 180 dbSNP
rs1031911222 183 dbSNP
rs1226047504 190 dbSNP
rs867152226 191 dbSNP
rs781597657 192 dbSNP
rs1362861150 195 dbSNP
rs1457164307 195 dbSNP
rs1013088311 199 dbSNP
rs1045971057 199 dbSNP
rs1255843469 203 dbSNP
rs1361761747 203 dbSNP
rs551584393 203 dbSNP
rs1289368707 207 dbSNP
rs1215548533 211 dbSNP
rs1240736674 211 dbSNP
rs1447834761 211 dbSNP
rs539991269 212 dbSNP
rs966391247 214 dbSNP
rs1445979832 218 dbSNP
rs879927764 219 dbSNP
rs566128938 221 dbSNP
rs527565192 222 dbSNP
rs1319969124 223 dbSNP
rs1386254626 223 dbSNP
rs1434272014 223 dbSNP
rs908244340 223 dbSNP
rs1337352745 224 dbSNP
rs1377005612 227 dbSNP
rs893344950 230 dbSNP
rs1033183906 232 dbSNP
rs1283680837 233 dbSNP
rs1311762534 233 dbSNP
rs1351601917 237 dbSNP
rs996724885 243 dbSNP
rs548100100 244 dbSNP
rs933948294 245 dbSNP
rs1376709806 255 dbSNP
rs529558516 257 dbSNP
rs975614930 259 dbSNP
rs1459939659 269 dbSNP
rs963922806 272 dbSNP
rs1470300984 273 dbSNP
rs568509306 275 dbSNP
rs1160007557 277 dbSNP
rs944772244 288 dbSNP
rs886479763 296 dbSNP
rs550158851 304 dbSNP
rs1408123555 306 dbSNP
rs112626285 315 dbSNP
rs1031713577 318 dbSNP
rs1333577138 323 dbSNP
rs1336504679 325 dbSNP
rs1444601081 328 dbSNP
rs1403117250 330 dbSNP
rs754510175 332 dbSNP
rs1178870238 335 dbSNP
rs999107718 337 dbSNP
rs1438681255 339 dbSNP
rs1236188067 356 dbSNP
rs1277289357 360 dbSNP
rs1437945244 361 dbSNP
rs971600814 361 dbSNP
rs1472064108 362 dbSNP
rs1199806420 364 dbSNP
rs1024570803 375 dbSNP
rs1013473593 378 dbSNP
rs1464483241 384 dbSNP
rs1192679064 385 dbSNP
rs1171971621 394 dbSNP
rs930567752 404 dbSNP
rs920486457 412 dbSNP
rs751080384 413 dbSNP
rs1389397047 416 dbSNP
rs1405791726 420 dbSNP
rs937872927 429 dbSNP
rs894662540 430 dbSNP
rs1320007888 431 dbSNP
rs1329779603 432 dbSNP
rs1233121522 445 dbSNP
rs927802555 454 dbSNP
rs766180527 460 dbSNP
rs1241218439 461 dbSNP
rs1046672207 463 dbSNP
rs181147184 470 dbSNP
rs1222856629 473 dbSNP
rs1307579502 480 dbSNP
rs966442221 481 dbSNP
rs1431281048 483 dbSNP
rs1388917509 486 dbSNP
rs933663638 487 dbSNP
rs564537288 488 dbSNP
rs1166727544 490 dbSNP
rs1039641494 493 dbSNP
rs1425530345 495 dbSNP
rs144068679 501 dbSNP
rs1361978110 508 dbSNP
rs915109704 516 dbSNP
rs957661861 521 dbSNP
rs533178542 523 dbSNP
rs996429508 524 dbSNP
rs1418753545 529 dbSNP
rs565203831 530 dbSNP
rs1294761308 534 dbSNP
rs1019066930 542 dbSNP
rs1340898959 548 dbSNP
rs559279121 553 dbSNP
rs1177729646 556 dbSNP
rs1266798142 558 dbSNP
rs188365463 565 dbSNP
rs1208946449 581 dbSNP
rs1262181501 582 dbSNP
rs573557006 584 dbSNP
rs764504488 587 dbSNP
rs554944247 596 dbSNP
rs995219881 602 dbSNP
rs1445365569 603 dbSNP
rs899153112 606 dbSNP
rs1165571101 609 dbSNP
rs149529217 619 dbSNP
rs1024955988 620 dbSNP
rs575751255 620 dbSNP
rs557465923 622 dbSNP
rs1387679923 623 dbSNP
rs959118462 634 dbSNP
rs762713066 643 dbSNP
rs1320535824 653 dbSNP
rs74922269 664 dbSNP
rs1217389157 665 dbSNP
rs1314258857 666 dbSNP
rs1319490543 669 dbSNP
rs1243683084 670 dbSNP
rs1261086146 671 dbSNP
rs1487979029 675 dbSNP
rs753215851 678 dbSNP
rs1206717258 679 dbSNP
rs1235616194 691 dbSNP
rs1247286517 694 dbSNP
rs913629664 696 dbSNP
rs566311879 697 dbSNP
rs1254240215 703 dbSNP
rs1313155381 707 dbSNP
rs1423458200 710 dbSNP
rs1160161012 712 dbSNP
rs1455934960 715 dbSNP
rs1407399668 716 dbSNP
rs1455063737 723 dbSNP
rs957970328 730 dbSNP
rs1301010198 737 dbSNP
rs920919780 737 dbSNP
rs1376419159 744 dbSNP
rs1395055949 748 dbSNP
rs975438431 749 dbSNP
rs886823237 751 dbSNP
rs1218033704 755 dbSNP
rs1226301452 765 dbSNP
rs1267262619 766 dbSNP
rs1324170820 768 dbSNP
rs1212238627 771 dbSNP
rs180848945 779 dbSNP
rs1342901545 780 dbSNP
rs536156844 782 dbSNP
rs1019076582 783 dbSNP
rs1177879169 789 dbSNP
rs1398874159 790 dbSNP
rs1254201847 800 dbSNP
rs1471737296 805 dbSNP
rs997782481 810 dbSNP
rs1430498283 815 dbSNP
rs1008978623 818 dbSNP
rs900868906 828 dbSNP
rs1040015579 833 dbSNP
rs764658603 838 dbSNP
rs1465065203 846 dbSNP
rs1298281859 851 dbSNP
rs950818366 853 dbSNP
rs772964092 864 dbSNP
rs1026388725 865 dbSNP
rs942668325 868 dbSNP
rs1287486647 875 dbSNP
rs893630949 876 dbSNP
rs1220853121 877 dbSNP
rs764949679 878 dbSNP
