miRTarBase - #MIRT562204 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HNRNPA2B1   
Description heterogeneous nuclear ribonucleoprotein A2/B1
Transcript NM_002137   
Other Transcripts NM_031243   
Putative miRNA Targets on HNRNPA2B1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            :|:| |: |||  ||||||| 
705 - 727 156.00 -13.20
miRNA  3' guguUUGGU---AAU------ACACGACGAu 5'
              |:|||   |||      |||||||:| 
814 - 844 140.00 -13.06
            |||: :||  | ||||||  
1249 - 1269 135.00 -9.62
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN24396006 26 COSMIC
COSN20061525 35 COSMIC
COSN28870584 145 COSMIC
COSN32050070 145 COSMIC
COSN508658 182 COSMIC
COSN24302256 193 COSMIC
COSN19444660 239 COSMIC
COSN31566653 239 COSMIC
COSN5099553 261 COSMIC
COSN19444659 262 COSMIC
COSN19444658 293 COSMIC
COSN9983798 296 COSMIC
COSN31530353 314 COSMIC
COSN27590210 387 COSMIC
COSN28686221 578 COSMIC
COSN8406827 586 COSMIC
COSN20838752 597 COSMIC
COSN14660517 646 COSMIC
COSN29989203 647 COSMIC
COSN31608922 663 COSMIC
COSN17189006 915 COSMIC
COSN29552640 1142 COSMIC
COSN22205014 1265 COSMIC
COSN15754558 1409 COSMIC
COSN22180371 1450 COSMIC
COSN16128253 1458 COSMIC
COSN30543582 1462 COSMIC
COSN31569757 1483 COSMIC
COSN29039187 1558 COSMIC
COSN31537226 1605 COSMIC
COSN21669754 1644 COSMIC
COSN24014574 1668 COSMIC
COSN21582973 1930 COSMIC
COSN30446385 2037 COSMIC
COSN31660849 2094 COSMIC
COSN31541420 2150 COSMIC
COSN6876875 2158 COSMIC
COSN31536034 2230 COSMIC
COSN4932964 2231 COSMIC
COSN28300322 2255 COSMIC
COSN31489862 2297 COSMIC
COSN2217427 2314 COSMIC
COSN4868798 2324 COSMIC
COSN31553521 2478 COSMIC
COSN8406826 2499 COSMIC
COSN32200471 2528 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1466814485 2 dbSNP
rs902886039 3 dbSNP
rs200301894 4 dbSNP
rs760843236 5 dbSNP
rs760764771 8 dbSNP
rs780061421 8 dbSNP
rs750906630 9 dbSNP
rs756219376 9 dbSNP
rs772119326 9 dbSNP
rs1478648972 10 dbSNP
rs917261057 10 dbSNP
rs748712123 11 dbSNP
rs1192479818 13 dbSNP
rs768069321 15 dbSNP
rs150895465 16 dbSNP
rs1239147009 17 dbSNP
rs779388965 18 dbSNP
rs112918759 22 dbSNP
rs539255107 29 dbSNP
rs1456705763 30 dbSNP
rs368287762 34 dbSNP
rs756818963 35 dbSNP
rs751190025 36 dbSNP
rs910139787 37 dbSNP
rs1276616644 39 dbSNP
rs375284812 41 dbSNP
rs775655448 44 dbSNP
rs757964758 45 dbSNP
rs752744674 46 dbSNP
rs1168544278 48 dbSNP
rs1026712298 49 dbSNP
rs954208863 51 dbSNP
rs1330555116 53 dbSNP
rs1333081773 55 dbSNP
rs1028484804 56 dbSNP
rs1301530516 56 dbSNP
rs993518585 59 dbSNP
rs1223126039 61 dbSNP
rs1230610410 65 dbSNP
rs1471987323 66 dbSNP
rs1406934694 67 dbSNP
rs1366414892 69 dbSNP
rs376066830 70 dbSNP
rs1474085185 73 dbSNP
rs183941705 76 dbSNP
rs1162484535 78 dbSNP
rs1016183416 87 dbSNP
rs772184758 88 dbSNP
rs1327104602 90 dbSNP
rs1369961549 91 dbSNP
rs1410536391 94 dbSNP
rs1410871395 97 dbSNP
rs1310343632 102 dbSNP
rs1045485044 103 dbSNP
rs76429846 105 dbSNP
rs1285228220 109 dbSNP
rs1358916756 114 dbSNP
rs1470199601 117 dbSNP
rs568358609 122 dbSNP
rs1229621441 128 dbSNP
rs1270477722 135 dbSNP
rs555168454 136 dbSNP
rs893432583 137 dbSNP
rs2853809 143 dbSNP
rs1196628990 144 dbSNP
rs1032239020 145 dbSNP
rs1186570274 154 dbSNP
rs1002048228 155 dbSNP
rs879817983 155 dbSNP
rs1166316546 156 dbSNP
rs1269114573 156 dbSNP
rs2853810 157 dbSNP
rs1214866370 158 dbSNP
rs1389814136 161 dbSNP
rs1314861113 162 dbSNP
rs1286295460 163 dbSNP
rs1046210165 166 dbSNP
rs1170632356 167 dbSNP
rs879059343 172 dbSNP
rs878941294 173 dbSNP
rs112332539 175 dbSNP
rs111456264 176 dbSNP
rs950213832 180 dbSNP
rs1344417908 192 dbSNP
rs1281520693 193 dbSNP
rs1395891685 196 dbSNP
rs745947242 203 dbSNP
rs1335466752 212 dbSNP
rs1342588325 218 dbSNP
rs1046257581 230 dbSNP
rs548602926 240 dbSNP
rs895910368 243 dbSNP
rs1346435558 249 dbSNP
rs1297800925 251 dbSNP
rs1294907430 262 dbSNP
rs778830338 263 dbSNP
rs1228477552 266 dbSNP
rs1276235334 273 dbSNP
rs1052496869 276 dbSNP
rs1037484352 286 dbSNP
rs936332762 293 dbSNP
rs1190805872 296 dbSNP
rs1247630801 296 dbSNP
rs1443886042 296 dbSNP
rs1450401378 297 dbSNP
rs903568399 298 dbSNP
rs1170724077 300 dbSNP
rs1393289026 307 dbSNP
rs1043269882 309 dbSNP
rs1347247046 319 dbSNP
