miRTarBase - #MIRT562031 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LANCL1   
Synonyms GPR69A, p40
Description LanC like 1
Transcript NM_001136574   
Other Transcripts NM_001136575 , NM_006055   
Putative miRNA Targets on LANCL1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            ||:|::: | | |||||||| 
1646 - 1668 160.00 -17.00
            | |  ||||| |||||| || 
915 - 936 131.00 -12.44
             :|::||||   ||  | ||||| 
2041 - 2066 123.00 -10.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30094194 4 COSMIC
COSN31507005 15 COSMIC
COSN30170280 41 COSMIC
COSN30134260 42 COSMIC
COSN13967959 53 COSMIC
COSN30656421 56 COSMIC
COSN30488042 70 COSMIC
COSN508979 71 COSMIC
COSN26440419 72 COSMIC
COSN1232741 554 COSMIC
COSN22918157 811 COSMIC
COSN15888809 828 COSMIC
COSN32057407 1001 COSMIC
COSN32064577 1111 COSMIC
COSN32166495 1194 COSMIC
COSN17037532 1252 COSMIC
COSN31517828 1283 COSMIC
COSN31579211 1336 COSMIC
COSN31564950 1360 COSMIC
COSN31483833 1401 COSMIC
COSN15810608 1452 COSMIC
COSN21762697 1463 COSMIC
COSN23420832 1557 COSMIC
COSN28230087 1564 COSMIC
COSN5788114 1622 COSMIC
COSN32099109 1721 COSMIC
COSN6166812 2244 COSMIC
COSN21358617 2523 COSMIC
COSN6935419 2767 COSMIC
COSN26228083 2807 COSMIC
COSN22193006 2879 COSMIC
COSN1821923 2978 COSMIC
COSN19583429 3075 COSMIC
COSN15987076 3234 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755962393 2 dbSNP
rs538036154 3 dbSNP
rs946653350 4 dbSNP
rs758488926 5 dbSNP
rs1256515569 10 dbSNP
rs752899486 15 dbSNP
rs765364851 17 dbSNP
rs905977234 18 dbSNP
rs759578797 28 dbSNP
rs777170230 29 dbSNP
rs575645099 35 dbSNP
rs866694517 36 dbSNP
rs759296980 40 dbSNP
rs548671897 42 dbSNP
rs1389739062 43 dbSNP
rs1173580250 46 dbSNP
rs773392200 46 dbSNP
rs1165361654 64 dbSNP
rs1344482112 69 dbSNP
rs1428587365 71 dbSNP
rs915119206 72 dbSNP
rs1362057253 79 dbSNP
rs11539818 85 dbSNP
rs1413773270 91 dbSNP
rs560424969 93 dbSNP
rs558869624 95 dbSNP
rs112768453 97 dbSNP
rs1315585493 108 dbSNP
rs1218576917 111 dbSNP
rs1242766507 128 dbSNP
rs1191163196 134 dbSNP
rs925604732 140 dbSNP
rs1186044095 142 dbSNP
rs1029724298 144 dbSNP
rs1259929225 155 dbSNP
rs976557691 180 dbSNP
rs1475668918 185 dbSNP
rs964106392 192 dbSNP
rs978472631 193 dbSNP
rs1406981557 195 dbSNP
rs1398820051 207 dbSNP
rs747193323 213 dbSNP
rs1477424265 219 dbSNP
rs1233367874 222 dbSNP
rs149912202 224 dbSNP
rs112024964 241 dbSNP
rs569330907 242 dbSNP
rs921026861 244 dbSNP
rs1007693945 245 dbSNP
rs1310568558 249 dbSNP
rs546684017 253 dbSNP
rs1027945063 262 dbSNP
rs965210451 272 dbSNP
rs753767904 275 dbSNP
rs772025238 279 dbSNP
rs993749791 283 dbSNP
rs897847858 291 dbSNP
rs1371706604 299 dbSNP
rs1015485023 304 dbSNP
rs983102751 308 dbSNP
rs1347219608 309 dbSNP
rs1208752477 313 dbSNP
rs1056852095 321 dbSNP
rs1217499071 327 dbSNP
rs1486081522 328 dbSNP
rs1319652237 329 dbSNP
rs749332390 334 dbSNP
rs905250731 338 dbSNP
rs1028057496 343 dbSNP
rs1367055182 347 dbSNP
rs1178847193 348 dbSNP
rs994861610 348 dbSNP
rs905935324 356 dbSNP
rs1453756024 363 dbSNP
rs1171126067 368 dbSNP
rs780161035 376 dbSNP
rs1414671245 386 dbSNP
rs1327854701 389 dbSNP
rs535919904 390 dbSNP
rs187960501 392 dbSNP
rs1353085213 396 dbSNP
rs550920314 397 dbSNP
rs895982747 399 dbSNP
rs550932446 407 dbSNP
rs1232751496 411 dbSNP
rs1305649552 416 dbSNP
rs1348765479 422 dbSNP
rs1195441260 424 dbSNP
rs1271198044 427 dbSNP
rs750680955 428 dbSNP
rs915068292 433 dbSNP
rs1206307969 435 dbSNP
rs1052341449 440 dbSNP
rs999492539 442 dbSNP