rs568724162 879 dbSNP
rs1205228109 882 dbSNP
rs1276884515 883 dbSNP
rs533821908 885 dbSNP
rs1478783244 887 dbSNP
rs977522109 894 dbSNP
rs1270005475 899 dbSNP
rs568326531 905 dbSNP
rs899201407 905 dbSNP
rs1192785799 906 dbSNP
rs950014852 908 dbSNP
rs550190008 909 dbSNP
rs1429632071 912 dbSNP
rs1202467203 913 dbSNP
rs1168606400 916 dbSNP
rs992147501 916 dbSNP
rs1427392131 918 dbSNP
rs1002539521 920 dbSNP
rs958947378 922 dbSNP
rs906408842 930 dbSNP
rs1017609955 932 dbSNP
rs1255812878 932 dbSNP
rs1202205191 933 dbSNP
rs1215150853 934 dbSNP
rs1320393652 934 dbSNP
rs1299909978 944 dbSNP
rs1340181055 955 dbSNP
rs1046280671 957 dbSNP
rs1292712056 958 dbSNP
rs1218493942 965 dbSNP
rs1246500685 967 dbSNP
rs951565622 967 dbSNP
rs550214057 968 dbSNP
rs1191098797 975 dbSNP
rs1391459065 977 dbSNP
rs997921637 980 dbSNP
rs931470797 985 dbSNP
rs1337866398 990 dbSNP
rs1162421461 993 dbSNP
rs1017981746 994 dbSNP
rs1006972107 998 dbSNP
rs892290346 999 dbSNP
rs1054126322 1004 dbSNP
rs1434411752 1007 dbSNP
rs745742424 1010 dbSNP
rs935129208 1011 dbSNP
rs1226877171 1012 dbSNP
rs1401008839 1013 dbSNP
rs1317952012 1016 dbSNP
rs60208723 1019 dbSNP
rs1246686442 1025 dbSNP
rs570836884 1025 dbSNP
rs1187327678 1026 dbSNP
rs1398363287 1030 dbSNP
rs1473574375 1033 dbSNP
rs1161134816 1037 dbSNP
rs1412769590 1047 dbSNP
rs920961707 1050 dbSNP
rs1457525971 1052 dbSNP
rs1041815401 1057 dbSNP
rs141816259 1061 dbSNP
rs367950505 1061 dbSNP
rs775550894 1061 dbSNP
rs1491158044 1062 dbSNP
rs189640317 1062 dbSNP
rs937350975 1064 dbSNP
rs1446061544 1069 dbSNP
rs1283769924 1070 dbSNP
rs1351371937 1077 dbSNP
rs367628706 1078 dbSNP
rs912119162 1085 dbSNP
rs1266644517 1087 dbSNP
rs987672438 1088 dbSNP
rs1204937704 1097 dbSNP
rs556531990 1104 dbSNP
rs1443686570 1110 dbSNP
rs1184803362 1111 dbSNP
rs950910282 1113 dbSNP
rs777458829 1128 dbSNP
rs1236492058 1130 dbSNP
rs1472716219 1131 dbSNP
rs1189672148 1133 dbSNP
rs375429251 1134 dbSNP
rs1026439676 1139 dbSNP
rs747133585 1140 dbSNP
rs1173140364 1147 dbSNP
rs1404296116 1153 dbSNP
rs1255768149 1167 dbSNP
rs879180406 1170 dbSNP
rs150182889 1174 dbSNP
rs1487702588 1190 dbSNP
rs1268999959 1191 dbSNP
rs1371338895 1192 dbSNP
rs1411974880 1197 dbSNP
rs568649211 1197 dbSNP
rs757808171 1199 dbSNP
rs750946203 1200 dbSNP
rs1350300844 1201 dbSNP
rs750769819 1201 dbSNP
rs767932312 1202 dbSNP
rs779234011 1202 dbSNP
rs1277067050 1204 dbSNP
rs1308441836 1207 dbSNP
rs1002187072 1208 dbSNP
rs762274891 1209 dbSNP
rs1213350994 1210 dbSNP
rs774766849 1211 dbSNP
rs1284007679 1215 dbSNP
rs1406789335 1221 dbSNP
rs372096837 1229 dbSNP
rs376972851 1230 dbSNP
rs757756462 1230 dbSNP
rs1293157655 1231 dbSNP
rs762899148 1235 dbSNP
rs775643868 1241 dbSNP
rs770083093 1245 dbSNP
rs552705113 1246 dbSNP
rs1429829249 1250 dbSNP
rs776564010 1254 dbSNP
rs770892448 1264 dbSNP
rs1266316061 1265 dbSNP
rs746943803 1270 dbSNP
rs1481383019 1272 dbSNP
rs1253483051 1274 dbSNP
rs777525942 1276 dbSNP
rs772079895 1277 dbSNP
rs778411504 1280 dbSNP
rs1483171356 1282 dbSNP
rs754254952 1283 dbSNP
rs892342850 1283 dbSNP
rs1206935218 1285 dbSNP
rs754617673 1290 dbSNP
rs1472114303 1291 dbSNP
rs753525220 1292 dbSNP
rs781512536 1293 dbSNP
rs1392200418 1297 dbSNP
rs775526796 1298 dbSNP
rs1375747773 1299 dbSNP
rs1018451598 1300 dbSNP
rs1390943098 1301 dbSNP
rs1431832021 1304 dbSNP
rs899539186 1309 dbSNP
rs757565783 1310 dbSNP
rs374098424 1314 dbSNP
rs764440996 1316 dbSNP
rs1178494257 1317 dbSNP
rs763528983 1324 dbSNP
rs752706056 1327 dbSNP
rs765479300 1330 dbSNP
rs764454536 1333 dbSNP
rs1420508587 1337 dbSNP
rs369877057 1340 dbSNP
rs1370203762 1341 dbSNP
rs777044321 1342 dbSNP
rs771303205 1343 dbSNP
rs559507913 1346 dbSNP
rs773067346 1347 dbSNP
rs375782237 1348 dbSNP
rs540819276 1355 dbSNP
rs529169673 1356 dbSNP
rs1342305421 1360 dbSNP
rs561617464 1363 dbSNP
rs185378883 1364 dbSNP
rs369649641 1367 dbSNP
rs929553439 1370 dbSNP
rs1013432943 1374 dbSNP
rs1163722518 1375 dbSNP
rs1458487915 1378 dbSNP
rs779137271 1382 dbSNP
rs1182054446 1384 dbSNP
rs919428444 1393 dbSNP
rs575662291 1394 dbSNP
rs1248702959 1402 dbSNP
rs777949324 1403 dbSNP
rs193166955 1405 dbSNP
rs760307432 1405 dbSNP
