miRTarBase - #MIRT559006 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CA8   
Synonyms CA-RP, CA-VIII, CALS, CAMRQ3, CARP
Description carbonic anhydrase 8
Transcript NM_004056   
Expression
Putative miRNA Targets on CA8
3'UTR of CA8
(miRNA target sites are highlighted)
>CA8|NM_004056|3'UTR
   1 CCAAAGAGGACAGGAACAAGTCTGTCTTCATGAGGGAGGAAGACAATGGTCCTATAATGCCCTTGGATAAGAAAAGGAAA
  81 CTTTTGAGCTGCACCTTCAGTTTATCCTCAAAGCCTGCGTTGTTTGTCTTCATCTAATCCAGCTTTGATGGACATCTGTG
 161 ATGGTTGCCTGTACACTTGCTGAAATGAAATATTAGAAATGGCTGTATATTCCAAAGAAACCCTATATTATATATCCACA
 241 TTACTGCTGCTAGGATTCATAGTTGCACATACTGTTTATTGCTTATGTGTAGAAGGAATGAAACTAGTTTCCAGAGTTGT
 321 TATTAATATGAATATATATCATGTGTTAATATTGAGAAAGGAAAAATACATTCCCGGTGTTAGTAGTTCTTCATTTCCTG
 401 TCTCCAACAGAAAATTCACTCATTTTAGAACTAGTGTAATTCTTGATAATAAAATAAGAGTTTTGATTAAGAACAGCATA
 481 GAGCTTCAAAATGCAAAGTGAATGATTAGTAAAATTATGTCTCATTTTATTTTTTCAGCACCCATACCACAATTAATATT
 561 AGGCTGGATTGCCATGGGAAACATTTTTTGGCATTAATGCAGCAACATAATACTCACTTTAGGTATTACTACATAGTTGA
 641 AGGATTTAACTGAATGTATGGATCAAATTTATTTATTTGACATATTCGAAGCTGTGGTTTAATAGGAATTTGAGAAAGGT
 721 GTAAGAAATAGGATAAAAAGAAGGTCAGCACCATGTACCAGGAATAGCTTTACTTTCCATACATAGAAATATAAATTTAG
 801 TGGTATCCTATATTACTTTAGTGTCGTACGCTTTGTAAGACTTAAATATTTTATTCTATTGATTCCACTACTTTGGTATG
 881 TTAAGACATTTCTTTAAAGATGACCAACAATATCCTTATTTTAGGTGCCACTAGCAGATGTAAGCGTATACTTAGTTGCC
 961 GTTAGATGTGACAGAATGAGATAATTTATGTAAAGCAGTAGAGTACCTGGCACAAAGCAAACAATAAATATTATTGTTAT
1041 TGTTGTTATAATTGTAAAATGAATGACTTCAAAAACATAGTCCCAGTTTGGAGGGATTTTGTGATGCAGAATATCTAAGT
1121 CATAGAAATAGAAGACAGGTGGAATAAGTATATGTTCAGAGTTTTTAGATGTGTTGAGTAGAGACGGTAATAATGGAAGC
1201 ATTAAATACAAATGAAAATCACACCAGATATCCCTGAAATTCAAGCAAAGAAAGTTCATCATGTATTCTTGGGCAGCAAG
1281 AGAAAGGACTAGGGTTATGGCAATGTGTGGAAAAGTTGAGGCTTGCTAAGGGTTGAGATCTGTTGGTAGCCCTGGATCAC
1361 ATGGGGTCAGCACCAGGCAGTGCCTCTGAAAGCGGAGAGAGGTCCTGGACTTCCCTTGTGTATAACAGTTCCTAGTGTCC
1441 AACAATGAGGAAACGGTGAAGCATGGTTACAAAACTGTGACAAAAATATTTACATCTAGCACTGTTACCACTCACATGCC
1521 AAACATTGGCTGCACACGTGCAGCCTTATTTGTAATTAACATCAAAAGACTAGATCTGAAGCCTTCCATAAATGAGAGGC
1601 CATTCATATGGCATTCCTGGAACAAAACACTGCACAGGTACCAGCCTCTCCACTCCTGACCGGGTTGGTGCTGAACAGTC
1681 AGGGATTGTTCTTGAACTAGACTTCTGATGCTTCTTGCAATCTTCTTTCATCTTTCCCTGAAATACACAAAATAAACAAA
1761 TACAATAACAAATAGTAATTAAATGACTTTCAGGATAACATCTAGTTGTTCAGACTTCACCCTTCACAGGTGTGTGTGTA
1841 TGTGTGTTTATGTCTGTATATTGAAGCAATTTGAATTTATTTACTGTATATTTTCTGAGTAAAAGACTGAAATGAACTAC
1921 TTGGTTCAGATCATGGTGTCCATTGGTGACATTGTTTGGAGGCATAATATTCTTTATATGGAAAATCCTTTAATTCCACA
2001 GTTAGTTACCTCAGATTCAGAATATGAATACTGTTTATAATACGCTTTTGTAGGAATGAATTTGAAAGGTAGTTTGTCAG
2081 TAAACGAAAGCACAACAACTAATCTCAAATCTGTTTTGATGGTGTGATAGGAAAGAAAGTAAAACCTATGTGATGGACCC
2161 TGTAATTGGGGCAGGAATCTCCCAAAGAAAAAGGGGAGAATTAATGACAAATGTCATAGATCTTGAAATTTAATTTAGGG
2241 TGCATTTTGTTTATGAAACAATTTAATAAGGCAACAAAGTGAAATGATTTTTCATGTAGCTTATACACATGTAAGTGCCT
2321 CTGATTCATGGTAACTAACGTACCTGATGGTGTGTAAAGTAATACTGTTGTCAGAAGGTTTGCCAATTAAGATAATTTGA
2401 GTTTACTCTTTTTTTGTTGGTTAGTTTAGCTGAAGGCTTGTCAATTTTATTGATTTTTTTCAAGGAGCCAAAGTGGATTT
2481 TGGGGTTTTCTCTATTGTGTTTGTATTCTCTATGTCATCAAACTCTGCTCAAATCTTACAAAATAGTAAGATTAGTAAGA
2561 AAGCAGACTAACTTCTGCTTGCTTTGTATTTAGTTTGTGTCTTTTCCAGTATTTTAAGGTGGAAGGTTAGGTTATTGATT
2641 TGAATTCTTTTTTGAATAAAGGCATTAACAGTTATAAATTTTCCTCTGAGCATTGCTTTAGCTGCATCCAATAAGTTTTG
2721 GTATGCCATGTTTTTGTTTTCATTCATCTCAAGGTATTAGAAAATACTTTGCCTTTTAATTTCTTTTTGATGCAATGGTT
2801 ATTTAGGAGTACATTGTTTAATTTCCACATATTTATGAATTCCCAAATTTGTTATTGATTTATAATTTTTTTCTGTTGTG