rs1191730444 446 dbSNP
rs781483791 450 dbSNP
rs922306808 458 dbSNP
rs1171422181 464 dbSNP
rs1043084882 472 dbSNP
rs976802312 483 dbSNP
rs932353143 488 dbSNP
rs1413381518 495 dbSNP
rs369127114 501 dbSNP
rs1040824023 504 dbSNP
rs183644864 517 dbSNP
rs551627035 519 dbSNP
rs1331724814 522 dbSNP
rs952231754 526 dbSNP
rs982665460 529 dbSNP
rs139215160 531 dbSNP
rs757507164 532 dbSNP
rs919873610 534 dbSNP
rs1250989571 539 dbSNP
rs1211705852 555 dbSNP
rs1254863792 568 dbSNP
rs993791793 570 dbSNP
rs773442494 573 dbSNP
rs73069766 574 dbSNP
rs764656829 580 dbSNP
rs1022958152 584 dbSNP
rs1003913227 590 dbSNP
rs905293111 592 dbSNP
rs1460245701 594 dbSNP
rs1014292281 599 dbSNP
rs960136002 602 dbSNP
rs1045159930 603 dbSNP
rs1284980359 605 dbSNP
rs1328334643 615 dbSNP
rs1400830356 622 dbSNP
rs1292947686 625 dbSNP
rs532552928 626 dbSNP
rs1225546135 635 dbSNP
rs766056048 636 dbSNP
rs1231169715 639 dbSNP
rs1349131582 642 dbSNP
rs1288296990 646 dbSNP
rs1267021129 649 dbSNP
rs1415762856 649 dbSNP
rs543006177 651 dbSNP
rs146687048 653 dbSNP
rs1448298249 661 dbSNP
rs1357807353 664 dbSNP
rs1310696788 671 dbSNP
rs1256429618 673 dbSNP
rs1474034601 674 dbSNP
rs1446913892 679 dbSNP
rs1043315721 682 dbSNP
rs191449410 684 dbSNP
rs996882128 687 dbSNP
rs899491580 688 dbSNP
rs1312371947 702 dbSNP
rs893669902 705 dbSNP
rs1353749277 713 dbSNP
rs544106523 715 dbSNP
rs1052191856 722 dbSNP
rs1411684029 727 dbSNP
rs1411073809 728 dbSNP
rs908306096 734 dbSNP
rs1165627323 736 dbSNP
rs1355202918 742 dbSNP
rs1476047021 748 dbSNP
rs935281697 752 dbSNP
rs931165457 761 dbSNP
rs1201879604 763 dbSNP
rs1257293872 771 dbSNP
rs922473467 775 dbSNP
rs919805708 780 dbSNP
rs1040724454 787 dbSNP
rs942396595 792 dbSNP
rs143803028 794 dbSNP
rs548429486 794 dbSNP
rs763595577 798 dbSNP
rs1483011653 799 dbSNP
rs992815325 813 dbSNP
rs1390655797 814 dbSNP
rs960082717 818 dbSNP
rs1246173700 822 dbSNP
rs558906453 824 dbSNP
rs1302047330 827 dbSNP
rs538895284 830 dbSNP
rs1363848765 838 dbSNP
rs3770701 838 dbSNP
rs972617025 842 dbSNP
rs552739461 849 dbSNP
rs1234511213 862 dbSNP
rs375089783 870 dbSNP
rs1240413538 873 dbSNP
rs1458563519 884 dbSNP
rs1022244674 889 dbSNP
rs1310951409 890 dbSNP
rs1294841667 897 dbSNP
rs1455671938 900 dbSNP
rs1035645487 918 dbSNP
rs567281214 919 dbSNP
rs1460687430 920 dbSNP
rs1296171699 923 dbSNP
rs969399618 926 dbSNP
rs1290285170 935 dbSNP
rs1447420165 936 dbSNP
rs900113535 936 dbSNP
rs1368121950 941 dbSNP
rs1432235432 947 dbSNP
rs768402457 950 dbSNP
rs1019263080 965 dbSNP
rs1306487424 970 dbSNP
rs1023573575 973 dbSNP
rs1224800648 975 dbSNP
rs373159822 975 dbSNP
rs1260386939 976 dbSNP
rs1319121697 977 dbSNP
rs1213582366 984 dbSNP
rs1007917356 991 dbSNP
rs1326491619 1015 dbSNP
rs113989735 1016 dbSNP
rs1415590429 1022 dbSNP
rs1191804384 1029 dbSNP
rs1044708 1031 dbSNP
rs1173176668 1032 dbSNP
rs1425464457 1032 dbSNP
rs1465988331 1033 dbSNP
rs931091088 1043 dbSNP
rs1392148159 1045 dbSNP
rs893869412 1052 dbSNP
rs1045328711 1053 dbSNP
rs1420467061 1055 dbSNP
rs1188552148 1058 dbSNP
rs1279745217 1062 dbSNP
rs1030837517 1067 dbSNP
rs1341501039 1068 dbSNP
rs999734494 1070 dbSNP
rs947958065 1071 dbSNP
rs1271699714 1080 dbSNP
rs1323959569 1081 dbSNP
rs900999904 1084 dbSNP
rs1041401842 1087 dbSNP
rs1260214456 1091 dbSNP
rs548261567 1105 dbSNP
rs537265608 1107 dbSNP
rs1484957445 1121 dbSNP
rs1196086505 1122 dbSNP
rs1247557131 1124 dbSNP
rs72944765 1128 dbSNP
rs938685995 1135 dbSNP
rs1186873790 1136 dbSNP
rs187172334 1137 dbSNP
rs551663317 1139 dbSNP
rs1048060150 1144 dbSNP