rs1451350830 1408 dbSNP
rs973557681 1409 dbSNP
rs1056298727 1410 dbSNP
rs1389708376 1413 dbSNP
rs1458614017 1414 dbSNP
rs963814225 1420 dbSNP
rs1389108173 1421 dbSNP
rs1386673131 1422 dbSNP
rs1436388618 1425 dbSNP
rs1321753448 1429 dbSNP
rs937337813 1432 dbSNP
rs1436565963 1434 dbSNP
rs1294787590 1435 dbSNP
rs1306549895 1437 dbSNP
rs1245153492 1447 dbSNP
rs375531959 1451 dbSNP
rs1354059538 1460 dbSNP
rs1212857201 1462 dbSNP
rs1248521223 1463 dbSNP
rs545924847 1463 dbSNP
rs1466201185 1464 dbSNP
rs189863050 1472 dbSNP
rs1355043230 1474 dbSNP
rs1424607544 1475 dbSNP
rs1189926910 1479 dbSNP
rs554347860 1480 dbSNP
rs1457685792 1499 dbSNP
rs970739599 1502 dbSNP
rs1391399375 1511 dbSNP
rs1024976996 1513 dbSNP
rs1317956336 1514 dbSNP
rs918844678 1518 dbSNP
rs976857038 1521 dbSNP
rs1314375567 1524 dbSNP
rs1338366090 1541 dbSNP
rs749658413 1546 dbSNP
rs965942945 1546 dbSNP
rs1353945543 1547 dbSNP
rs1268540846 1554 dbSNP
rs892352600 1562 dbSNP
rs1331114016 1563 dbSNP
rs535645893 1568 dbSNP
rs1206816486 1571 dbSNP
rs1308026559 1581 dbSNP
rs568654416 1582 dbSNP
rs1260186604 1584 dbSNP
rs1483647511 1590 dbSNP
rs556924475 1598 dbSNP
rs1254261319 1604 dbSNP
rs1332550573 1609 dbSNP
rs184980043 1615 dbSNP
rs985638252 1627 dbSNP
rs1471880919 1632 dbSNP
rs1000679209 1633 dbSNP
rs957715397 1634 dbSNP
rs756663539 1636 dbSNP
rs1360275830 1640 dbSNP
rs1466064864 1642 dbSNP
rs1304080091 1644 dbSNP
rs570897879 1647 dbSNP
rs1039481949 1651 dbSNP
rs1007931584 1660 dbSNP
rs1288742549 1662 dbSNP
rs890828976 1668 dbSNP
rs1226472733 1674 dbSNP
rs1306140127 1681 dbSNP
rs1312705596 1684 dbSNP
rs75856509 1688 dbSNP
rs753204092 1690 dbSNP
rs1485466226 1693 dbSNP
rs1379663615 1701 dbSNP
rs966583195 1711 dbSNP
rs1206191211 1716 dbSNP
rs1024910250 1718 dbSNP
rs1177024406 1719 dbSNP
rs1482252428 1719 dbSNP
rs1426403145 1724 dbSNP
rs527745472 1726 dbSNP
rs1013394130 1729 dbSNP
rs1451523277 1731 dbSNP
rs1433678795 1734 dbSNP
rs1266210042 1737 dbSNP
rs929563336 1738 dbSNP
rs1218126276 1744 dbSNP
rs1297408486 1746 dbSNP
rs1368201348 1749 dbSNP
rs1220946605 1751 dbSNP
rs372191667 1754 dbSNP
rs1488303740 1755 dbSNP
rs1276994053 1761 dbSNP
rs1055869372 1762 dbSNP
rs766022196 1763 dbSNP
rs2250390 1764 dbSNP
rs1038289843 1767 dbSNP
rs1489750033 1768 dbSNP
rs140938480 1773 dbSNP
rs1232509799 1774 dbSNP
rs1453216180 1776 dbSNP
rs926764664 1777 dbSNP
rs1168709694 1779 dbSNP
rs980891284 1779 dbSNP
rs897386083 1783 dbSNP
rs1169482338 1786 dbSNP
rs1350296520 1786 dbSNP
rs1438499220 1792 dbSNP
rs1323756992 1793 dbSNP
rs1370203560 1798 dbSNP
rs970793412 1801 dbSNP
rs1299929622 1802 dbSNP
rs917930005 1804 dbSNP
rs547588368 1811 dbSNP
rs1290994063 1814 dbSNP
rs1041299770 1818 dbSNP
rs529090415 1819 dbSNP
rs1188626714 1820 dbSNP
rs542360107 1821 dbSNP
rs1414098299 1839 dbSNP
rs73990637 1844 dbSNP
rs1393561851 1856 dbSNP
rs1401942884 1856 dbSNP
rs138267035 1858 dbSNP
rs1322634003 1860 dbSNP
rs1324799942 1867 dbSNP
rs531493658 1878 dbSNP
rs1018518896 1880 dbSNP
rs1430248813 1882 dbSNP
rs1317911445 1886 dbSNP
rs1381658964 1892 dbSNP
rs1399170017 1894 dbSNP
rs1293122800 1896 dbSNP
rs1330425450 1915 dbSNP
rs192757605 1926 dbSNP
rs1269458166 1929 dbSNP
rs977723336 1931 dbSNP
rs1214498616 1951 dbSNP
rs890837259 1951 dbSNP
rs966384818 1953 dbSNP
rs867917254 1954 dbSNP
rs1478010880 1957 dbSNP
rs186941435 1971 dbSNP
rs1427842708 1974 dbSNP
rs1046736084 1980 dbSNP
rs992512236 1983 dbSNP
rs959226852 1985 dbSNP
rs1033971965 1986 dbSNP
rs1006057891 1987 dbSNP
rs993766569 1989 dbSNP
rs888499140 1993 dbSNP
rs763987155 1998 dbSNP
rs572127554 2000 dbSNP
rs1037979205 2002 dbSNP
rs1278249829 2003 dbSNP
rs994105330 2009 dbSNP
rs942273757 2023 dbSNP
rs752422553 2025 dbSNP
rs926844519 2025 dbSNP
rs1279119593 2026 dbSNP
rs1045220930 2028 dbSNP
rs1321084385 2031 dbSNP
rs949448878 2036 dbSNP
rs1256517441 2037 dbSNP
rs917982531 2045 dbSNP
rs1184118750 2056 dbSNP
rs1361925468 2060 dbSNP
rs988151812 2062 dbSNP
rs944323138 2066 dbSNP
rs1433066269 2068 dbSNP
rs1312447875 2071 dbSNP
rs1371433502 2078 dbSNP
rs552887315 2079 dbSNP
rs754494470 2081 dbSNP
rs374607932 2089 dbSNP
rs1437898290 2103 dbSNP
rs1274896544 2114 dbSNP