2881 ATCAGAAAACATACTTTATATGATCTCAGTCTTAAATTTATCGAGGTTTGCTTTCTGGCTTAGCATATGGTTTATCCTGC
2961 AGAATAATCCATGTGTACTTAAGAGTATGTATTGTACTGTTGTTGGATGCTGTGTTCTATAGATAGATGGCTGTTAGGTC
3041 TATAGTGTTGGCCTGTTGTGTTGTTCAAGTCTTCTATTTCCTTGTTGATATGCCTATTTCTGTCTATTATGAAAGTAGTG
3121 TATTGAATTCTCTGACTGTTGTTGAATAATCTCTTCCTTCAATTCTGTCAGTTTTTTTCTACATTCATTTTGGGACTTTT
3201 GTCCTTCTTTATCTCTAGTAACATTTTTTTATTTTAATATATACTTTGTCAGATATTAATATAGCTGCCCCAGCTTTCTT
3281 ATAGTTGCTATTTGTATGATGTATCTTTTTTCATCTTTTCACTTTCAACTTATTTATATTTTTGAATCTAAAGTGTGTCT
3361 CCAACTTATAGTTGGATCTTGTTTTTTTTTGAAATCCAGTCTGACAGTCTCTCTGCCTTTTGGTTGGATTATTTAACCCA
3441 TTTGCACTTAATGTTATTGTTTATATAGTTGGATTTGTGTCTGCCATTTTACTTTTTGTTTTCCACATGTCTTGTATCTT
3521 TTTGTTGTTGTTCCTTTATTCCTCCTCTATTACTTTTTTTTTAATTAGGTGAATATTTTCTAGTATATTTCAATTGCTTT
3601 AATTATTTTTTTCATTTTTTTGAGTATATTTTCACAGTGGTTGCTAAAGGGCATATCATATACTTGTTAATTTATCAGAA
3681 TCTATTTCAGATTTATAATAACTTTATTACAGTGAGTTATTTAGTTACTACTAAATAGCTCTGAACTCTCTTCTCCCTTT
3761 TTGTGCTATTATTGTTATACATATTACATCTATACATGCTGTAAGCCCAACAATACATTGTTATATTTTTCCTGTAATTG
3841 TATGTATATTAAGCAAGCAGAGACTTGAGAACAAATTATATTTATAGAGTTTCTTCTAGTAAGCTTTTAATTTACCATTT
3921 CTGGTTATGTTCATTTTGTCTTGTAAATTTGAGTCACCATCTGGTGTGATTTCTTACTCCAGTACTACTTTGTTCTTATT
4001 TACCTCCTTTGTGTTGTCATTGTCAAATATGTCACATTTGTATATGTTCTGGGTCTAAAGCATAATTACATGATATTTTA
4081 TACAATTGCTCTTTAAGAGAAGGAAGAAATGCATTTATACTGTCTTTCATAATTACATAATTACATTTACCAGTGCCCTT
4161 TTTTTTTTGGAATGGATTCAAATTAGTATCTGGGGTCACTTCATTCCAGGCAGAAGTCCTTTTTTTAATATATTTTTATA
4241 TAAGGCAAATCTGATAGGGACAAATCTTTAGTTTTTGTTTATATGGGCTATCTTTATTTTACCTTCTTTGAGATAGTTTT
4321 GCTAAATATAAAACTCCTGGTGAAAAGTTTCTGTTTCTGTTTTTGTTTTCTCAGCATCTGCTGAGATGCCAGCTATAAAG
4401 CTTAATGAGGTTTCCTTCTACAAGACAAATCGTTTTTCTGTTTCTGCTTTCAAAAACAAATGGTTTCCCCCCTGCCCCAG
4481 ATTTCGTACTATGATGTATCTGGGTGTGAGTCTGTATTTATTCTGCTTGGAATTTGTTGAGCTTCTTGGGTATGTAGATG
4561 AATGATTTTTTTTAAGAAAAATATTAAATTTGGGATGTTTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugGUAAUACACGACGAu 5'
                 |||||  ||||||| 
Target 5' atatccaCATTA-CTGCTGCTa 3'
232 - 252 154.00 -13.40
2
miRNA  3' guGUUUGGU---AAUAC-ACGACGAu 5'
            ||||:|:   || || | ||||| 
Target 5' gaCAAATCGTTTTTCTGTTTCTGCTt 3'
4424 - 4449 132.00 -15.50
3
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               |:::|||| ||:||:| 
Target 5' atattATTGTTAT-TGTTGTTa 3'
1028 - 1048 128.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30520363 2 COSMIC
COSN30524709 15 COSMIC
COSN30188374 23 COSMIC
COSN30750800 27 COSMIC
COSN5030183 35 COSMIC
COSN26650718 36 COSMIC
COSN31778682 69 COSMIC
COSN24394505 70 COSMIC
COSN32115527 109 COSMIC
COSN8093857 186 COSMIC
COSN8093856 195 COSMIC
COSN8093855 307 COSMIC
COSN21597734 1099 COSMIC
COSN32115526 1358 COSMIC
COSN22612992 1539 COSMIC
COSN2283258 1549 COSMIC
COSN22839443 1744 COSMIC
COSN27914295 1751 COSMIC
COSN6701619 1907 COSMIC
COSN30545603 2000 COSMIC
COSN7674906 2433 COSMIC
COSN30313062 2581 COSMIC
COSN197361 2680 COSMIC
COSN6701618 2913 COSMIC
COSN25807982 3020 COSMIC
COSN24957277 3102 COSMIC
COSN22246686 3392 COSMIC
COSN25903744 3615 COSMIC
COSN19181808 3628 COSMIC
COSN2283257 3715 COSMIC
COSN29410377 3820 COSMIC
COSN6701617 3849 COSMIC
COSN2283256 3927 COSMIC
COSN2283255 3932 COSMIC
COSN2283254 4170 COSMIC
COSN25952392 4265 COSMIC
COSN6701616 4659 COSMIC
COSN6701615 5077 COSMIC
COSN5113587 5453 COSMIC
COSN9266392 5605 COSMIC
COSN2283253 5664 COSMIC
COSN6701614 5699 COSMIC