rs766074620 1148 dbSNP
rs918298825 1154 dbSNP
rs972264369 1156 dbSNP
rs940888583 1160 dbSNP
rs760342646 1162 dbSNP
rs982795084 1163 dbSNP
rs1360725095 1167 dbSNP
rs773095967 1168 dbSNP
rs969246721 1173 dbSNP
rs969583416 1174 dbSNP
rs1023611166 1178 dbSNP
rs989401964 1179 dbSNP
rs1021781941 1180 dbSNP
rs975592967 1183 dbSNP
rs1315683001 1186 dbSNP
rs1218832606 1192 dbSNP
rs1286829501 1193 dbSNP
rs1485431986 1199 dbSNP
rs1209064334 1208 dbSNP
rs964267257 1214 dbSNP
rs1019881753 1216 dbSNP
rs559856717 1217 dbSNP
rs1407101101 1224 dbSNP
rs1292918946 1226 dbSNP
rs774812072 1229 dbSNP
rs1356134024 1231 dbSNP
rs1380391285 1231 dbSNP
rs1170705868 1233 dbSNP
rs1031539737 1236 dbSNP
rs1007865237 1237 dbSNP
rs367849671 1240 dbSNP
rs1389785521 1252 dbSNP
rs1449145405 1256 dbSNP
rs901026836 1267 dbSNP
rs566355192 1270 dbSNP
rs576823157 1274 dbSNP
rs1242964808 1277 dbSNP
rs1310055669 1280 dbSNP
rs1455655069 1287 dbSNP
rs886771451 1289 dbSNP
rs1039013414 1297 dbSNP
rs1443239559 1302 dbSNP
rs1019432943 1317 dbSNP
rs995251525 1345 dbSNP
rs1044845857 1346 dbSNP
rs1232098815 1346 dbSNP
rs898266230 1346 dbSNP
rs866856424 1347 dbSNP
rs1453320331 1352 dbSNP
rs1006823282 1355 dbSNP
rs1170320025 1358 dbSNP
rs889681464 1367 dbSNP
rs1048092659 1372 dbSNP
rs930930309 1376 dbSNP
rs1398629685 1382 dbSNP
rs896809482 1384 dbSNP
rs1332681233 1389 dbSNP
rs183437865 1390 dbSNP
rs1434341034 1393 dbSNP
rs1209810206 1397 dbSNP
rs1276724366 1403 dbSNP
rs1345898326 1404 dbSNP
rs935278995 1407 dbSNP
rs1481162016 1415 dbSNP
rs745859815 1420 dbSNP
rs924632721 1421 dbSNP
rs977848639 1422 dbSNP
rs938426016 1443 dbSNP
rs748145881 1444 dbSNP
rs191527293 1457 dbSNP
rs543864790 1459 dbSNP
rs1247958986 1461 dbSNP
rs780687069 1462 dbSNP
rs530734285 1464 dbSNP
rs1185637723 1469 dbSNP
rs982279624 1472 dbSNP
rs1421892772 1483 dbSNP
rs1467560081 1487 dbSNP
rs948310619 1491 dbSNP
rs775545408 1495 dbSNP
rs975540729 1507 dbSNP
rs565025003 1508 dbSNP
rs1331810815 1509 dbSNP
rs1430275082 1515 dbSNP
rs1276590109 1527 dbSNP
rs1342634001 1530 dbSNP
rs73069762 1552 dbSNP
rs559275524 1561 dbSNP
rs1235823034 1564 dbSNP
rs1328891307 1566 dbSNP
rs1300502360 1572 dbSNP
rs1391957271 1573 dbSNP
rs1192001414 1575 dbSNP
rs987049687 1576 dbSNP
rs769801622 1580 dbSNP
rs1025298388 1583 dbSNP
rs1370132948 1584 dbSNP
rs1030986232 1585 dbSNP
rs1391507487 1587 dbSNP
rs1400140496 1588 dbSNP
rs1296453935 1607 dbSNP
rs978613393 1609 dbSNP
rs745974420 1610 dbSNP
rs781224500 1611 dbSNP
rs962465926 1614 dbSNP
rs1420140099 1618 dbSNP
rs1023341530 1621 dbSNP
rs756733230 1640 dbSNP
rs965466047 1647 dbSNP
rs1180410229 1649 dbSNP
rs1356997673 1655 dbSNP
rs896314555 1661 dbSNP
rs1215215420 1665 dbSNP
rs1056265817 1666 dbSNP
rs1489036014 1668 dbSNP
rs999430926 1670 dbSNP
rs140109512 1680 dbSNP
rs1006687596 1683 dbSNP
rs953949998 1686 dbSNP
rs1441089498 1687 dbSNP
rs541802570 1698 dbSNP
rs995419717 1702 dbSNP
rs896836551 1710 dbSNP
rs1470076914 1715 dbSNP
rs546485695 1716 dbSNP
rs542284349 1726 dbSNP
rs1420530711 1729 dbSNP
rs1003054817 1730 dbSNP
rs906912537 1732 dbSNP
rs1408964860 1740 dbSNP
rs1039804441 1743 dbSNP
rs1046557384 1761 dbSNP
rs747306190 1778 dbSNP
rs1398066547 1780 dbSNP
rs912719143 1787 dbSNP
rs1239358521 1790 dbSNP
rs188540725 1797 dbSNP
rs986998045 1798 dbSNP
rs759078924 1799 dbSNP
rs1454394987 1804 dbSNP
rs1255102423 1806 dbSNP
rs948258675 1811 dbSNP
rs1202473002 1816 dbSNP
rs1257320074 1820 dbSNP
rs1457700210 1821 dbSNP
rs1177385252 1832 dbSNP
rs1157640472 1834 dbSNP