rs760629213 2117 dbSNP
rs1231472749 2118 dbSNP
rs560024532 2126 dbSNP
rs562056670 2130 dbSNP
rs772152357 2131 dbSNP
rs1335055692 2136 dbSNP
rs977857277 2139 dbSNP
rs536693991 2141 dbSNP
rs1469624061 2143 dbSNP
rs1248404575 2147 dbSNP
rs1018066575 2155 dbSNP
rs567719408 2160 dbSNP
rs1173537187 2162 dbSNP
rs1452612669 2167 dbSNP
rs182323841 2172 dbSNP
rs145687386 2178 dbSNP
rs1431919911 2185 dbSNP
rs1166517491 2186 dbSNP
rs1418233732 2187 dbSNP
rs191257801 2187 dbSNP
rs1184229586 2194 dbSNP
rs1473473183 2200 dbSNP
rs917622459 2200 dbSNP
rs558928731 2206 dbSNP
rs993858343 2207 dbSNP
rs1437998781 2212 dbSNP
rs1302080962 2213 dbSNP
rs1365458449 2223 dbSNP
rs1229204490 2226 dbSNP
rs992085890 2228 dbSNP
rs1186326677 2232 dbSNP
rs540250873 2233 dbSNP
rs1259744040 2239 dbSNP
rs898198180 2242 dbSNP
rs1467092364 2244 dbSNP
rs533904491 2248 dbSNP
rs543349884 2249 dbSNP
rs1451529110 2256 dbSNP
rs1272427655 2258 dbSNP
rs1212914550 2269 dbSNP
rs959513676 2274 dbSNP
rs566845168 2282 dbSNP
rs575992488 2286 dbSNP
rs1165370225 2288 dbSNP
rs1458699511 2288 dbSNP
rs985003754 2291 dbSNP
rs1461432336 2324 dbSNP
rs1285007733 2325 dbSNP
rs1388795712 2333 dbSNP
rs1383437089 2342 dbSNP
rs951902141 2344 dbSNP
rs1006481130 2346 dbSNP
rs905401430 2356 dbSNP
rs548424972 2366 dbSNP
rs879757848 2366 dbSNP
rs1294959794 2367 dbSNP
rs530174699 2367 dbSNP
rs536346362 2368 dbSNP
rs565063660 2369 dbSNP
rs879575251 2369 dbSNP
rs1213038235 2371 dbSNP
rs994242138 2372 dbSNP
rs745932896 2381 dbSNP
rs567956229 2382 dbSNP
rs1168898115 2384 dbSNP
rs1424630447 2387 dbSNP
rs140630641 2388 dbSNP
rs1052562153 2392 dbSNP
rs1475154058 2395 dbSNP
rs935406914 2398 dbSNP
rs1162606151 2407 dbSNP
rs10683543 2409 dbSNP
rs189488413 2410 dbSNP
rs3214803 2410 dbSNP
rs200498445 2411 dbSNP
rs1286622748 2412 dbSNP
rs184763088 2413 dbSNP
rs1383771891 2416 dbSNP
rs925318015 2418 dbSNP
rs531507699 2421 dbSNP
rs1353386367 2422 dbSNP
rs564197582 2423 dbSNP
rs1288867775 2424 dbSNP
rs187767137 2426 dbSNP
rs527316986 2427 dbSNP
rs560089909 2432 dbSNP
rs201443850 2435 dbSNP
rs894774473 2437 dbSNP
rs911109861 2438 dbSNP
rs1042150466 2439 dbSNP
rs986667323 2444 dbSNP
rs955230958 2453 dbSNP
rs945145829 2454 dbSNP
rs1183355095 2460 dbSNP
rs1253212308 2468 dbSNP
rs1245580136 2471 dbSNP
rs1156303327 2473 dbSNP
rs1362748930 2482 dbSNP
rs541985132 2486 dbSNP
rs972543153 2492 dbSNP
rs1373274558 2503 dbSNP
rs1413871559 2505 dbSNP
rs962741203 2507 dbSNP
rs1056502594 2518 dbSNP
rs1274688129 2523 dbSNP
rs1306344801 2528 dbSNP
rs1312798898 2529 dbSNP
rs1448007567 2534 dbSNP
rs1278378858 2535 dbSNP
rs1016601010 2536 dbSNP
rs1206295456 2543 dbSNP
rs1372988155 2543 dbSNP
rs1479923978 2546 dbSNP
rs1177182135 2547 dbSNP
rs1268696920 2550 dbSNP
rs1454305049 2553 dbSNP
rs1194964775 2555 dbSNP
rs146837960 2555 dbSNP
rs563074978 2559 dbSNP
rs1433778107 2568 dbSNP
rs1170875590 2572 dbSNP
rs183670159 2575 dbSNP
rs1460383419 2581 dbSNP
rs926511081 2581 dbSNP
rs1439219423 2586 dbSNP
rs1350025250 2594 dbSNP
rs1368220670 2606 dbSNP
rs1301969048 2615 dbSNP
rs1443118158 2616 dbSNP
rs1301412437 2618 dbSNP
rs1231522218 2633 dbSNP
rs544786881 2636 dbSNP
rs1275523099 2637 dbSNP
rs577478616 2639 dbSNP
rs1023920112 2644 dbSNP
rs1266482677 2645 dbSNP
rs1470233408 2648 dbSNP
rs1215005087 2655 dbSNP
rs951869279 2656 dbSNP
rs1453390152 2669 dbSNP
rs774503119 2670 dbSNP
rs1421245356 2671 dbSNP
rs896691353 2674 dbSNP
rs1169498598 2681 dbSNP
rs545512767 2683 dbSNP
rs1463007664 2686 dbSNP
rs1158826557 2687 dbSNP
rs559019496 2690 dbSNP
rs972791211 2692 dbSNP
rs961407065 2693 dbSNP
rs142410866 2705 dbSNP
rs553431795 2709 dbSNP
rs1313963523 2710 dbSNP
rs13415304 2728 dbSNP
rs1337580144 2737 dbSNP
rs954094805 2757 dbSNP
rs1043746634 2762 dbSNP
rs1192908964 2765 dbSNP
rs1028977488 2767 dbSNP
rs1488752856 2775 dbSNP
rs942725805 2776 dbSNP
rs911204583 2783 dbSNP
rs1215888002 2784 dbSNP
rs1001149729 2787 dbSNP
rs1484721282 2792 dbSNP
rs986717996 2796 dbSNP
rs1418354822 2800 dbSNP
rs1476132961 2803 dbSNP
rs1162638625 2804 dbSNP
rs1417123822 2810 dbSNP
rs1401293390 2821 dbSNP
rs1320387042 2839 dbSNP
rs1269741431 2851 dbSNP
rs149206932 2853 dbSNP
rs1042538760 2859 dbSNP