COSN16361519 5728 COSMIC
COSN9663149 5904 COSMIC
COSN2283252 5930 COSMIC
COSN2283251 5931 COSMIC
COSN15686682 6702 COSMIC
COSN23407509 6781 COSMIC
COSN19532720 7221 COSMIC
COSN16115868 7282 COSMIC
COSN29351334 7423 COSMIC
COSN21902577 7476 COSMIC
COSN6701613 7734 COSMIC
COSN17845971 7764 COSMIC
COSN21483566 7780 COSMIC
COSN6701612 7793 COSMIC
COSN16228082 7883 COSMIC
COSN19687270 8027 COSMIC
COSN24092726 8036 COSMIC
COSN8858998 8265 COSMIC
COSN20375264 8530 COSMIC
COSN20370964 8596 COSMIC
COSN2479415 8612 COSMIC
COSN23819120 8714 COSMIC
COSN5685133 8840 COSMIC
COSN27372196 8857 COSMIC
COSN26286544 9070 COSMIC
COSN22488364 9505 COSMIC
COSN20425812 9693 COSMIC
COSN20396202 9768 COSMIC
COSN20343665 9799 COSMIC
COSN32005808 9812 COSMIC
COSN6701610 9818 COSMIC
COSN29404813 10015 COSMIC
COSN15675776 10068 COSMIC
COSN19244257 10104 COSMIC
COSN30391456 10150 COSMIC
COSN9266391 10350 COSMIC
COSN6701609 10355 COSMIC
COSN6701608 10591 COSMIC
COSN2283250 10895 COSMIC
COSN21593521 11153 COSMIC
COSN26653611 11708 COSMIC
COSN7674905 11774 COSMIC
COSN8093854 11892 COSMIC
COSN26262327 11914 COSMIC
COSN21064893 12394 COSMIC
COSN2283249 12467 COSMIC
COSN18988752 12775 COSMIC
COSN14780507 12782 COSMIC
COSN26891316 12820 COSMIC
COSN8093853 13187 COSMIC
COSN1366657 13269 COSMIC
COSN17617674 13331 COSMIC
COSN9266390 13551 COSMIC
COSN16467839 13626 COSMIC
COSN19114029 13656 COSMIC
COSN15734937 13686 COSMIC
COSN2283248 13781 COSMIC
COSN29977702 14050 COSMIC
COSN32207094 14063 COSMIC
COSN2458727 14242 COSMIC
COSN16355611 14266 COSMIC
COSN8093852 14650 COSMIC
COSN23629115 14654 COSMIC
COSN22290609 14674 COSMIC
COSN23606268 14690 COSMIC
COSN5685132 14690 COSMIC
COSN29493243 14864 COSMIC
COSN26829396 14877 COSMIC
COSN9663147 14884 COSMIC
COSN22222908 15146 COSMIC
COSN16347659 15172 COSMIC
COSN20996759 15184 COSMIC
COSN21072584 15190 COSMIC
COSN23110766 15542 COSMIC
COSN16050779 15593 COSMIC
COSN25939031 15729 COSMIC
COSN203838 16006 COSMIC
COSN27572744 16105 COSMIC
COSN9266389 16161 COSMIC
COSN15000803 16228 COSMIC
COSN4881601 16432 COSMIC
COSN8093851 16802 COSMIC
COSN26501946 16941 COSMIC
COSN2283246 17092 COSMIC
COSN8093850 17150 COSMIC
COSN5113586 17407 COSMIC
COSN23642652 17477 COSMIC
COSN24967925 17649 COSMIC
COSN22231578 17657 COSMIC
COSN23909665 17826 COSMIC
COSN16239397 17828 COSMIC
COSN5685131 17891 COSMIC
COSN19713126 18769 COSMIC
COSN24901752 18812 COSMIC
COSN6701605 18833 COSMIC
COSN31491203 18883 COSMIC
COSN28638354 18892 COSMIC
COSN26560731 19060 COSMIC
COSN7052393 19090 COSMIC
COSN31517083 19094 COSMIC
COSN22603612 19448 COSMIC
COSN32058662 19489 COSMIC
COSN29346259 19594 COSMIC
COSN21482865 19706 COSMIC
COSN23696192 19724 COSMIC
COSN24625165 19902 COSMIC
COSN5685130 19930 COSMIC
COSN31856383 20244 COSMIC
COSN18780699 20429 COSMIC
COSN22895157 20602 COSMIC
COSN23855868 20760 COSMIC
COSN17720790 20799 COSMIC
COSN17850963 20808 COSMIC
COSN2283245 20891 COSMIC
COSN21489051 21079 COSMIC
COSN9663146 21178 COSMIC
rs10098647 16145 GWAS
rs4894942 x rs224215 20850 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1009041800 1 dbSNP
rs769972664 8 dbSNP
rs781777444 9 dbSNP
rs371796629 10 dbSNP
rs776556904 11 dbSNP
rs768791999 12 dbSNP
rs745722848 13 dbSNP
rs1205893746 15 dbSNP
rs779019928 16 dbSNP
rs368380583 17 dbSNP
rs749064742 18 dbSNP
rs777780593 23 dbSNP
rs755815659 26 dbSNP
rs1394684999 30 dbSNP
rs1355400605 32 dbSNP
rs1355326572 34 dbSNP