rs1173633133 328 dbSNP
rs528739085 329 dbSNP
rs9806 340 dbSNP
rs566365325 350 dbSNP
rs1319567004 351 dbSNP
rs1414457535 353 dbSNP
rs1405033227 355 dbSNP
rs940022639 357 dbSNP
rs1320371500 359 dbSNP
rs1364004679 360 dbSNP
rs1435280547 361 dbSNP
rs1299377223 364 dbSNP
rs1427806761 365 dbSNP
rs909857549 369 dbSNP
rs1173683194 370 dbSNP
rs1231923401 374 dbSNP
rs1256480515 377 dbSNP
rs1481118561 378 dbSNP
rs1347114705 382 dbSNP
rs1206589888 385 dbSNP
rs552776580 387 dbSNP
rs1190703577 389 dbSNP
rs1251408223 391 dbSNP
rs1432637273 391 dbSNP
rs1199734432 396 dbSNP
rs201198080 396 dbSNP
rs921473143 396 dbSNP
rs532769130 401 dbSNP
rs774494885 403 dbSNP
rs1159077748 407 dbSNP
rs1389768057 414 dbSNP
rs965893675 421 dbSNP
rs192474836 423 dbSNP
rs943650706 424 dbSNP
rs1322088952 428 dbSNP
rs1388177240 431 dbSNP
rs910681342 433 dbSNP
rs764165455 434 dbSNP
rs11557708 435 dbSNP
rs1484773735 440 dbSNP
rs1287676437 441 dbSNP
rs988270725 444 dbSNP
rs749133495 447 dbSNP
rs777393637 450 dbSNP
rs1263882769 458 dbSNP
rs763262209 460 dbSNP
rs1243573822 462 dbSNP
rs540110113 463 dbSNP
rs1460868806 467 dbSNP
rs1269466249 476 dbSNP
rs957713873 477 dbSNP
rs919359670 478 dbSNP
rs1182025592 484 dbSNP
rs1413379125 487 dbSNP
rs1205707591 488 dbSNP
rs1031954887 504 dbSNP
rs1002099114 511 dbSNP
rs550675037 517 dbSNP
rs1163281872 518 dbSNP
rs905114702 521 dbSNP
rs755907259 524 dbSNP
rs1013423622 525 dbSNP
rs1212964888 525 dbSNP
rs1293768958 525 dbSNP
rs141587177 527 dbSNP
rs1364328317 530 dbSNP
rs9807 531 dbSNP
rs11557711 534 dbSNP
rs1351085588 536 dbSNP
rs541820828 537 dbSNP
rs1310394943 540 dbSNP
rs573010137 543 dbSNP
rs1271204859 544 dbSNP
rs980671762 546 dbSNP
rs1482090344 551 dbSNP
rs780978393 553 dbSNP
rs754602361 555 dbSNP
rs559247073 558 dbSNP
rs969308297 562 dbSNP
rs1180631641 567 dbSNP
rs1424785423 573 dbSNP
rs1164990754 584 dbSNP
rs1404595548 585 dbSNP
rs751045955 586 dbSNP
rs1427235826 587 dbSNP
rs1167481014 593 dbSNP
rs189172379 594 dbSNP
rs1411509612 596 dbSNP
rs1048425712 597 dbSNP
rs1013423389 598 dbSNP
rs1378110361 603 dbSNP
rs1315066633 604 dbSNP
rs932921618 604 dbSNP
rs570123212 605 dbSNP
rs1030747447 606 dbSNP
rs1041652119 607 dbSNP
rs1421202652 610 dbSNP
rs1049851 612 dbSNP
rs1208584824 613 dbSNP
rs866184159 614 dbSNP
rs1186929934 617 dbSNP
rs868070398 627 dbSNP
rs1483766076 630 dbSNP
rs369559841 631 dbSNP
rs769755119 639 dbSNP
rs1244585408 643 dbSNP
rs914028198 646 dbSNP
rs1187543742 648 dbSNP
rs1390191410 674 dbSNP
rs1411174828 676 dbSNP
rs1173817973 678 dbSNP
rs1000593306 681 dbSNP
rs903514582 682 dbSNP
rs762175637 684 dbSNP
rs1466337464 685 dbSNP
rs943598328 691 dbSNP
rs987879129 693 dbSNP
rs1461833633 697 dbSNP
rs957764082 700 dbSNP
rs1298640116 702 dbSNP
rs1367398801 702 dbSNP
rs1217588653 705 dbSNP
rs1278511455 707 dbSNP
rs183940343 708 dbSNP
rs1266556161 711 dbSNP
rs1477801638 711 dbSNP
rs980413523 729 dbSNP
rs1207656654 730 dbSNP
rs556782403 734 dbSNP
rs1309523372 735 dbSNP
rs1424353820 739 dbSNP
rs778965965 743 dbSNP
rs139197882 747 dbSNP
rs1178519132 749 dbSNP
rs1456540300 752 dbSNP
rs745783245 752 dbSNP
rs1391173341 753 dbSNP
rs550668260 753 dbSNP
rs1434382633 756 dbSNP
rs1274409666 758 dbSNP
rs1368404898 758 dbSNP
rs530482360 758 dbSNP
rs1287025752 760 dbSNP
rs1004340595 763 dbSNP
rs1229439496 765 dbSNP
rs781456058 776 dbSNP
rs554620746 777 dbSNP
rs193027274 782 dbSNP
rs1448426273 783 dbSNP
rs1218735430 784 dbSNP
rs1245553482 785 dbSNP
rs1201453413 788 dbSNP
rs888526009 788 dbSNP
rs942123302 791 dbSNP
rs909185014 792 dbSNP
rs980786325 794 dbSNP
rs969254540 795 dbSNP
rs1024884801 797 dbSNP
rs1460000367 800 dbSNP
rs1350490659 809 dbSNP
rs188388055 819 dbSNP
rs1355969336 824 dbSNP
rs1306682419 826 dbSNP
rs1350469037 828 dbSNP
rs1229377244 830 dbSNP
rs1170653424 833 dbSNP
rs1423808146 835 dbSNP
rs996851356 837 dbSNP
rs1354689924 839 dbSNP
rs899805153 840 dbSNP
rs1288745329 844 dbSNP
rs1185181269 851 dbSNP
rs1445231809 855 dbSNP
rs992523749 858 dbSNP
rs182514356 860 dbSNP
rs1224141434 864 dbSNP
rs956547936 866 dbSNP
rs944273929 871 dbSNP
rs1482727192 878 dbSNP
rs1031279786 879 dbSNP
rs115788913 883 dbSNP
rs1471699946 884 dbSNP
rs1162847610 885 dbSNP
rs539369396 889 dbSNP