rs1489865051 2860 dbSNP
rs1009747568 2861 dbSNP
rs2250522 2864 dbSNP
rs1231869611 2867 dbSNP
rs536356878 2874 dbSNP
rs1056237273 2876 dbSNP
rs1223838528 2889 dbSNP
rs972938631 2895 dbSNP
rs1316770074 2897 dbSNP
rs937658673 2898 dbSNP
rs1214690486 2906 dbSNP
rs568548966 2912 dbSNP
rs1486505078 2929 dbSNP
rs1185541235 2931 dbSNP
rs568965534 2933 dbSNP
rs1017064040 2945 dbSNP
rs979862080 2947 dbSNP
rs969733054 2949 dbSNP
rs930602196 2951 dbSNP
rs1405935165 2953 dbSNP
rs1400318384 2960 dbSNP
rs145407977 2964 dbSNP
rs537609820 2966 dbSNP
rs1361832480 2967 dbSNP
rs1312712105 2968 dbSNP
rs191935743 2969 dbSNP
rs1445040853 2981 dbSNP
rs1466350391 2985 dbSNP
rs1347856525 2987 dbSNP
rs971841754 2988 dbSNP
rs1280513775 2998 dbSNP
rs1349620201 3005 dbSNP
rs1208452081 3014 dbSNP
rs1279432358 3015 dbSNP
rs1452588839 3026 dbSNP
rs1343265406 3027 dbSNP
rs965868561 3028 dbSNP
rs758042462 3030 dbSNP
rs747320795 3031 dbSNP
rs1177928726 3032 dbSNP
rs1397101526 3032 dbSNP
rs1433166780 3032 dbSNP
rs904008166 3036 dbSNP
rs188259535 3037 dbSNP
rs1303583627 3039 dbSNP
rs144115947 3039 dbSNP
rs79503121 3039 dbSNP
rs1006973005 3044 dbSNP
rs1265426368 3045 dbSNP
rs778471375 3048 dbSNP
rs1197372577 3051 dbSNP
rs1270717962 3052 dbSNP
rs1206007109 3057 dbSNP
rs1437223596 3059 dbSNP
rs1485654160 3066 dbSNP
rs1214391706 3069 dbSNP
rs566352233 3073 dbSNP
rs889816817 3075 dbSNP
rs1051011489 3079 dbSNP
rs1452784357 3087 dbSNP
rs896675475 3093 dbSNP
rs1373884438 3095 dbSNP
rs1212722747 3114 dbSNP
rs933912200 3115 dbSNP
rs1313099711 3123 dbSNP
rs1001995745 3140 dbSNP
rs1462494433 3149 dbSNP
rs1325963274 3150 dbSNP
rs918477819 3153 dbSNP
rs1396097167 3170 dbSNP
rs904856758 3171 dbSNP
rs1300119599 3176 dbSNP
rs1048673197 3178 dbSNP
rs576233880 3189 dbSNP
rs756914138 3196 dbSNP
rs764551283 3199 dbSNP
rs1268266564 3205 dbSNP
rs1233875950 3206 dbSNP
rs1317192063 3206 dbSNP
rs941218546 3209 dbSNP
rs150073567 3210 dbSNP
rs1467158196 3218 dbSNP
rs897721228 3220 dbSNP
rs1036258495 3229 dbSNP
rs1449017731 3234 dbSNP
rs1191484145 3236 dbSNP
rs1170669030 3238 dbSNP
rs980294874 3240 dbSNP
rs1475810009 3241 dbSNP
rs911763021 3246 dbSNP
rs1416376731 3255 dbSNP
rs1359465659 3267 dbSNP
rs1478871369 3272 dbSNP
rs1292448930 3279 dbSNP
rs1304168268 3292 dbSNP
rs969763900 3296 dbSNP
rs183605861 3298 dbSNP
rs1466369161 3299 dbSNP
rs916924032 3301 dbSNP
rs372450349 3310 dbSNP
rs960960803 3311 dbSNP
rs1031699997 3312 dbSNP
rs1467111859 3314 dbSNP
rs1332602137 3328 dbSNP
rs1244139363 3342 dbSNP
rs1261459806 3342 dbSNP
rs1425936607 3344 dbSNP
rs1262769919 3347 dbSNP
rs932711628 3349 dbSNP
rs1193957945 3371 dbSNP
rs753384476 3375 dbSNP
rs1427954661 3376 dbSNP
rs921357017 3378 dbSNP
rs562532968 3380 dbSNP
rs999764664 3387 dbSNP
rs968661425 3390 dbSNP
rs979399934 3391 dbSNP
rs1259944187 3394 dbSNP
rs1363926787 3398 dbSNP
rs1183759841 3400 dbSNP
rs1454913627 3402 dbSNP
rs139443908 3405 dbSNP
rs1156402936 3414 dbSNP
rs190410567 3415 dbSNP
rs147780493 3431 dbSNP
rs1415105345 3432 dbSNP
rs1021199771 3434 dbSNP
rs758692858 3440 dbSNP
rs565474070 3443 dbSNP
rs1337564798 3446 dbSNP
rs78496675 3453 dbSNP
rs1285497353 3457 dbSNP
rs1051064270 3461 dbSNP
rs1320582095 3467 dbSNP
rs1348887748 3471 dbSNP
rs1213450576 3474 dbSNP
rs1278687056 3481 dbSNP
rs1483195641 3497 dbSNP
rs1178231785 3504 dbSNP
rs998111238 3509 dbSNP
rs763907975 3514 dbSNP
rs1176251496 3534 dbSNP
rs1379287561 3553 dbSNP
rs1226083632 3563 dbSNP
rs1305196540 3564 dbSNP
rs573444908 3566 dbSNP
rs1314431925 3576 dbSNP
rs1396241734 3579 dbSNP
rs904908233 3585 dbSNP
rs1465381604 3596 dbSNP
rs1298641171 3601 dbSNP
rs1398553195 3603 dbSNP
rs1308696197 3605 dbSNP
rs760760732 3605 dbSNP
rs1037378138 3626 dbSNP
rs570834403 3639 dbSNP
rs1381846660 3640 dbSNP
rs1301553047 3642 dbSNP
rs1311935033 3645 dbSNP
rs941283007 3648 dbSNP
rs1448961800 3651 dbSNP
rs909716869 3651 dbSNP
rs994441987 3654 dbSNP
rs1400983785 3659 dbSNP
rs1237079403 3667 dbSNP
rs1167211023 3668 dbSNP
rs1195063794 3671 dbSNP
rs1461558288 3673 dbSNP
rs897521706 3673 dbSNP
rs1036227228 3676 dbSNP
rs1044199941 3680 dbSNP
rs554547782 3682 dbSNP
rs1464061995 3686 dbSNP