rs752408191 35 dbSNP
rs780504279 39 dbSNP
rs1371938377 45 dbSNP
rs754549694 46 dbSNP
rs751960096 47 dbSNP
rs1368794096 49 dbSNP
rs1201024927 54 dbSNP
rs1260444256 56 dbSNP
rs1391077730 60 dbSNP
rs1181507962 70 dbSNP
rs1421185544 71 dbSNP
rs1000450487 73 dbSNP
rs904812625 75 dbSNP
rs370263753 87 dbSNP
rs542013160 88 dbSNP
rs987466179 90 dbSNP
rs1305447895 94 dbSNP
rs1338523508 100 dbSNP
rs574267507 101 dbSNP
rs1057465994 102 dbSNP
rs1279147305 102 dbSNP
rs1482712694 105 dbSNP
rs1226437538 108 dbSNP
rs188247535 109 dbSNP
rs939164436 117 dbSNP
rs1224676023 118 dbSNP
rs1283719447 122 dbSNP
rs996421024 125 dbSNP
rs1216696012 129 dbSNP
rs963661689 135 dbSNP
rs540913834 136 dbSNP
rs60352411 138 dbSNP
rs1445546205 139 dbSNP
rs867370898 142 dbSNP
rs1166030255 144 dbSNP
rs886162892 150 dbSNP
rs1419250045 162 dbSNP
rs974416757 163 dbSNP
rs182728004 164 dbSNP
rs1408653792 170 dbSNP
rs190848773 171 dbSNP
rs1002505885 176 dbSNP
rs772369606 179 dbSNP
rs767399358 186 dbSNP
rs187982581 188 dbSNP
rs1247828174 190 dbSNP
rs1432102634 194 dbSNP
rs1307077147 197 dbSNP
rs748494852 201 dbSNP
rs1371559520 206 dbSNP
rs1018665041 216 dbSNP
rs987633222 223 dbSNP
rs1440156088 227 dbSNP
rs905545043 236 dbSNP
rs1237632761 241 dbSNP
rs1031839259 242 dbSNP
rs1185807147 245 dbSNP
rs1379047128 252 dbSNP
rs1439598226 255 dbSNP
rs554340706 257 dbSNP
rs1410301885 268 dbSNP
rs947303492 271 dbSNP
rs540896724 281 dbSNP
rs1472299105 285 dbSNP
rs779427365 292 dbSNP
rs769083767 297 dbSNP
rs1249641379 299 dbSNP
rs1407100560 308 dbSNP
rs1454410310 310 dbSNP
rs536060521 325 dbSNP
rs904760297 328 dbSNP
rs1375806141 332 dbSNP
rs1207218191 336 dbSNP
rs1240822609 340 dbSNP
rs1281145622 355 dbSNP
rs1342277444 358 dbSNP
rs568654356 360 dbSNP
rs1012893211 362 dbSNP
rs772135249 366 dbSNP
rs1206026316 368 dbSNP
rs1236757289 377 dbSNP
rs547346023 383 dbSNP
rs1183174910 386 dbSNP
rs150493090 406 dbSNP
rs1057179370 408 dbSNP
rs1172036387 409 dbSNP
rs1430299930 415 dbSNP
rs749384998 426 dbSNP
rs940099102 427 dbSNP
rs748001655 439 dbSNP
rs887228098 446 dbSNP
rs921924012 447 dbSNP
rs140547872 453 dbSNP
rs28493959 454 dbSNP
rs575997133 458 dbSNP
rs1216447062 470 dbSNP
rs975078277 472 dbSNP
rs12677216 475 dbSNP
rs911548212 482 dbSNP
rs1005030068 484 dbSNP
rs1198711588 486 dbSNP
rs1031450276 492 dbSNP
rs115417987 493 dbSNP
rs750652525 496 dbSNP
rs1003028658 501 dbSNP
rs534676967 502 dbSNP
rs1456850636 511 dbSNP
rs1409891390 527 dbSNP
rs1462364961 536 dbSNP
rs1184377094 558 dbSNP
rs541926131 559 dbSNP
rs905660888 569 dbSNP
rs1472905237 570 dbSNP
rs545536792 572 dbSNP
rs1266548303 573 dbSNP
rs1346856743 573 dbSNP
rs1397527590 576 dbSNP
rs1277247556 580 dbSNP
rs1189320200 584 dbSNP
rs1326655676 592 dbSNP
rs1228670976 599 dbSNP
rs896110059 602 dbSNP
rs1036093255 603 dbSNP
rs1293065647 605 dbSNP
rs1490877162 608 dbSNP
rs148357668 609 dbSNP
rs1207713163 621 dbSNP
rs1262790167 623 dbSNP
rs190977103 628 dbSNP
rs186208296 633 dbSNP
rs1366532831 637 dbSNP
rs1472305974 639 dbSNP
rs1048480751 643 dbSNP
rs1269531870 644 dbSNP
rs1228444471 647 dbSNP
rs893031762 650 dbSNP
rs1053447351 659 dbSNP
rs1384986346 661 dbSNP
rs994600936 663 dbSNP
rs1385540136 668 dbSNP
rs575287329 672 dbSNP
rs758153144 673 dbSNP
rs1316434256 676 dbSNP
rs144659736 676 dbSNP
rs1386697351 681 dbSNP
rs933371825 685 dbSNP
rs1454369148 686 dbSNP
rs943276773 693 dbSNP
rs1207126677 694 dbSNP
rs1377056795 695 dbSNP
rs1441691796 697 dbSNP