rs1414850116 900 dbSNP
rs936458548 905 dbSNP
rs775759977 908 dbSNP
rs903629123 910 dbSNP
rs570261980 926 dbSNP
rs925038022 930 dbSNP
rs980465982 931 dbSNP
rs1339036198 934 dbSNP
rs1481629397 941 dbSNP
rs969094816 943 dbSNP
rs1017854645 947 dbSNP
rs1283219105 948 dbSNP
rs1221939065 950 dbSNP
rs1201065964 958 dbSNP
rs564901099 960 dbSNP
rs1294478127 961 dbSNP
rs111656128 963 dbSNP
rs1340860729 966 dbSNP
rs1247170348 968 dbSNP
rs1316886734 971 dbSNP
rs917560973 986 dbSNP
rs1006518221 987 dbSNP
rs566094791 995 dbSNP
rs890823520 996 dbSNP
rs770994687 997 dbSNP
rs1014795740 1000 dbSNP
rs1186911611 1002 dbSNP
rs1389567769 1003 dbSNP
rs1006065413 1005 dbSNP
rs1052021683 1006 dbSNP
rs1400759171 1008 dbSNP
rs1414252346 1009 dbSNP
rs1308269861 1013 dbSNP
rs1335354924 1013 dbSNP
rs750845438 1018 dbSNP
rs73281542 1019 dbSNP
rs897982047 1020 dbSNP
rs1036547053 1026 dbSNP
rs867594043 1027 dbSNP
rs1165279876 1029 dbSNP
rs1020014943 1032 dbSNP
rs1278981043 1035 dbSNP
rs1425037480 1039 dbSNP
rs1462494260 1042 dbSNP
rs1008518278 1053 dbSNP
rs35442241 1053 dbSNP
rs1247689038 1057 dbSNP
rs892702554 1063 dbSNP
rs551386024 1064 dbSNP
rs1376430413 1075 dbSNP
rs1477950290 1086 dbSNP
rs1052598410 1087 dbSNP
rs942070930 1088 dbSNP
rs1456007139 1092 dbSNP
rs936861145 1095 dbSNP
rs528430593 1099 dbSNP
rs1387514242 1102 dbSNP
rs772219484 1106 dbSNP
rs774368003 1116 dbSNP
rs1044822684 1118 dbSNP
rs1420961482 1119 dbSNP
rs948077800 1120 dbSNP
rs1226401299 1123 dbSNP
rs1267731108 1123 dbSNP
rs1325365552 1123 dbSNP
rs1486356528 1126 dbSNP
rs917934030 1129 dbSNP
rs777363470 1130 dbSNP
rs1451132458 1132 dbSNP
rs947779474 1138 dbSNP
rs1432132061 1141 dbSNP
rs1158966220 1144 dbSNP
rs1471801519 1144 dbSNP
rs1453933134 1148 dbSNP
rs1489940442 1149 dbSNP
rs1290276241 1150 dbSNP
rs992074718 1152 dbSNP
rs917633487 1154 dbSNP
rs992228584 1157 dbSNP
rs146782223 1159 dbSNP
rs190255971 1161 dbSNP
rs940336870 1164 dbSNP
rs1259520205 1166 dbSNP
rs1241724779 1167 dbSNP
rs1407762037 1171 dbSNP
rs1317315988 1172 dbSNP
rs1241395815 1174 dbSNP
rs1263935213 1176 dbSNP
rs907794659 1178 dbSNP
rs1288500324 1182 dbSNP
rs763766330 1185 dbSNP
rs984681477 1185 dbSNP
rs956848180 1186 dbSNP
rs1182089451 1187 dbSNP
rs1252916915 1189 dbSNP
rs1343304206 1192 dbSNP
rs1160789340 1198 dbSNP
rs951870265 1199 dbSNP
rs923751810 1200 dbSNP
rs1456958526 1201 dbSNP
rs1163743435 1202 dbSNP
rs1304527766 1202 dbSNP
rs1028815154 1204 dbSNP
rs1383884724 1206 dbSNP
rs1427682233 1208 dbSNP
rs1307369411 1209 dbSNP
rs1373742876 1211 dbSNP
rs1392963859 1218 dbSNP
rs1310816856 1220 dbSNP
rs979235962 1222 dbSNP
rs967735646 1223 dbSNP
rs1017968521 1224 dbSNP
rs1006637236 1225 dbSNP
rs1246793724 1226 dbSNP
rs1293953921 1229 dbSNP
rs575085976 1233 dbSNP
rs1205014328 1235 dbSNP
rs1252436904 1237 dbSNP
rs1412616487 1238 dbSNP
rs1481804368 1238 dbSNP
rs1180538449 1241 dbSNP
rs1253639968 1242 dbSNP
rs770934802 1242 dbSNP
rs955051505 1243 dbSNP
rs1175847201 1246 dbSNP
rs1479485709 1247 dbSNP
rs747874980 1248 dbSNP
rs1008651849 1249 dbSNP
rs1167852850 1251 dbSNP
rs749225559 1253 dbSNP
rs75112074 1260 dbSNP
rs898091227 1263 dbSNP
rs1401236184 1264 dbSNP
rs1036492892 1269 dbSNP
rs1453574343 1273 dbSNP
rs1006402485 1274 dbSNP
rs1200363122 1275 dbSNP
rs1317456050 1276 dbSNP
rs1001060475 1279 dbSNP
rs1428300239 1279 dbSNP
rs528071802 1282 dbSNP
rs904054790 1288 dbSNP
rs1045209498 1289 dbSNP
rs887984542 1291 dbSNP
rs896234316 1293 dbSNP
rs1462066598 1295 dbSNP
rs1203869591 1296 dbSNP
rs1244641977 1297 dbSNP
rs1045154625 1298 dbSNP
rs1447112513 1298 dbSNP
rs1185485995 1302 dbSNP
rs1420131088 1306 dbSNP
rs1430162082 1309 dbSNP
rs1173880374 1310 dbSNP
rs1428279521 1310 dbSNP
rs558948848 1311 dbSNP
rs1263035209 1312 dbSNP
rs769534583 1313 dbSNP
rs1202506111 1315 dbSNP
rs1434460922 1317 dbSNP
rs545686813 1318 dbSNP
rs1289456081 1319 dbSNP
rs1320745099 1320 dbSNP
rs940366663 1322 dbSNP
rs1301229519 1323 dbSNP
rs1225790621 1325 dbSNP
rs1233446991 1326 dbSNP
rs1264605575 1326 dbSNP
rs1242128601 1327 dbSNP
rs144037257 1330 dbSNP
rs1428563504 1331 dbSNP
rs369896118 1332 dbSNP
rs563101452 1332 dbSNP
rs796635335 1332 dbSNP
rs1345253631 1335 dbSNP
rs917895324 1345 dbSNP