rs140424692 3687 dbSNP
rs1330734453 3692 dbSNP
rs1395245949 3693 dbSNP
rs1443234505 3696 dbSNP
rs916976043 3699 dbSNP
rs760404097 3702 dbSNP
rs552569474 3712 dbSNP
rs924299449 3727 dbSNP
rs1306235532 3731 dbSNP
rs1445440300 3731 dbSNP
rs978783485 3734 dbSNP
rs556594957 3746 dbSNP
rs968293708 3754 dbSNP
rs1468509811 3756 dbSNP
rs1215028602 3761 dbSNP
rs1050234129 3763 dbSNP
rs765753267 3772 dbSNP
rs1186885503 3774 dbSNP
rs1421448900 3777 dbSNP
rs985569790 3778 dbSNP
rs954138743 3781 dbSNP
rs1029728093 3787 dbSNP
rs1418491495 3788 dbSNP
rs1195659495 3791 dbSNP
rs549222306 3796 dbSNP
rs1162834887 3803 dbSNP
rs1349509217 3808 dbSNP
rs979535962 3810 dbSNP
rs946687347 3820 dbSNP
rs913940149 3825 dbSNP
rs150553520 3834 dbSNP
rs1294376166 3837 dbSNP
rs960951280 3838 dbSNP
rs1015562687 3841 dbSNP
rs1358249628 3844 dbSNP
rs1005886513 3847 dbSNP
rs539118374 3848 dbSNP
rs1027344321 3849 dbSNP
rs185693462 3852 dbSNP
rs1487147356 3853 dbSNP
rs1192684592 3854 dbSNP
rs961685106 3860 dbSNP
rs1476182844 3862 dbSNP
rs1014503708 3866 dbSNP
rs948563652 3868 dbSNP
rs1161508974 3869 dbSNP
rs1358872669 3870 dbSNP
rs1419424355 3874 dbSNP
rs1328106568 3878 dbSNP
rs1357914879 3878 dbSNP
rs1284146403 3879 dbSNP
rs1377758091 3879 dbSNP
rs1389602098 3881 dbSNP
rs895634684 3882 dbSNP
rs1351128734 3888 dbSNP
rs1056942305 3897 dbSNP
rs1050792104 3898 dbSNP
rs934391876 3900 dbSNP
rs1394481705 3902 dbSNP
rs74327996 3915 dbSNP
rs10639750 3916 dbSNP
rs1239478334 3916 dbSNP
rs1491011737 3916 dbSNP
rs548554712 3916 dbSNP
rs62182780 3917 dbSNP
rs1174623924 3918 dbSNP
rs558678175 3919 dbSNP
rs1384869232 3920 dbSNP
rs533846503 3927 dbSNP
rs1161838820 3929 dbSNP
rs1442278299 3933 dbSNP
rs1310899614 3939 dbSNP
rs904386298 3951 dbSNP
rs1364729588 3952 dbSNP
rs978410660 3956 dbSNP
rs114678102 3960 dbSNP
rs180894982 3961 dbSNP
rs1303718989 3972 dbSNP
rs915466561 3973 dbSNP
rs1436559902 3978 dbSNP
rs1268899393 3980 dbSNP
rs1198521446 3983 dbSNP
rs946825307 4006 dbSNP
rs913992064 4026 dbSNP
rs1206716366 4028 dbSNP
rs1457469362 4036 dbSNP
rs1490030136 4036 dbSNP
rs1289162026 4043 dbSNP
rs1397121019 4044 dbSNP
rs79634835 4052 dbSNP
rs1351217719 4053 dbSNP
rs202114568 4054 dbSNP
rs1412169328 4055 dbSNP
rs200785921 4055 dbSNP
rs141740783 4057 dbSNP
rs1332790442 4061 dbSNP
rs1445446429 4062 dbSNP
rs1326086584 4067 dbSNP
rs1214409935 4068 dbSNP
rs1230776788 4068 dbSNP
rs1274102822 4068 dbSNP
rs1276030633 4068 dbSNP
rs1332476496 4068 dbSNP
rs1457320300 4068 dbSNP
rs397987423 4068 dbSNP
rs56967058 4068 dbSNP
rs575600999 4068 dbSNP
rs1255104921 4069 dbSNP
rs1283790821 4070 dbSNP
rs1405641587 4072 dbSNP
rs879535144 4081 dbSNP
rs1301591406 4082 dbSNP
rs1476605532 4082 dbSNP
rs529747511 4084 dbSNP
rs370584484 4089 dbSNP
rs866538424 4089 dbSNP
rs981457629 4089 dbSNP
rs1384763056 4096 dbSNP
rs920799012 4102 dbSNP
rs189702169 4104 dbSNP
rs1199146445 4110 dbSNP
rs1468889710 4131 dbSNP
rs566997498 4133 dbSNP
rs1276158355 4153 dbSNP
rs1317277685 4161 dbSNP
rs1233968127 4170 dbSNP
rs1200710480 4178 dbSNP
rs1015100049 4179 dbSNP
rs1209414767 4181 dbSNP
rs753382209 4182 dbSNP
rs961447220 4183 dbSNP
rs1266146326 4194 dbSNP
rs1489438490 4201 dbSNP
rs770864890 4209 dbSNP
rs550744051 4215 dbSNP
rs536365604 4220 dbSNP
rs567779089 4223 dbSNP
rs58919792 4224 dbSNP
rs148469963 4231 dbSNP
rs368956216 4232 dbSNP
rs187499684 4254 dbSNP
rs996530384 4260 dbSNP
rs1181712829 4261 dbSNP
rs1455956391 4262 dbSNP
rs1283071536 4272 dbSNP
rs1162241650 4279 dbSNP
rs1385235393 4281 dbSNP
rs770299979 4283 dbSNP
rs1421271977 4289 dbSNP
rs1296183357 4293 dbSNP
rs1339716042 4295 dbSNP
rs534230431 4307 dbSNP
rs144608462 4308 dbSNP
rs895687094 4314 dbSNP
rs1314796426 4319 dbSNP
rs774417785 4325 dbSNP
rs1346787898 4327 dbSNP
rs1338734326 4330 dbSNP
rs1263682289 4333 dbSNP
rs1056954421 4336 dbSNP
rs374868340 4338 dbSNP
rs1042874724 4340 dbSNP
rs1261475599 4340 dbSNP
rs1214901479 4346 dbSNP
rs1222816711 4347 dbSNP
rs1345024637 4350 dbSNP
rs1281425351 4353 dbSNP
rs748512802 4353 dbSNP
rs1254728076 4357 dbSNP
rs561213454 4358 dbSNP
rs1421477870 4362 dbSNP
rs1433208184 4363 dbSNP
rs1186295618 4381 dbSNP
rs1380520414 4383 dbSNP
rs781782451 4388 dbSNP