rs922037158 698 dbSNP
rs1387058042 699 dbSNP
rs13261565 708 dbSNP
rs1157929414 712 dbSNP
rs942030236 713 dbSNP
rs781338586 714 dbSNP
rs1253423927 733 dbSNP
rs1401044722 735 dbSNP
rs1187638618 740 dbSNP
rs543427032 741 dbSNP
rs978516015 750 dbSNP
rs984118711 756 dbSNP
rs1445258547 757 dbSNP
rs1306833860 759 dbSNP
rs1317610034 759 dbSNP
rs1249505758 760 dbSNP
rs1208875265 764 dbSNP
rs1343694858 767 dbSNP
rs968837418 770 dbSNP
rs951031875 776 dbSNP
rs1323056890 781 dbSNP
rs1036267262 793 dbSNP
rs1253678018 794 dbSNP
rs1244775857 797 dbSNP
rs575913308 800 dbSNP
rs1231748077 801 dbSNP
rs1456224793 814 dbSNP
rs1176562227 818 dbSNP
rs1251134273 823 dbSNP
rs1314405818 825 dbSNP
rs13259697 832 dbSNP
rs1228086424 833 dbSNP
rs1376764676 841 dbSNP
rs960557426 848 dbSNP
rs969767903 851 dbSNP
rs1022688010 857 dbSNP
rs1178095852 858 dbSNP
rs1322790947 860 dbSNP
rs1382932223 864 dbSNP
rs1035967334 866 dbSNP
rs1298165813 867 dbSNP
rs1374690099 871 dbSNP
rs1393257346 872 dbSNP
rs1299261768 873 dbSNP
rs1344916498 881 dbSNP
rs1224355447 882 dbSNP
rs570605882 884 dbSNP
rs753818501 885 dbSNP
rs377071628 894 dbSNP
rs73243955 898 dbSNP
rs1251856334 899 dbSNP
rs1481562280 902 dbSNP
rs1189349450 903 dbSNP
rs1467538757 905 dbSNP
rs553596051 912 dbSNP
rs1026990081 924 dbSNP
rs1201152214 924 dbSNP
rs1421007364 929 dbSNP
rs1395583301 938 dbSNP
rs1464456388 950 dbSNP
rs891066435 951 dbSNP
rs1464002768 956 dbSNP
rs899953671 958 dbSNP
rs1365046511 960 dbSNP
rs1051355052 965 dbSNP
rs1405612990 975 dbSNP
rs932488177 980 dbSNP
rs1285501139 988 dbSNP
rs1039270048 992 dbSNP
rs900566606 997 dbSNP
rs772760680 1004 dbSNP
rs1308995810 1009 dbSNP
rs535188132 1011 dbSNP
rs1290874948 1012 dbSNP
rs140870561 1018 dbSNP
rs1490387589 1023 dbSNP
rs1193463436 1025 dbSNP
rs1224068594 1026 dbSNP
rs1441443891 1030 dbSNP
rs866102078 1038 dbSNP
rs552570071 1039 dbSNP
rs1484548376 1052 dbSNP
rs1430601456 1054 dbSNP
rs1051695280 1057 dbSNP
rs929529890 1061 dbSNP
rs1228202068 1063 dbSNP
rs1340497592 1066 dbSNP
rs1358647359 1068 dbSNP
rs1300186538 1069 dbSNP
rs1430316770 1071 dbSNP
rs1228465385 1072 dbSNP
rs928932041 1073 dbSNP
rs981552043 1074 dbSNP
rs947114656 1081 dbSNP
rs56367279 1089 dbSNP
rs1022634250 1092 dbSNP
rs989850605 1093 dbSNP
rs992047522 1098 dbSNP
rs1247601350 1099 dbSNP
rs762087742 1105 dbSNP
rs1397858713 1111 dbSNP
rs1243472050 1114 dbSNP
rs1487091436 1116 dbSNP
rs553707692 1127 dbSNP
rs1445789606 1140 dbSNP
rs928850365 1141 dbSNP
rs1405891129 1144 dbSNP
rs1400132692 1145 dbSNP
rs998559050 1146 dbSNP
rs1347178554 1160 dbSNP
rs891006825 1166 dbSNP
rs1029605644 1174 dbSNP
rs1427671531 1175 dbSNP
rs73243954 1177 dbSNP
rs1383196326 1184 dbSNP
rs548692580 1189 dbSNP
rs111855725 1196 dbSNP
rs146461233 1207 dbSNP
rs1223845290 1210 dbSNP
rs559378554 1232 dbSNP
rs1006307843 1238 dbSNP
rs1285957330 1246 dbSNP
rs1366320256 1248 dbSNP
rs1310049580 1253 dbSNP
rs1202586547 1254 dbSNP
rs181595990 1267 dbSNP
rs1475241164 1268 dbSNP
rs964461335 1272 dbSNP
rs1048179218 1276 dbSNP
rs1250350796 1282 dbSNP
rs1205077668 1289 dbSNP
rs532146335 1292 dbSNP
rs1231659607 1293 dbSNP
rs929336447 1295 dbSNP
rs1018379664 1296 dbSNP
rs1177822467 1296 dbSNP
rs928840692 1313 dbSNP
rs1196720582 1326 dbSNP
rs1406554484 1327 dbSNP
rs1470823649 1335 dbSNP
rs768995827 1339 dbSNP
rs1045970597 1340 dbSNP
rs949005637 1343 dbSNP
rs749860649 1347 dbSNP
rs1335060649 1349 dbSNP
rs916076196 1352 dbSNP