rs1160136755 1346 dbSNP
rs1346999089 1347 dbSNP
rs1434455188 1351 dbSNP
rs1293437606 1353 dbSNP
rs1407138255 1355 dbSNP
rs930528157 1361 dbSNP
rs921800602 1362 dbSNP
rs752424416 1365 dbSNP
rs1056884293 1370 dbSNP
rs1284559476 1371 dbSNP
rs780374465 1377 dbSNP
rs923865907 1378 dbSNP
rs979349024 1384 dbSNP
rs111618262 1386 dbSNP
rs1490474376 1391 dbSNP
rs1201521605 1392 dbSNP
rs967855126 1394 dbSNP
rs911080196 1396 dbSNP
rs780994771 1402 dbSNP
rs1469466856 1403 dbSNP
rs1363898683 1406 dbSNP
rs1468330159 1409 dbSNP
rs1408309787 1412 dbSNP
rs1020136363 1413 dbSNP
rs986875040 1414 dbSNP
rs955315109 1415 dbSNP
rs3210097 1416 dbSNP
rs1173394508 1417 dbSNP
rs3210098 1419 dbSNP
rs956734914 1421 dbSNP
rs3210099 1422 dbSNP
rs1029308593 1429 dbSNP
rs1030943110 1433 dbSNP
rs994241964 1439 dbSNP
rs3210100 1441 dbSNP
rs3210101 1442 dbSNP
rs3210104 1446 dbSNP
rs962255802 1447 dbSNP
rs756529815 1449 dbSNP
rs968265003 1450 dbSNP
rs1429431868 1451 dbSNP
rs1006501283 1452 dbSNP
rs1023857590 1461 dbSNP
rs1224577846 1466 dbSNP
rs1243102283 1467 dbSNP
rs887931982 1475 dbSNP
rs1182209188 1480 dbSNP
rs1272440738 1485 dbSNP
rs1459601349 1491 dbSNP
rs1205032104 1495 dbSNP
rs185008012 1498 dbSNP
rs1012834824 1507 dbSNP
rs1471893049 1509 dbSNP
rs1012308565 1510 dbSNP
rs949799585 1517 dbSNP
rs1167226851 1526 dbSNP
rs1200529073 1534 dbSNP
rs1396474802 1536 dbSNP
rs896626350 1538 dbSNP
rs1331372762 1540 dbSNP
rs896564745 1541 dbSNP
rs574809103 1548 dbSNP
rs1437100999 1560 dbSNP
rs1449955911 1561 dbSNP
rs1313967145 1563 dbSNP
rs1249239209 1567 dbSNP
rs1229370607 1569 dbSNP
rs1365613292 1572 dbSNP
rs1338744990 1573 dbSNP
rs1314302714 1581 dbSNP
rs1274781122 1582 dbSNP
rs1440504961 1583 dbSNP
rs1203221387 1586 dbSNP
rs1056432862 1588 dbSNP
rs1244015887 1588 dbSNP
rs1186819515 1590 dbSNP
rs182284582 1602 dbSNP
rs902559917 1609 dbSNP
rs754618680 1612 dbSNP
rs886127338 1618 dbSNP
rs1048755677 1624 dbSNP
rs930580500 1624 dbSNP
rs1043607763 1627 dbSNP
rs555060593 1628 dbSNP
rs1406441690 1633 dbSNP
rs767946822 1634 dbSNP
rs946666570 1635 dbSNP
rs1325358350 1636 dbSNP
rs751134020 1637 dbSNP
rs1228000615 1640 dbSNP
rs189790171 1641 dbSNP
rs985718078 1643 dbSNP
rs944550920 1652 dbSNP
rs1222721954 1666 dbSNP
rs1263976072 1676 dbSNP
rs911715630 1679 dbSNP
rs933716504 1682 dbSNP
rs987315000 1683 dbSNP
rs922353782 1690 dbSNP
rs572449829 1693 dbSNP
rs1195916967 1696 dbSNP
rs1245532207 1698 dbSNP
rs1480308812 1705 dbSNP
rs559040556 1718 dbSNP
rs74741045 1719 dbSNP
rs1169828969 1720 dbSNP
rs1431912129 1721 dbSNP
rs377264305 1723 dbSNP
rs751169051 1723 dbSNP
rs1156464759 1732 dbSNP
rs550062665 1737 dbSNP
rs764745344 1739 dbSNP
rs1384936087 1740 dbSNP
rs776213579 1740 dbSNP
rs952291807 1741 dbSNP
rs1343625417 1745 dbSNP
rs757798001 1747 dbSNP
rs1447048029 1755 dbSNP
rs1237107381 1759 dbSNP
rs536874477 1763 dbSNP
rs1023764165 1767 dbSNP
rs1012836456 1770 dbSNP
rs1207031772 1774 dbSNP
rs1436664785 1780 dbSNP
rs1247982104 1782 dbSNP
rs1290216460 1782 dbSNP
rs961188482 1783 dbSNP
rs568032043 1792 dbSNP
rs1342633213 1794 dbSNP
rs1290822286 1798 dbSNP
rs1035174942 1802 dbSNP
rs1179181524 1812 dbSNP
rs548242725 1818 dbSNP
rs771055933 1818 dbSNP
rs1361580761 1821 dbSNP
rs1363174233 1822 dbSNP
rs542914846 1822 dbSNP
rs1284654415 1823 dbSNP
rs1441573700 1826 dbSNP
rs1048808691 1829 dbSNP
rs1306547757 1830 dbSNP
rs999641856 1833 dbSNP
rs902512333 1834 dbSNP
rs1043721552 1839 dbSNP
rs946614288 1840 dbSNP
rs1331159314 1841 dbSNP
rs4273 1847 dbSNP
rs1294631823 1849 dbSNP
rs1365156267 1850 dbSNP
rs1049547906 1851 dbSNP
rs1479848482 1852 dbSNP
rs756443666 1853 dbSNP
rs1195643196 1859 dbSNP
rs1249373965 1860 dbSNP
rs1183552744 1862 dbSNP
rs944622391 1867 dbSNP
rs565325391 1868 dbSNP
rs1426931777 1874 dbSNP
rs933810937 1877 dbSNP
rs1367438359 1886 dbSNP
rs911754321 1887 dbSNP
rs1297331736 1888 dbSNP
rs551763820 1891 dbSNP
rs1052952410 1893 dbSNP
rs753005613 1898 dbSNP
rs867244969 1904 dbSNP
rs922500124 1905 dbSNP
rs972881231 1912 dbSNP
rs939765356 1918 dbSNP
rs1469208591 1920 dbSNP
rs909523638 1922 dbSNP
rs74689577 1928 dbSNP
rs1252191824 1929 dbSNP
rs934461743 1934 dbSNP
rs113021382 1936 dbSNP
rs1183741539 1937 dbSNP
rs532226724 1938 dbSNP