rs1043129044 4389 dbSNP
rs1156588882 4389 dbSNP
rs1317846367 4390 dbSNP
rs947099281 4399 dbSNP
rs1399337610 4406 dbSNP
rs1399999601 4410 dbSNP
rs910198132 4417 dbSNP
rs985713797 4418 dbSNP
rs1408675021 4423 dbSNP
rs1052970908 4426 dbSNP
rs932895778 4428 dbSNP
rs1307881512 4430 dbSNP
rs1379358726 4433 dbSNP
rs1238313174 4434 dbSNP
rs1469727287 4438 dbSNP
rs796398966 4440 dbSNP
rs1235898580 4452 dbSNP
rs1254751515 4453 dbSNP
rs1195251312 4457 dbSNP
rs1199355454 4461 dbSNP
rs1238304915 4463 dbSNP
rs922777041 4468 dbSNP
rs1475427161 4478 dbSNP
rs1458730491 4481 dbSNP
rs1176353191 4493 dbSNP
rs1241169166 4494 dbSNP
rs1433494996 4500 dbSNP
rs1178039042 4508 dbSNP
rs976866378 4509 dbSNP
rs1190489890 4512 dbSNP
rs1465518610 4520 dbSNP
rs1298798458 4530 dbSNP
rs1402492736 4534 dbSNP
rs1444700164 4534 dbSNP
rs1330857935 4537 dbSNP
rs1372021382 4538 dbSNP
rs1240066193 4542 dbSNP
rs769256811 4547 dbSNP
rs1388881251 4552 dbSNP
rs1443990725 4554 dbSNP
rs1299689754 4555 dbSNP
rs961774725 4556 dbSNP
rs927986807 4557 dbSNP
rs1228731187 4559 dbSNP
rs1260583713 4561 dbSNP
rs1319302871 4562 dbSNP
rs1196223002 4577 dbSNP
rs1237175446 4583 dbSNP
rs908656398 4586 dbSNP
rs1243509334 4590 dbSNP
rs376436125 4602 dbSNP
rs984594606 4606 dbSNP
rs542899128 4614 dbSNP
rs1432411528 4615 dbSNP
rs1171256200 4618 dbSNP
rs1425698279 4619 dbSNP
rs7602076 4620 dbSNP
rs1012848328 4628 dbSNP
rs959904564 4633 dbSNP
rs1350651739 4645 dbSNP
rs1438931557 4647 dbSNP
rs376158317 4651 dbSNP
rs77589546 4653 dbSNP
rs1340091460 4655 dbSNP
rs181994271 4657 dbSNP
rs1280582520 4662 dbSNP
rs1428885303 4666 dbSNP
rs1385510607 4667 dbSNP
rs1216251067 4675 dbSNP
rs1337778778 4676 dbSNP
rs1452322086 4681 dbSNP
rs1321925145 4690 dbSNP
rs998670451 4692 dbSNP
rs1263348192 4704 dbSNP
rs903002546 4706 dbSNP
rs1173090863 4709 dbSNP
rs558492016 4718 dbSNP
rs1042833612 4719 dbSNP
rs72926408 4720 dbSNP
rs888813896 4725 dbSNP
rs573057771 4726 dbSNP
rs1414562169 4736 dbSNP
rs1446057377 4737 dbSNP
rs954395491 4740 dbSNP
rs1162861092 4748 dbSNP
rs1420676676 4749 dbSNP
rs1243567522 4756 dbSNP
rs1050014403 4758 dbSNP
rs1300508697 4764 dbSNP
rs1359154867 4765 dbSNP
rs1399982213 4766 dbSNP
rs1294466977 4769 dbSNP
rs1379216354 4778 dbSNP
rs777389281 4781 dbSNP
rs932925294 4781 dbSNP
rs1320808190 4782 dbSNP
rs922830768 4782 dbSNP
rs1041683320 4783 dbSNP
rs554928727 4786 dbSNP
rs536549532 4787 dbSNP
rs1239957710 4790 dbSNP
rs774383329 4791 dbSNP
rs1215752833 4804 dbSNP
rs563762948 4806 dbSNP
rs1473784730 4807 dbSNP
rs984256485 4812 dbSNP
rs1413340993 4814 dbSNP
rs1440594481 4821 dbSNP
rs1160802987 4824 dbSNP
rs1213083116 4825 dbSNP
rs73060643 4826 dbSNP
rs1157718342 4827 dbSNP
rs1335368235 4830 dbSNP
rs1361424247 4833 dbSNP
rs1021567182 4841 dbSNP
rs930441954 4846 dbSNP
rs538361716 4847 dbSNP
rs1380951443 4851 dbSNP
rs1010051631 4853 dbSNP
rs1300486847 4853 dbSNP
rs915918562 4854 dbSNP
rs1031075500 4855 dbSNP
rs1239172979 4855 dbSNP
rs891650683 4855 dbSNP
rs1208074885 4856 dbSNP
rs1353460744 4856 dbSNP
rs1004073222 4857 dbSNP
rs906618802 4858 dbSNP
rs1326239619 4860 dbSNP
rs1425965913 4870 dbSNP
rs1180703153 4871 dbSNP
rs1378707401 4871 dbSNP
rs199536675 4871 dbSNP
rs369267717 4871 dbSNP
rs757615866 4871 dbSNP
rs773797051 4871 dbSNP
rs879072049 4871 dbSNP
rs1289895573 4872 dbSNP
rs1347009516 4872 dbSNP
rs1491192036 4872 dbSNP
rs1491283673 4872 dbSNP
rs1491348578 4873 dbSNP
rs1385503928 4874 dbSNP
rs1162474877 4875 dbSNP
rs1442552368 4876 dbSNP
rs1409885345 4878 dbSNP
rs1177769824 4880 dbSNP
rs1469545881 4881 dbSNP
rs974603775 4884 dbSNP
rs1045436830 4889 dbSNP
rs754474420 4891 dbSNP
rs964618705 4901 dbSNP
rs2250800 4904 dbSNP
rs546894098 4905 dbSNP
rs1202551123 4907 dbSNP
rs1172433855 4908 dbSNP
rs1490843807 4911 dbSNP
rs1424982226 4915 dbSNP
rs1292787742 4916 dbSNP
rs1465676803 4917 dbSNP
rs1172277246 4928 dbSNP
rs751123830 4929 dbSNP
rs528696807 4946 dbSNP
rs1357810762 4950 dbSNP
rs1037940248 4953 dbSNP
rs959958844 4956 dbSNP
rs1309571212 4966 dbSNP
rs1332567612 4969 dbSNP
rs562563288 4972 dbSNP
rs940849835 4985 dbSNP
rs908070953 4986 dbSNP
rs1282499043 4987 dbSNP
rs1341122794 5006 dbSNP