rs1472466842 1837 dbSNP
rs916746519 1838 dbSNP
rs556792355 1841 dbSNP
rs936913254 1844 dbSNP
rs536704319 1845 dbSNP
rs1044710 1856 dbSNP
rs978097673 1857 dbSNP
rs965850926 1860 dbSNP
rs1255087930 1861 dbSNP
rs1023290603 1865 dbSNP
rs912616367 1879 dbSNP
rs985535893 1885 dbSNP
rs1486588759 1898 dbSNP
rs1266128451 1902 dbSNP
rs774168069 1916 dbSNP
rs1335221965 1921 dbSNP
rs1446819307 1924 dbSNP
rs1310016144 1927 dbSNP
rs953899816 1930 dbSNP
rs1256949711 1931 dbSNP
rs1294836467 1934 dbSNP
rs1317730255 1935 dbSNP
rs1026802556 1936 dbSNP
rs1242345559 1937 dbSNP
rs1044044036 1947 dbSNP
rs1010859706 1953 dbSNP
rs995452418 1955 dbSNP
rs961289553 1961 dbSNP
rs893140814 1962 dbSNP
rs1039752203 1965 dbSNP
rs1382819500 1966 dbSNP
rs1464952788 1975 dbSNP
rs1168301903 1981 dbSNP
rs1402285016 1986 dbSNP
rs1015677665 1993 dbSNP
rs758968944 1999 dbSNP
rs1466087502 2006 dbSNP
rs1002509162 2008 dbSNP
rs763806265 2020 dbSNP
rs906854806 2023 dbSNP
rs942750858 2027 dbSNP
rs1364959369 2031 dbSNP
rs1391010900 2033 dbSNP
rs912666544 2034 dbSNP
rs73069760 2046 dbSNP
rs1457127278 2060 dbSNP
rs1419221183 2061 dbSNP
rs1165325654 2064 dbSNP
rs765851983 2066 dbSNP
rs1221559754 2072 dbSNP
rs1263758549 2074 dbSNP
rs534875701 2079 dbSNP
rs1012600219 2081 dbSNP
rs566273782 2084 dbSNP
rs1367505968 2099 dbSNP
rs918810508 2105 dbSNP
rs758173147 2110 dbSNP
rs895345548 2110 dbSNP
rs974721222 2113 dbSNP
rs1465855959 2115 dbSNP
rs1347584401 2124 dbSNP
rs1053850794 2126 dbSNP
rs1293635681 2130 dbSNP
rs1245729845 2132 dbSNP
rs936935261 2133 dbSNP
rs1280480072 2138 dbSNP
rs150703831 2144 dbSNP
rs1042792510 2146 dbSNP
rs1228221256 2149 dbSNP
rs116260268 2153 dbSNP
rs1034734645 2158 dbSNP
rs1275006711 2169 dbSNP
rs977917976 2170 dbSNP
rs562735723 2174 dbSNP
rs1022169297 2181 dbSNP
rs912566434 2182 dbSNP
rs1270705775 2183 dbSNP
rs900450541 2186 dbSNP
rs1018257763 2191 dbSNP
rs370728343 2191 dbSNP
rs985567030 2194 dbSNP
rs142008319 2204 dbSNP
rs954098725 2218 dbSNP
rs550301378 2219 dbSNP
rs1006916791 2221 dbSNP
rs1367642579 2224 dbSNP
rs1295416446 2226 dbSNP
rs973862656 2237 dbSNP
rs1301492680 2247 dbSNP
rs148516018 2258 dbSNP
rs1015544597 2260 dbSNP
rs1051625093 2265 dbSNP
rs114963239 2270 dbSNP
rs1242555203 2289 dbSNP
rs1286944248 2301 dbSNP
rs1311856077 2303 dbSNP
rs1209078913 2304 dbSNP
rs144671499 2305 dbSNP
rs142960849 2306 dbSNP
rs1012631216 2313 dbSNP
rs892861788 2315 dbSNP
rs1032478244 2320 dbSNP
rs1001009266 2329 dbSNP
rs1387942314 2343 dbSNP
rs1187339578 2344 dbSNP
rs902675332 2346 dbSNP
rs11683553 2358 dbSNP
rs1042686002 2385 dbSNP
rs1174378541 2387 dbSNP
rs1361328939 2388 dbSNP
rs944270596 2397 dbSNP
rs1038557971 2399 dbSNP
rs1331316727 2400 dbSNP
rs558891865 2403 dbSNP
rs1248356246 2407 dbSNP
rs916844553 2410 dbSNP
rs1310082746 2414 dbSNP
rs754311666 2415 dbSNP
rs990406773 2415 dbSNP
rs1217751298 2427 dbSNP
rs1196757058 2428 dbSNP
rs1313782058 2431 dbSNP
rs1204201276 2433 dbSNP
rs1257291649 2449 dbSNP
rs1456411609 2450 dbSNP
rs939027738 2454 dbSNP
rs927684856 2462 dbSNP
rs1049728865 2465 dbSNP
rs1477487956 2472 dbSNP
rs1450806872 2476 dbSNP
rs766430656 2488 dbSNP
rs1189134721 2490 dbSNP
rs544334204 2495 dbSNP
rs1427668032 2496 dbSNP
rs932741634 2499 dbSNP
rs978241093 2500 dbSNP
rs1273377562 2501 dbSNP
rs1170450642 2503 dbSNP
rs966509010 2507 dbSNP
rs1344543041 2511 dbSNP
rs760421175 2518 dbSNP
rs1022534198 2519 dbSNP
rs760703117 2527 dbSNP
rs1434544250 2529 dbSNP
rs974554329 2530 dbSNP
rs1276882453 2533 dbSNP
rs772982077 2536 dbSNP
rs1346415230 2538 dbSNP