rs1183683341 1941 dbSNP
rs1483199514 1946 dbSNP
rs1403147811 1947 dbSNP
rs1169689159 1949 dbSNP
rs1267721595 1949 dbSNP
rs1463366720 1952 dbSNP
rs1219997169 1953 dbSNP
rs1334938402 1955 dbSNP
rs1405699696 1955 dbSNP
rs1453464614 1956 dbSNP
rs17153378 1957 dbSNP
rs1049938 1964 dbSNP
rs991123373 1966 dbSNP
rs1223097353 1969 dbSNP
rs961138771 1969 dbSNP
rs1260864227 1973 dbSNP
rs1348428925 1974 dbSNP
rs1203921665 1976 dbSNP
rs960983958 1978 dbSNP
rs867930867 1983 dbSNP
rs759717440 1984 dbSNP
rs549106163 1988 dbSNP
rs1185833009 1989 dbSNP
rs1035630672 1997 dbSNP
rs999539563 1997 dbSNP
rs1478671331 1998 dbSNP
rs774527003 2000 dbSNP
rs1174080549 2003 dbSNP
rs766419464 2004 dbSNP
rs1470391125 2006 dbSNP
rs1178879328 2014 dbSNP
rs950821990 2016 dbSNP
rs1430164273 2019 dbSNP
rs1027424278 2021 dbSNP
rs1229079612 2024 dbSNP
rs1345177769 2026 dbSNP
rs994575738 2027 dbSNP
rs1346568386 2031 dbSNP
rs900190909 2034 dbSNP
rs1350790798 2037 dbSNP
rs1314587195 2040 dbSNP
rs1214521487 2044 dbSNP
rs1318271340 2046 dbSNP
rs1022216012 2065 dbSNP
rs775834082 2069 dbSNP
rs1010870601 2074 dbSNP
rs1197204703 2081 dbSNP
rs1267855183 2084 dbSNP
rs889828975 2089 dbSNP
rs1399512874 2090 dbSNP
rs1480658571 2099 dbSNP
rs1193102545 2102 dbSNP
rs1400189581 2110 dbSNP
rs1017270009 2125 dbSNP
rs1387732946 2125 dbSNP
rs1160824876 2127 dbSNP
rs1472602625 2129 dbSNP
rs1428174915 2132 dbSNP
rs1196791620 2134 dbSNP
rs1478901373 2145 dbSNP
rs1247121429 2146 dbSNP
rs1366554866 2146 dbSNP
rs1009263779 2149 dbSNP
rs1370809473 2152 dbSNP
rs890387516 2155 dbSNP
rs1050104851 2157 dbSNP
rs543898592 2161 dbSNP
rs578030070 2166 dbSNP
rs1052930390 2167 dbSNP
rs1307011496 2167 dbSNP
rs1220108918 2170 dbSNP
rs998142261 2172 dbSNP
rs900972752 2179 dbSNP
rs1036884575 2180 dbSNP
rs1230968040 2184 dbSNP
rs904338490 2185 dbSNP
rs374851780 2186 dbSNP
rs1469767940 2187 dbSNP
rs1043817075 2188 dbSNP
rs144766633 2188 dbSNP
rs916605608 2189 dbSNP
rs990827151 2192 dbSNP
rs1163485881 2196 dbSNP
rs1209456144 2197 dbSNP
rs939711489 2201 dbSNP
rs369920233 2202 dbSNP
rs1407427543 2205 dbSNP
rs909639651 2206 dbSNP
rs1281649711 2208 dbSNP
rs928240279 2210 dbSNP
rs1440959443 2211 dbSNP
rs1331652301 2212 dbSNP
rs1243203934 2213 dbSNP
rs529883406 2213 dbSNP
rs747851689 2213 dbSNP
rs950889599 2214 dbSNP
rs1027806119 2215 dbSNP
rs763076283 2216 dbSNP
rs1437051039 2217 dbSNP
rs1205453731 2219 dbSNP
rs1240317493 2221 dbSNP
rs1460030456 2222 dbSNP
rs1429052874 2225 dbSNP
rs1017739453 2226 dbSNP
rs1474024981 2227 dbSNP
rs560954292 2232 dbSNP
rs17153373 2235 dbSNP
rs1321737386 2237 dbSNP
rs759333833 2242 dbSNP
rs769705607 2244 dbSNP
rs998714147 2246 dbSNP
rs991469056 2247 dbSNP
rs1335423347 2250 dbSNP
rs961003567 2251 dbSNP
rs1425427563 2256 dbSNP
rs1450083362 2257 dbSNP
rs779212462 2262 dbSNP
rs1474270588 2265 dbSNP
rs928099658 2265 dbSNP
rs904385933 2269 dbSNP
rs1215008121 2272 dbSNP
rs1260227412 2272 dbSNP
rs1321588624 2273 dbSNP
rs1042866964 2275 dbSNP
rs572613516 2280 dbSNP
rs1460943647 2281 dbSNP
rs1243769731 2284 dbSNP
rs1261391767 2284 dbSNP
rs1444228666 2285 dbSNP
rs1191623953 2286 dbSNP
rs1242095281 2287 dbSNP
rs1475938608 2289 dbSNP
rs557773777 2291 dbSNP
rs1427658098 2295 dbSNP
rs558954009 2295 dbSNP
rs1175306551 2296 dbSNP
rs1402259125 2297 dbSNP
rs376889657 2297 dbSNP
rs1212288257 2301 dbSNP
rs946823139 2302 dbSNP
rs1316122013 2305 dbSNP
rs1325856930 2307 dbSNP
rs1313062904 2310 dbSNP
rs1400536081 2312 dbSNP
rs1279790233 2314 dbSNP
rs895238927 2319 dbSNP
rs966732382 2324 dbSNP
rs1022329240 2329 dbSNP
rs1347188443 2337 dbSNP
rs1203529271 2338 dbSNP
rs1055578106 2340 dbSNP
rs939385230 2341 dbSNP
rs1267165169 2342 dbSNP
rs1480338469 2344 dbSNP
rs1452615006 2347 dbSNP
rs927925966 2350 dbSNP
rs1381188556 2352 dbSNP
rs1334200011 2353 dbSNP
rs545425109 2357 dbSNP
rs954166705 2359 dbSNP
rs1359395430 2361 dbSNP
rs929541801 2361 dbSNP
rs1299995147 2367 dbSNP
rs1028337032 2373 dbSNP
rs1169226728 2373 dbSNP
rs1237172244 2377 dbSNP
rs1302227406 2377 dbSNP
rs1404160223 2377 dbSNP
rs534683903 2377 dbSNP
rs1408031368 2379 dbSNP
rs1278986521 2380 dbSNP
rs1354542652 2381 dbSNP
rs1219398060 2382 dbSNP
rs747969265 2390 dbSNP
rs1490285737 2394 dbSNP