rs116061655 1353 dbSNP
rs1364826671 1359 dbSNP
rs957334728 1378 dbSNP
rs998772181 1380 dbSNP
rs1263892556 1384 dbSNP
rs1324791190 1387 dbSNP
rs1205964405 1388 dbSNP
rs1271554288 1389 dbSNP
rs1247193454 1402 dbSNP
rs1437742410 1403 dbSNP
rs924395962 1409 dbSNP
rs1356185500 1415 dbSNP
rs191356397 1421 dbSNP
rs775946050 1425 dbSNP
rs143959424 1426 dbSNP
rs894191716 1429 dbSNP
rs1055560574 1440 dbSNP
rs1352232373 1446 dbSNP
rs1410470270 1448 dbSNP
rs1330764555 1450 dbSNP
rs1363192444 1453 dbSNP
rs938813280 1456 dbSNP
rs10087699 1458 dbSNP
rs963996266 1460 dbSNP
rs1388205583 1462 dbSNP
rs542786167 1465 dbSNP
rs1346999728 1467 dbSNP
rs982951676 1468 dbSNP
rs186353186 1469 dbSNP
rs1339064877 1473 dbSNP
rs553856594 1476 dbSNP
rs1005413277 1477 dbSNP
rs1489893061 1479 dbSNP
rs1221843167 1481 dbSNP
rs974022208 1488 dbSNP
rs1490906519 1489 dbSNP
rs1410621034 1492 dbSNP
rs1191219446 1493 dbSNP
rs756511719 1494 dbSNP
rs887831709 1494 dbSNP
rs1471922095 1497 dbSNP
rs1169628058 1506 dbSNP
rs1475591453 1506 dbSNP
rs1235068883 1512 dbSNP
rs1183064743 1513 dbSNP
rs180859280 1516 dbSNP
rs1303213335 1518 dbSNP
rs577190679 1522 dbSNP
rs1288087373 1525 dbSNP
rs369868259 1526 dbSNP
rs1380172369 1527 dbSNP
rs559238005 1530 dbSNP
rs907204411 1540 dbSNP
rs1215826904 1549 dbSNP
rs1335664483 1552 dbSNP
rs1326229398 1555 dbSNP
rs1228579985 1557 dbSNP
rs1300538029 1559 dbSNP
rs1045748039 1560 dbSNP
rs1245813012 1561 dbSNP
rs745915213 1566 dbSNP
rs781304828 1576 dbSNP
rs878906377 1580 dbSNP
rs757437887 1581 dbSNP
rs747217101 1583 dbSNP
rs778913976 1585 dbSNP
rs1195054096 1608 dbSNP
rs754786475 1621 dbSNP
rs1241259866 1625 dbSNP
rs1443944470 1627 dbSNP
rs1021568876 1639 dbSNP
rs1011628281 1640 dbSNP
rs189335428 1642 dbSNP
rs558709082 1643 dbSNP
rs1383186953 1647 dbSNP
rs1322986557 1655 dbSNP
rs10100729 1656 dbSNP
rs1316288794 1665 dbSNP
rs1325235297 1671 dbSNP
rs906995209 1673 dbSNP
rs1260429816 1674 dbSNP
rs922262981 1679 dbSNP
rs766289588 1680 dbSNP
rs184755902 1683 dbSNP
rs879597928 1684 dbSNP
rs1460672856 1692 dbSNP
rs1016874918 1693 dbSNP
rs1416829048 1704 dbSNP
rs1180455914 1715 dbSNP
rs1005775110 1722 dbSNP
rs1363815479 1724 dbSNP
rs1455031530 1729 dbSNP
rs565855464 1735 dbSNP
rs1404393309 1737 dbSNP
rs1025932148 1738 dbSNP
rs1338004981 1747 dbSNP
rs993593775 1751 dbSNP
rs920150263 1757 dbSNP
rs974361125 1759 dbSNP
rs767089249 1760 dbSNP
rs1024245013 1767 dbSNP
rs942657126 1773 dbSNP
rs1012881993 1780 dbSNP
rs547451887 1781 dbSNP
rs761512302 1785 dbSNP
rs911223297 1791 dbSNP
rs936137060 1792 dbSNP
rs903345505 1793 dbSNP
rs955431350 1793 dbSNP
rs1469105615 1796 dbSNP
rs1031116964 1797 dbSNP
rs62511578 1798 dbSNP
rs933737721 1800 dbSNP
rs564908298 1806 dbSNP
rs11991950 1809 dbSNP
rs77825500 1810 dbSNP
rs1298065594 1811 dbSNP
rs763283614 1813 dbSNP
rs114820076 1816 dbSNP
rs73243948 1824 dbSNP
rs1303147000 1829 dbSNP
rs1305512600 1837 dbSNP
rs113036674 1839 dbSNP
rs112697950 1840 dbSNP
rs1219615820 1842 dbSNP
rs778774993 1842 dbSNP
rs898670916 1842 dbSNP
rs1234705608 1849 dbSNP
rs1490415470 1849 dbSNP
rs1192500343 1850 dbSNP
rs1364093352 1853 dbSNP
rs1038982119 1854 dbSNP
rs1318147064 1857 dbSNP
rs942960185 1858 dbSNP
rs775887387 1869 dbSNP
rs1431773937 1871 dbSNP
rs951414014 1873 dbSNP
rs1025457059 1875 dbSNP
rs933999413 1878 dbSNP
rs1295460402 1879 dbSNP
rs923991600 1881 dbSNP
rs978177535 1882 dbSNP
rs1175994322 1883 dbSNP
rs1290403500 1886 dbSNP