rs559407030 2538 dbSNP
rs1277338336 2539 dbSNP
rs981409434 2545 dbSNP
rs1200523166 2546 dbSNP
rs773323824 2547 dbSNP
rs767371687 2548 dbSNP
rs1450586036 2552 dbSNP
rs1022602990 2562 dbSNP
rs1227737985 2569 dbSNP
rs1248053829 2575 dbSNP
rs370613451 2575 dbSNP
rs991073739 2578 dbSNP
rs957129438 2579 dbSNP
rs542870783 2583 dbSNP
rs1193323481 2585 dbSNP
rs573561713 2589 dbSNP
rs1479087896 2590 dbSNP
rs1169039739 2595 dbSNP
rs1435017844 2609 dbSNP
rs1390080551 2610 dbSNP
rs183487437 2613 dbSNP
rs902705591 2616 dbSNP
rs1366359938 2628 dbSNP
rs1021528740 2633 dbSNP
rs1399646685 2634 dbSNP
rs1297344758 2638 dbSNP
rs1338192727 2640 dbSNP
rs1329882809 2647 dbSNP
rs1008493834 2648 dbSNP
rs891361402 2655 dbSNP
rs1432050846 2657 dbSNP
rs543007328 2662 dbSNP
rs1049765286 2663 dbSNP
rs367916386 2664 dbSNP
rs75616845 2665 dbSNP
rs994642306 2666 dbSNP
rs1434795608 2668 dbSNP
rs897267935 2680 dbSNP
rs772262778 2681 dbSNP
rs1038916324 2683 dbSNP
rs139162248 2688 dbSNP
rs1170312197 2695 dbSNP
rs745898440 2700 dbSNP
rs898495416 2701 dbSNP
rs1038475720 2702 dbSNP
rs534910314 2714 dbSNP
rs1165021694 2727 dbSNP
rs566230059 2737 dbSNP
rs1386005664 2741 dbSNP
rs1419293523 2744 dbSNP
rs1157131185 2746 dbSNP
rs190727890 2748 dbSNP
rs908382594 2774 dbSNP
rs116466209 2775 dbSNP
rs949971527 2777 dbSNP
rs1339745036 2791 dbSNP
rs927600458 2795 dbSNP
rs977812027 2797 dbSNP
rs770279343 2801 dbSNP
rs771036917 2804 dbSNP
rs11539819 2808 dbSNP
rs945089316 2808 dbSNP
rs915013842 2811 dbSNP
rs747322263 2814 dbSNP
rs1352436803 2824 dbSNP
rs1312831264 2827 dbSNP
rs1280752963 2834 dbSNP
rs1217550642 2836 dbSNP
rs915797924 2844 dbSNP
rs991360021 2851 dbSNP
rs910423497 2874 dbSNP
rs1243796318 2880 dbSNP
rs534035939 2885 dbSNP
rs778145387 2886 dbSNP
rs925593060 2888 dbSNP
rs1030064860 2918 dbSNP
rs1158916196 2935 dbSNP
rs977228879 2938 dbSNP
rs573165190 2939 dbSNP
rs967504293 2945 dbSNP
rs1349089775 2947 dbSNP
rs1307012966 2949 dbSNP
rs1414959573 2950 dbSNP
rs994195059 2964 dbSNP
rs1445350282 2965 dbSNP
rs758775936 2966 dbSNP
rs7893 2972 dbSNP
rs186260631 2974 dbSNP
rs1413435901 2977 dbSNP
rs12819 2978 dbSNP
rs1028618982 2980 dbSNP
rs1055242557 2995 dbSNP
rs997081676 3004 dbSNP
rs1205988439 3017 dbSNP
rs1264252682 3022 dbSNP
rs76305970 3023 dbSNP
rs1038746349 3024 dbSNP
rs557032988 3043 dbSNP
rs1419890074 3045 dbSNP
rs1198470917 3052 dbSNP
rs1376834701 3054 dbSNP
rs887150331 3059 dbSNP
rs180823768 3063 dbSNP
rs949924137 3070 dbSNP
rs765975617 3073 dbSNP
rs1406643428 3075 dbSNP
rs915744216 3076 dbSNP
rs142809682 3078 dbSNP
rs1328677049 3084 dbSNP
rs15138 3085 dbSNP
rs1188404417 3094 dbSNP
rs935909705 3108 dbSNP
rs1300102178 3110 dbSNP
rs755720833 3111 dbSNP
rs1483662492 3117 dbSNP
rs34613213 3122 dbSNP
rs945062750 3132 dbSNP
rs914943013 3133 dbSNP
rs1053527922 3139 dbSNP
rs977469209 3144 dbSNP
rs189870405 3146 dbSNP
rs910370636 3148 dbSNP
rs1253118516 3154 dbSNP
rs1481027644 3160 dbSNP
rs112368478 3162 dbSNP
rs911597336 3169 dbSNP
rs1441964777 3170 dbSNP
rs1269316994 3173 dbSNP
rs1209343241 3180 dbSNP
rs1265488242 3181 dbSNP
rs533031618 3183 dbSNP
rs987332611 3184 dbSNP
rs767173712 3186 dbSNP
rs1201243125 3188 dbSNP
rs954759666 3216 dbSNP
rs1477454795 3226 dbSNP
rs1168499086 3233 dbSNP
rs1374743269 3234 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guguuugguaauacaCGACGAu 5'
Target 5' ---uauacuccuuugGCUGCUa 3'