rs1269924040 2395 dbSNP
rs1452920656 2397 dbSNP
rs1179254222 2400 dbSNP
rs1168965488 2403 dbSNP
rs901091737 2406 dbSNP
rs1160362183 2410 dbSNP
rs187250333 2414 dbSNP
rs1423763042 2415 dbSNP
rs182166665 2415 dbSNP
rs910322617 2417 dbSNP
rs1004039439 2419 dbSNP
rs536568515 2421 dbSNP
rs1328479385 2427 dbSNP
rs572435550 2429 dbSNP
rs1242474774 2433 dbSNP
rs1313546959 2434 dbSNP
rs888320066 2434 dbSNP
rs1246188236 2437 dbSNP
rs1183726645 2439 dbSNP
rs1479882793 2440 dbSNP
rs1193687794 2443 dbSNP
rs1483583710 2443 dbSNP
rs1048152036 2445 dbSNP
rs1180043126 2450 dbSNP
rs1202639756 2452 dbSNP
rs948478744 2453 dbSNP
rs1165434990 2454 dbSNP
rs1369946102 2457 dbSNP
rs968596493 2459 dbSNP
rs1275851865 2463 dbSNP
rs776517212 2464 dbSNP
rs1401380216 2466 dbSNP
rs567842517 2466 dbSNP
rs1056820465 2467 dbSNP
rs939561047 2470 dbSNP
rs1382159398 2474 dbSNP
rs1397085413 2480 dbSNP
rs1245697850 2487 dbSNP
rs1227233151 2488 dbSNP
rs1306106385 2488 dbSNP
rs928247016 2492 dbSNP
rs1257028987 2495 dbSNP
rs1318091747 2499 dbSNP
rs978348196 2499 dbSNP
rs554109805 2500 dbSNP
rs1482665590 2502 dbSNP
rs915434717 2504 dbSNP
rs1258246979 2505 dbSNP
rs534372777 2510 dbSNP
rs1315372867 2511 dbSNP
rs1192578082 2513 dbSNP
rs565438454 2517 dbSNP
rs1379211990 2519 dbSNP
rs1405406495 2519 dbSNP
rs894275461 2522 dbSNP
rs768452212 2523 dbSNP
rs1055228367 2527 dbSNP
rs1279175105 2530 dbSNP
rs1382161996 2530 dbSNP
rs1004019188 2532 dbSNP
rs1220053952 2536 dbSNP
rs906572321 2536 dbSNP
rs1439633144 2542 dbSNP
rs1210289394 2545 dbSNP
rs1257246467 2546 dbSNP
rs989511204 2547 dbSNP
rs954172972 2548 dbSNP
rs1215830142 2549 dbSNP
rs1263585969 2550 dbSNP
rs1478705729 2552 dbSNP
rs1197513926 2554 dbSNP
rs1424798988 2557 dbSNP
rs1028702129 2558 dbSNP
rs74646772 2560 dbSNP
rs965791534 2563 dbSNP
rs1453625996 2573 dbSNP
rs190065646 2576 dbSNP
rs779731471 2577 dbSNP
rs1366380647 2578 dbSNP
rs888265822 2580 dbSNP
rs1026836060 2581 dbSNP
rs1302695389 2584 dbSNP
rs943565728 2585 dbSNP
rs569584977 2586 dbSNP
rs757899896 2590 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
              | |: |||  ||||||| 
1 - 18
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000354667.4 | 3UTR | AUCUUUUAGAUGCUGCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.638 5.3e-4 -0.460 1.4e-2 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.57 4.3e-3 0.705 2.6e-4 20 Click to see details
GSE17498 Multiple myeloma 0.34 1.6e-2 0.388 6.7e-3 40 Click to see details
GSE38226 Liver fibrosis -0.442 2.2e-2 -0.343 6.4e-2 21 Click to see details
GSE19783 ER+ ER+ breast cancer -0.359 6.0e-2 -0.435 2.8e-2 20 Click to see details
GSE21032 Prostate cancer 0.156 8.0e-2 0.107 1.7e-1 83 Click to see details
GSE32688 Pancreatic cancer -0.22 1.1e-1 0.007 4.8e-1 32 Click to see details
GSE21849 B cell lymphoma -0.186 1.7e-1 0.379 2.1e-2 29 Click to see details
GSE17306 Multiple myeloma -0.135 1.8e-1 -0.149 1.5e-1 49 Click to see details
GSE28544 Breast cancer -0.153 2.4e-1 -0.270 1.0e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.159 2.8e-1 0.141 3.0e-1 16 Click to see details
GSE19350 CNS germ cell tumors 0.184 2.8e-1 -0.133 3.4e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.062 3.1e-1 0.026 4.2e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.072 3.7e-1 0.058 3.9e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.057 4.0e-1 0.065 3.8e-1 24 Click to see details
GSE19783 ER- ER- breast cancer 0.03 4.0e-1 0.052 3.2e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.036 4.3e-1 0.266 9.9e-2 25 Click to see details
GSE14794 Lymphoblastoid cells -0.016 4.4e-1 0.025 4.1e-1 90 Click to see details
GSE19536 Breast cancer -0.013 4.5e-1 -0.003 4.9e-1 100 Click to see details
GSE28260 Renal cortex and medulla -0.008 4.9e-1 -0.011 4.9e-1 13 Click to see details
GSE28260 Renal cortex and medulla -0.008 4.9e-1 -0.011 4.9e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.543 0 0.458 0 32 Click to see details
HNSC 0.375 0.01 0.408 0 42 Click to see details
PRAD 0.272 0.03 0.349 0.01 50 Click to see details
BLCA 0.455 0.03 0.492 0.02 18 Click to see details
PAAD 0.844 0.08 0.200 0.4 4 Click to see details
BRCA -0.127 0.12 -0.104 0.17 84 Click to see details