rs982381510 1888 dbSNP
rs971424507 1891 dbSNP
rs1223343580 1893 dbSNP
rs552286940 1896 dbSNP
rs745943628 1901 dbSNP
rs1389876605 1904 dbSNP
rs572043233 1913 dbSNP
rs1012828111 1914 dbSNP
rs10112339 1921 dbSNP
rs1162183954 1926 dbSNP
rs914406699 1927 dbSNP
rs1242797654 1936 dbSNP
rs958635291 1952 dbSNP
rs1033463447 1955 dbSNP
rs1289243572 1966 dbSNP
rs62511577 1979 dbSNP
rs1450393828 1981 dbSNP
rs1211439892 1982 dbSNP
rs1314231721 1985 dbSNP
rs1382944141 1988 dbSNP
rs971046323 1997 dbSNP
rs1025309645 2005 dbSNP
rs1295083217 2009 dbSNP
rs1315946720 2011 dbSNP
rs1215985106 2013 dbSNP
rs903458523 2015 dbSNP
rs1041877564 2019 dbSNP
rs993876059 2020 dbSNP
rs577397837 2022 dbSNP
rs898285093 2025 dbSNP
rs1362198020 2027 dbSNP
rs1405810118 2028 dbSNP
rs1400344723 2031 dbSNP
rs1160128514 2033 dbSNP
rs1283135082 2035 dbSNP
rs13278859 2036 dbSNP
rs1336042476 2043 dbSNP
rs540482327 2050 dbSNP
rs1406723564 2051 dbSNP
rs1449653232 2055 dbSNP
rs900900380 2057 dbSNP
rs1277275759 2059 dbSNP
rs1039474957 2063 dbSNP
rs890021736 2067 dbSNP
rs942459933 2076 dbSNP
rs1289813163 2081 dbSNP
rs772822398 2101 dbSNP
rs909546092 2107 dbSNP
rs1202167368 2108 dbSNP
rs984216776 2115 dbSNP
rs1263127434 2117 dbSNP
rs1443511996 2119 dbSNP
rs1212774079 2124 dbSNP
rs1315370255 2135 dbSNP
rs1231284395 2139 dbSNP
rs543953143 2148 dbSNP
rs1370367943 2150 dbSNP
rs772188287 2150 dbSNP
rs1167047239 2152 dbSNP
rs748052936 2153 dbSNP
rs11373827 2154 dbSNP
rs1402568751 2154 dbSNP
rs1420451514 2159 dbSNP
rs768269176 2160 dbSNP
rs746117756 2164 dbSNP
rs918509911 2166 dbSNP
rs981941150 2168 dbSNP
rs371718277 2178 dbSNP
rs79297258 2179 dbSNP
rs1471842135 2180 dbSNP
rs1024308486 2185 dbSNP
rs1309542683 2186 dbSNP
rs536260600 2187 dbSNP
rs1259627953 2189 dbSNP
rs1222460180 2194 dbSNP
rs1283047887 2195 dbSNP
rs1346099843 2198 dbSNP
rs1221454006 2202 dbSNP
rs946773018 2204 dbSNP
rs565719540 2207 dbSNP
rs989981222 2208 dbSNP
rs1254310409 2209 dbSNP
rs1489924235 2212 dbSNP
rs553876160 2216 dbSNP
rs927202383 2222 dbSNP
rs1166132667 2231 dbSNP
rs373870098 2231 dbSNP
rs1418709163 2232 dbSNP
rs538753765 2233 dbSNP
rs981327715 2236 dbSNP
rs181985332 2241 dbSNP
rs1307783392 2243 dbSNP
rs1403985088 2244 dbSNP
rs1323751132 2247 dbSNP
rs1332088372 2253 dbSNP
rs1439014444 2257 dbSNP
rs1288686592 2259 dbSNP
rs1226203638 2260 dbSNP
rs1000634452 2271 dbSNP
rs967626743 2284 dbSNP
rs1020975960 2290 dbSNP
rs971326541 2292 dbSNP
rs1293323378 2304 dbSNP
rs112945554 2306 dbSNP
rs1350386830 2309 dbSNP
rs998316042 2316 dbSNP
rs1190742417 2318 dbSNP
rs1241247682 2335 dbSNP
rs149758202 2346 dbSNP
rs962475759 2348 dbSNP
rs1164358138 2360 dbSNP
rs1423428427 2363 dbSNP
rs139560713 2367 dbSNP
rs778116672 2372 dbSNP
rs888220567 2376 dbSNP
rs759800013 2390 dbSNP
rs1048028560 2391 dbSNP
rs1249525811 2392 dbSNP
rs889958498 2398 dbSNP
rs929647610 2399 dbSNP
rs918470148 2401 dbSNP
rs1480845070 2402 dbSNP
rs1245846531 2403 dbSNP
rs1380730948 2404 dbSNP
rs1218966275 2406 dbSNP
rs561248302 2412 dbSNP
rs949339513 2427 dbSNP
rs1203547601 2428 dbSNP
rs1465143183 2429 dbSNP
rs916414709 2429 dbSNP
rs544551169 2430 dbSNP
rs1241162907 2431 dbSNP
rs1443552283 2432 dbSNP
rs995448874 2433 dbSNP
rs946723303 2438 dbSNP
rs1305471979 2439 dbSNP
rs1388433218 2441 dbSNP
rs893866928 2441 dbSNP
rs549266789 2444 dbSNP
rs140184676 2446 dbSNP
rs189234771 2446 dbSNP
rs749777375 2446 dbSNP
rs937151729 2446 dbSNP
rs949958542 2446 dbSNP