rs1220543508 5008 dbSNP
rs1035634263 5012 dbSNP
rs1373285854 5013 dbSNP
rs1338846107 5016 dbSNP
rs933028664 5025 dbSNP
rs1292294771 5027 dbSNP
rs999160408 5028 dbSNP
rs561125011 5038 dbSNP
rs974378845 5041 dbSNP
rs1021868965 5047 dbSNP
rs968393830 5049 dbSNP
rs1479111825 5050 dbSNP
rs1011332371 5051 dbSNP
rs752457589 5066 dbSNP
rs1365592089 5072 dbSNP
rs988760642 5073 dbSNP
rs1163413248 5077 dbSNP
rs1422346983 5078 dbSNP
rs955893766 5078 dbSNP
rs1302389722 5085 dbSNP
rs1361059303 5093 dbSNP
rs1401825506 5094 dbSNP
rs1276258383 5095 dbSNP
rs190557489 5095 dbSNP
rs1245625236 5098 dbSNP
rs1346800020 5115 dbSNP
rs879834567 5123 dbSNP
rs185298048 5124 dbSNP
rs1354595175 5126 dbSNP
rs1222174777 5132 dbSNP
rs1399846856 5139 dbSNP
rs1405718401 5152 dbSNP
rs1002717074 5154 dbSNP
rs1201411704 5156 dbSNP
rs371014319 5160 dbSNP
rs1261648433 5162 dbSNP
rs906581739 5171 dbSNP
rs901499673 5172 dbSNP
rs1369836480 5180 dbSNP
rs1041340807 5183 dbSNP
rs545060427 5186 dbSNP
rs1380634991 5188 dbSNP
rs1487609078 5189 dbSNP
rs940260917 5203 dbSNP
rs1396672766 5204 dbSNP
rs563344471 5205 dbSNP
rs1216988802 5206 dbSNP
rs1037910767 5208 dbSNP
rs940986076 5214 dbSNP
rs1316645186 5215 dbSNP
rs1356214976 5216 dbSNP
rs1049002845 5219 dbSNP
rs1260638829 5222 dbSNP
rs376564062 5223 dbSNP
rs1052332474 5224 dbSNP
rs1200502865 5227 dbSNP
rs933519868 5228 dbSNP
rs1282065282 5233 dbSNP
rs921654152 5234 dbSNP
rs578043874 5235 dbSNP
rs759538507 5236 dbSNP
rs1238417138 5244 dbSNP
rs1441297155 5258 dbSNP
rs974516020 5263 dbSNP
rs947026347 5266 dbSNP
rs1466531026 5268 dbSNP
rs915967690 5276 dbSNP
rs145648108 5277 dbSNP
rs1332230846 5281 dbSNP
rs1452792367 5289 dbSNP
rs1445023224 5297 dbSNP
rs1306791125 5303 dbSNP
rs1313278634 5304 dbSNP
rs988475766 5306 dbSNP
rs938684978 5317 dbSNP
rs1178569516 5318 dbSNP
rs1470231203 5328 dbSNP
rs1202547211 5329 dbSNP
rs1430116471 5329 dbSNP
rs181502320 5330 dbSNP
rs573120043 5332 dbSNP
rs1175833831 5340 dbSNP
rs1238400658 5344 dbSNP
rs1431459635 5345 dbSNP
rs1458843625 5346 dbSNP
rs1175242705 5350 dbSNP
rs1264144778 5351 dbSNP
rs1187266301 5356 dbSNP
rs1249496791 5356 dbSNP
rs10650425 5357 dbSNP
rs1469344221 5358 dbSNP
rs2264901 5358 dbSNP
rs1297845794 5360 dbSNP
rs1464311175 5360 dbSNP
rs1368703792 5362 dbSNP
rs1485786657 5362 dbSNP
rs928582159 5363 dbSNP
rs981658482 5367 dbSNP
rs1206177423 5369 dbSNP
rs1324857449 5371 dbSNP
rs1047510 5373 dbSNP
rs201945070 5375 dbSNP
rs1129558 5377 dbSNP
rs1241030170 5377 dbSNP
rs67160931 5378 dbSNP
rs10650424 5379 dbSNP
rs1488652234 5379 dbSNP
rs1169930547 5381 dbSNP
rs1350741665 5381 dbSNP
rs1459761663 5381 dbSNP
rs1488308709 5381 dbSNP
rs2957328 5381 dbSNP
rs372040819 5381 dbSNP
rs372249473 5381 dbSNP
rs990361725 5382 dbSNP
rs1379419119 5383 dbSNP
rs199519643 5383 dbSNP
rs567216499 5383 dbSNP
rs1358384519 5384 dbSNP
rs1297421750 5385 dbSNP
rs953202400 5385 dbSNP
rs969939147 5385 dbSNP
rs1028724084 5387 dbSNP
rs1242775004 5388 dbSNP
rs1023661878 5389 dbSNP
rs1012321149 5390 dbSNP
rs1406384994 5393 dbSNP
rs73990636 5393 dbSNP
rs963346435 5394 dbSNP
rs1359167770 5396 dbSNP
rs1454143369 5397 dbSNP
rs200542761 5397 dbSNP
rs71408937 5397 dbSNP
rs1441239229 5398 dbSNP
rs1275348828 5400 dbSNP
rs1318707637 5400 dbSNP
rs1347365626 5400 dbSNP
rs201489616 5401 dbSNP
rs1197703249 5402 dbSNP
rs1363263602 5404 dbSNP
rs1271182481 5405 dbSNP
rs76899339 5406 dbSNP
rs1437555591 5408 dbSNP
rs538594533 5408 dbSNP
rs571142435 5410 dbSNP
rs1479777762 5412 dbSNP
rs1199348730 5419 dbSNP
rs1453045890 5420 dbSNP
rs1427910247 5421 dbSNP
rs879131031 5422 dbSNP
rs546704483 5424 dbSNP
rs1334544475 5449 dbSNP
rs1409122445 5450 dbSNP
rs1464615880 5450 dbSNP
rs916052468 5450 dbSNP
rs998077335 5456 dbSNP
rs1004473580 5462 dbSNP
rs1302472791 5465 dbSNP
rs1402961149 5465 dbSNP
rs1164431210 5467 dbSNP
rs1038798263 5469 dbSNP
rs900703963 5469 dbSNP
rs1339061970 5474 dbSNP
rs887335510 5480 dbSNP
rs1294333185 5482 dbSNP
rs914330455 5495 dbSNP
rs1388749973 5504 dbSNP
rs1264561138 5506 dbSNP
rs1052742027 5507 dbSNP
rs934362044 5507 dbSNP
rs1491147029 5508 dbSNP
rs1462009830 5509 dbSNP
rs1163493555 5513 dbSNP
rs1243075325 5516 dbSNP
rs1386788661