PCPG -0.915 0.13 -1.000 0.5 3 Click to see details
COAD 0.425 0.15 0.310 0.23 8 Click to see details
KIRC 0.125 0.15 0.144 0.12 68 Click to see details
UCEC -0.216 0.19 -0.079 0.37 19 Click to see details
LUAD 0.28 0.19 0.091 0.39 12 Click to see details
LUSC -0.143 0.2 -0.131 0.22 38 Click to see details
KIRP -0.147 0.21 -0.115 0.27 32 Click to see details
CHOL 0.224 0.28 0.350 0.18 9 Click to see details
THCA 0.065 0.31 0.070 0.3 59 Click to see details
KICH -0.067 0.38 0.121 0.28 25 Click to see details
LIHC 0.039 0.4 0.042 0.39 49 Click to see details
CESC 0.256 0.42 0.500 0.33 3 Click to see details
ESCA 0.046 0.45 0.182 0.3 11 Click to see details
ESCA 0.046 0.45 0.182 0.3 11 Click to see details
ESCA 0.046 0.45 0.182 0.3 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000285 CCND2 cyclin D2 4 7
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 3 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472263 NFIC nuclear factor I C 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505116 YTHDC1 YTH domain containing 1 2 6
MIRT505349 TMEM245 transmembrane protein 245 2 6
MIRT505398 TMEM100 transmembrane protein 100 2 2
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505549 SNX16 sorting nexin 16 2 6
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505930 RCAN3 RCAN family member 3 2 4
MIRT506112 PPIG peptidylprolyl isomerase G 2 6
MIRT506138 PLRG1 pleiotropic regulator 1 2 4
MIRT506166 PLAG1 PLAG1 zinc finger 2 9
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506487 MYO5A myosin VA 2 7
MIRT506854 KIF23 kinesin family member 23 2 7
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507820 CDK1 cyclin dependent kinase 1 2 6
MIRT507853 CCNE2 cyclin E2 2 6
MIRT507877 CBX6 chromobox 6 2 2
MIRT508041 AXIN2 axin 2 2 6
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509368 DMPK DM1 protein kinase 2 11
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511847 GPATCH8 G-patch domain containing 8 2 5
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT514042 ATG14 autophagy related 14 2 2
MIRT518095 TRIM35 tripartite motif containing 35 2 2
MIRT518533 FLCN folliculin 2 6
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521055 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521207 SBNO1 strawberry notch homolog 1 2 6
MIRT521818 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522778 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537815 EFNB2 ephrin B2 2 4
MIRT539902 RPL14 ribosomal protein L14 2 4
MIRT540847 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541217 HOXA10 homeobox A10 2 2
MIRT541432 CBX4 chromobox 4 2 3
MIRT542810 PHC3 polyhomeotic homolog 3 2 3
MIRT542837 PDCD1 programmed cell death 1 2 7
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543310 ZNF585B zinc finger protein 585B 2 2
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543529 PRSS21 protease, serine 21 2 2
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543839 GSG1 germ cell associated 1 2 2
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544916 CLSPN claspin 2 2
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545351 CCDC83 coiled-coil domain containing 83 2 2
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546118 USP48 ubiquitin specific peptidase 48 2 4
MIRT546611 SALL1 spalt like transcription factor 1 2 4
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546640 RTN4 reticulon 4 2 2
MIRT547069 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547406 MKX mohawk homeobox 2 2
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547661 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547702 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT548001 HCFC2 host cell factor C2 2 4
MIRT548018 GRB2 growth factor receptor bound protein 2 2 4
MIRT548219 FKBP1A FK506 binding protein 1A 2 2
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548727 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548946 CDK17 cyclin dependent kinase 17 2 3
MIRT549076 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549123 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549389 AMOT angiomotin 2 2