1 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000443314.1 | 3UTR | UAUACUCCUUUGGCUGCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000443314.1 | 3UTR | UAUACUCCUUUGGCUGCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.564 2.5e-3 -0.532 4.5e-3 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.532 7.9e-3 0.692 3.6e-4 20 Click to see details
GSE19536 Breast cancer 0.24 8.1e-3 0.282 2.2e-3 100 Click to see details
GSE14794 Lymphoblastoid cells -0.25 8.7e-3 -0.154 7.4e-2 90 Click to see details
GSE21849 B cell lymphoma 0.342 3.5e-2 0.433 9.5e-3 29 Click to see details
GSE32688 Pancreatic cancer -0.319 3.8e-2 -0.350 2.5e-2 32 Click to see details
GSE19783 ER- ER- breast cancer 0.194 4.3e-2 0.254 1.2e-2 79 Click to see details
GSE21032 Prostate cancer 0.188 4.4e-2 0.108 1.7e-1 83 Click to see details
GSE28260 Renal cortex and medulla -0.409 8.3e-2 -0.280 1.8e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.295 1.8e-1 -0.014 4.8e-1 12 Click to see details
GSE27834 Pluripotent stem cells 0.178 2.5e-1 0.126 3.2e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.128 3.0e-1 0.009 4.8e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.064 3.1e-1 0.134 1.5e-1 64 Click to see details
GSE28544 Breast cancer 0.081 3.5e-1 0.507 5.7e-3 24 Click to see details
GSE17306 Multiple myeloma 0.052 3.6e-1 -0.079 2.9e-1 49 Click to see details
GSE17498 Multiple myeloma 0.038 4.1e-1 -0.054 3.7e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.036 4.3e-1 -0.078 3.6e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.028 4.5e-1 0.107 3.1e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.026 4.5e-1 -0.161 2.3e-1 24 Click to see details
GSE38226 Liver fibrosis -0.003 4.9e-1 0.023 4.6e-1 21 Click to see details
GSE38226 Liver fibrosis -0.003 4.9e-1 0.023 4.6e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.324 0.01 -0.378 0 49 Click to see details
STAD -0.382 0.02 -0.458 0 32 Click to see details
KIRC -0.248 0.02 -0.212 0.04 68 Click to see details
BLCA -0.42 0.04 -0.474 0.02 18 Click to see details
PAAD 0.874 0.06 0.800 0.1 4 Click to see details
THCA -0.186 0.08 -0.245 0.03 59 Click to see details
KIRP -0.189 0.15 -0.211 0.12 32 Click to see details
KICH -0.188 0.18 -0.094 0.33 25 Click to see details
CESC 0.629 0.28 0.500 0.33 3 Click to see details
COAD -0.206 0.31 -0.595 0.06 8 Click to see details
ESCA -0.153 0.33 -0.291 0.19 11 Click to see details
LUAD -0.124 0.35 -0.329 0.15 12 Click to see details
UCEC -0.09 0.36 -0.130 0.3 19 Click to see details
PCPG -0.297 0.4 -0.500 0.33 3 Click to see details
BRCA 0.016 0.44 -0.022 0.42 84 Click to see details
LUSC -0.018 0.46 0.052 0.38 38 Click to see details
HNSC 0.013 0.47 -0.095 0.27 42 Click to see details
PRAD -0.007 0.48 -0.035 0.4 50 Click to see details
CHOL -0.014 0.49 -0.017 0.48 9 Click to see details
CHOL -0.014 0.49 -0.017 0.48 9 Click to see details
CHOL -0.014 0.49 -0.017 0.48 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000285 CCND2 cyclin D2 4 7
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 3 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472263 NFIC nuclear factor I C 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505116 YTHDC1 YTH domain containing 1 2 6
MIRT505349 TMEM245 transmembrane protein 245 2 6
MIRT505398 TMEM100 transmembrane protein 100 2 2
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505549 SNX16 sorting nexin 16 2 6
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505930 RCAN3 RCAN family member 3 2 4
MIRT506112 PPIG peptidylprolyl isomerase G 2 6
MIRT506138 PLRG1 pleiotropic regulator 1 2 4