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550619 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550827 FAM229B family with sequence similarity 229 member B 2 2
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551621 ZNF267 zinc finger protein 267 2 2
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552348 ZNF704 zinc finger protein 704 2 2
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553442 TPM3 tropomyosin 3 2 2
MIRT553565 TMEM161B transmembrane protein 161B 2 2
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553777 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554702 RNF149 ring finger protein 149 2 2
MIRT554965 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555035 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555278 PRDM4 PR/SET domain 4 2 2
MIRT555431 PPAP2B phospholipid phosphatase 3 2 2
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557484 GPR27 G protein-coupled receptor 27 2 4
MIRT558041 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558664 CNKSR3 CNKSR family member 3 2 2
MIRT559006 CA8 carbonic anhydrase 8 2 2
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560855 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561153 KRT33B keratin 33B 2 2
MIRT561404 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562031 LANCL1 LanC like 1 2 2
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562881 KIAA1456 KIAA1456 2 2
MIRT563090 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563507 DLGAP3 DLG associated protein 3 2 2
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564336 CCNT1 cyclin T1 2 2
MIRT564482 ZNF391 zinc finger protein 391 2 2
MIRT564556 CCDC80 coiled-coil domain containing 80 2 2
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564954 XKR7 XK related 7 2 2
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566122 RASEF RAS and EF-hand domain containing 2 2
MIRT566654 NCKAP1 NCK associated protein 1 2 2
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567017 KLHL15 kelch like family member 15 2 2
MIRT567450 GNG12 G protein subunit gamma 12 2 2
MIRT567482 FZD9 frizzled class receptor 9 2 2
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568143 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568477 ARMC12 armadillo repeat containing 12 2 2
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568621 ACVR2A activin A receptor type 2A 2 2
MIRT570464 TLK1 tousled like kinase 1 2 3
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571431 RIF1 replication timing regulatory factor 1 2 2
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571824 PHF19 PHD finger protein 19 5 2
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 2 3
MIRT574062 PROSC pyridoxal phosphate binding protein 2 2
MIRT574207 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574595 N4BP1 NEDD4 binding protein 1 2 3
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575928 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576100 Pdcd1 programmed cell death 1 2 5
MIRT576593 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614697 TRAK1 trafficking kinesin protein 1 2 2
MIRT616471 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640542 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645514 BSPRY B-box and SPRY domain containing 2 2
MIRT646599 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648788 KLHL40 kelch like family member 40 2 2
MIRT655815 NOTCH2 notch 2 2 3
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659260 CUL3 cullin 3 5 2
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682280 RS1 retinoschisin 1 2 2
MIRT682518 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691713 FLOT2 flotillin 2 2 3
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701510 NEGR1 neuronal growth regulator 1 2 2
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713423 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716436 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717465 ADORA3 adenosine A3 receptor 2 2
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725130 SYNRG synergin gamma 2 2
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1