MIRT506166 PLAG1 PLAG1 zinc finger 2 9
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506487 MYO5A myosin VA 2 7
MIRT506854 KIF23 kinesin family member 23 2 7
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507820 CDK1 cyclin dependent kinase 1 2 6
MIRT507853 CCNE2 cyclin E2 2 6
MIRT507877 CBX6 chromobox 6 2 2
MIRT508041 AXIN2 axin 2 2 6
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509368 DMPK DM1 protein kinase 2 11
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511847 GPATCH8 G-patch domain containing 8 2 5
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT514042 ATG14 autophagy related 14 2 2
MIRT518095 TRIM35 tripartite motif containing 35 2 2
MIRT518533 FLCN folliculin 2 6
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521055 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521207 SBNO1 strawberry notch homolog 1 2 6
MIRT521818 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522778 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537815 EFNB2 ephrin B2 2 4
MIRT539902 RPL14 ribosomal protein L14 2 4
MIRT540847 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541217 HOXA10 homeobox A10 2 2
MIRT541432 CBX4 chromobox 4 2 3
MIRT542810 PHC3 polyhomeotic homolog 3 2 3
MIRT542837 PDCD1 programmed cell death 1 2 7
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543310 ZNF585B zinc finger protein 585B 2 2
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543529 PRSS21 protease, serine 21 2 2
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543839 GSG1 germ cell associated 1 2 2
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544916 CLSPN claspin 2 2
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545351 CCDC83 coiled-coil domain containing 83 2 2
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546118 USP48 ubiquitin specific peptidase 48 2 4
MIRT546611 SALL1 spalt like transcription factor 1 2 4
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546640 RTN4 reticulon 4 2 2
MIRT547069 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547406 MKX mohawk homeobox 2 2
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547661 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547702 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT548001 HCFC2 host cell factor C2 2 4
MIRT548018 GRB2 growth factor receptor bound protein 2 2 4
MIRT548219 FKBP1A FK506 binding protein 1A 2 2
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548727 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548946 CDK17 cyclin dependent kinase 17 2 3
MIRT549076 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549123 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549389 AMOT angiomotin 2 2
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550619 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550827 FAM229B family with sequence similarity 229 member B 2 2
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551621 ZNF267 zinc finger protein 267 2 2
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552348 ZNF704 zinc finger protein 704 2 2
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553442 TPM3 tropomyosin 3 2 2
MIRT553565 TMEM161B transmembrane protein 161B 2 2
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553777 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554702 RNF149 ring finger protein 149 2 2
MIRT554965 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555035 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555278 PRDM4 PR/SET domain 4 2 2
MIRT555431 PPAP2B phospholipid phosphatase 3 2 2
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557484 GPR27 G protein-coupled receptor 27 2 4
MIRT558041 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558664 CNKSR3 CNKSR family member 3 2 2
MIRT559006 CA8 carbonic anhydrase 8 2 2
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560855 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561153 KRT33B keratin 33B 2 2
MIRT561404 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562031 LANCL1 LanC like 1 2 2
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562881 KIAA1456 KIAA1456 2 2
MIRT563090 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563507 DLGAP3 DLG associated protein 3 2 2
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564336 CCNT1 cyclin T1 2 2
MIRT564482 ZNF391 zinc finger protein 391 2 2
MIRT564556 CCDC80 coiled-coil domain containing 80 2 2
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564954 XKR7 XK related 7 2 2
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566122 RASEF RAS and EF-hand domain containing 2 2
MIRT566654 NCKAP1 NCK associated protein 1 2 2
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567017 KLHL15 kelch like family member 15 2 2
MIRT567450 GNG12 G protein subunit gamma 12 2 2
MIRT567482 FZD9 frizzled class receptor 9 2 2
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568143 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568477 ARMC12 armadillo repeat containing 12 2 2
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568621 ACVR2A activin A receptor type 2A 2 2
MIRT570464 TLK1 tousled like kinase 1 2 3
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571431 RIF1 replication timing regulatory factor 1 2 2
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571824 PHF19 PHD finger protein 19 5 2
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 2 3
MIRT574062 PROSC pyridoxal phosphate binding protein 2 2
MIRT574207 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574595 N4BP1 NEDD4 binding protein 1 2 3
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575928 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576100 Pdcd1 programmed cell death 1 2 5
MIRT576593 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614697 TRAK1 trafficking kinesin protein 1 2 2
MIRT616471 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640542 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645514 BSPRY B-box and SPRY domain containing 2 2
MIRT646599 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648788 KLHL40 kelch like family member 40 2 2
MIRT655815 NOTCH2 notch 2 2 3
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659260 CUL3 cullin 3 5 2
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682280 RS1 retinoschisin 1 2 2
MIRT682518 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691713 FLOT2 flotillin 2 2 3
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701510 NEGR1 neuronal growth regulator 1 2 2
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713423 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716436 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717465 ADORA3 adenosine A3 receptor 2 2
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725130 SYNRG synergin gamma 2 2
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
MIRT735131 GSDMB gasdermin B 2 0
MIRT736201 DRD1 dopamine receptor D1 3 0
Error report submission
Your e-Mail*