rs1237186479 2459 dbSNP
rs1393583958 2459 dbSNP
rs147183536 2461 dbSNP
rs545173621 2464 dbSNP
rs972351552 2465 dbSNP
rs532892353 2469 dbSNP
rs962707061 2472 dbSNP
rs1200895230 2473 dbSNP
rs1165834227 2481 dbSNP
rs776121369 2484 dbSNP
rs1018440047 2487 dbSNP
rs1007075592 2488 dbSNP
rs985615260 2490 dbSNP
rs1412251680 2498 dbSNP
rs953857274 2499 dbSNP
rs1427558122 2500 dbSNP
rs562553826 2501 dbSNP
rs1419559750 2503 dbSNP
rs1303889015 2507 dbSNP
rs1029826346 2515 dbSNP
rs1389711109 2516 dbSNP
rs1307730805 2518 dbSNP
rs1351324936 2527 dbSNP
rs867284331 2531 dbSNP
rs998381380 2545 dbSNP
rs1311349906 2552 dbSNP
rs888177153 2553 dbSNP
rs902748468 2557 dbSNP
rs1021235712 2576 dbSNP
rs1479411778 2577 dbSNP
rs1010881657 2581 dbSNP
rs543675673 2583 dbSNP
rs1196788277 2589 dbSNP
rs1048619096 2592 dbSNP
rs1432946278 2593 dbSNP
rs1469568014 2598 dbSNP
rs576544210 2599 dbSNP
rs868193807 2603 dbSNP
rs993813207 2609 dbSNP
rs893806154 2611 dbSNP
rs1460581103 2615 dbSNP
rs896805211 2631 dbSNP
rs554876825 2632 dbSNP
rs1371167081 2645 dbSNP
rs1411929903 2652 dbSNP
rs1046089411 2654 dbSNP
rs949287131 2659 dbSNP
rs1366702857 2662 dbSNP
rs184498075 2672 dbSNP
rs1303397858 2673 dbSNP
rs1463167904 2680 dbSNP
rs1305711752 2685 dbSNP
rs1054855975 2687 dbSNP
rs906648171 2688 dbSNP
rs1274775058 2695 dbSNP
rs1343619133 2702 dbSNP
rs575223017 2710 dbSNP
rs936519758 2712 dbSNP
rs926021502 2718 dbSNP
rs545796201 2737 dbSNP
rs946191237 2750 dbSNP
rs918476171 2758 dbSNP
rs1269841153 2763 dbSNP
rs572154750 2767 dbSNP
rs1318029349 2768 dbSNP
rs1188437464 2775 dbSNP
rs1390887254 2778 dbSNP
rs1301068785 2781 dbSNP
rs913216166 2785 dbSNP
rs976777633 2803 dbSNP
rs965590167 2808 dbSNP
rs1018554319 2820 dbSNP
rs1295080039 2823 dbSNP
rs940995973 2824 dbSNP
rs1434562885 2831 dbSNP
rs1382919785 2836 dbSNP
rs1434309890 2854 dbSNP
rs116448410 2878 dbSNP
rs1366792545 2882 dbSNP
rs1243129599 2884 dbSNP
rs538983414 2888 dbSNP
rs1321962585 2899 dbSNP
rs1454292157 2900 dbSNP
rs952999357 2905 dbSNP
rs762894986 2906 dbSNP
rs1171594622 2907 dbSNP
rs1027186825 2910 dbSNP
rs75947084 2913 dbSNP
rs896927993 2919 dbSNP
rs1249152873 2923 dbSNP
rs1426319874 2925 dbSNP
rs1263286647 2929 dbSNP
rs1424652280 2931 dbSNP
rs753863956 2931 dbSNP
rs749050418 2942 dbSNP
rs966879440 2944 dbSNP
rs1456482638 2945 dbSNP
rs1321217294 2956 dbSNP
rs1011572858 2957 dbSNP
rs958350736 2958 dbSNP
rs1034084795 2959 dbSNP
rs1209285310 2967 dbSNP
rs868260279 2968 dbSNP
rs1024586604 2969 dbSNP
rs1327571042 2971 dbSNP
rs1002234393 2973 dbSNP
rs556593125 2974 dbSNP
rs1466644688 2976 dbSNP
rs1208595972 2979 dbSNP
rs1236999934 2982 dbSNP
rs193089750 3000 dbSNP
rs1183859124 3010 dbSNP
rs779858628 3016 dbSNP
rs1046481327 3017 dbSNP
rs895043418 3019 dbSNP
rs1054968617 3020 dbSNP
rs869040952 3021 dbSNP
rs1159647919 3026 dbSNP
rs1413815587 3027 dbSNP
rs1412720144 3029 dbSNP
rs1333369855 3031 dbSNP
rs1359282349 3032 dbSNP
rs368182762 3033 dbSNP
rs1449539942 3041 dbSNP
rs896997669 3044 dbSNP
rs936484607 3044 dbSNP
rs1036863221 3049 dbSNP
rs567455159 3050 dbSNP
rs1228555344 3064 dbSNP
rs1297867859 3072 dbSNP
rs1331614986 3076 dbSNP
rs903677814 3078 dbSNP
rs1312918157 3082 dbSNP
rs1042246606 3098 dbSNP
rs1401477470 3101 dbSNP
rs1249635502 3105 dbSNP
rs1396874489 3107 dbSNP
rs1311004109 3133 dbSNP
rs1253734279 3135 dbSNP
rs909827457 3138 dbSNP
rs1049841267 3140 dbSNP
rs1425777035 3150 dbSNP
rs1416044875 3159 dbSNP
rs1375866905 3160 dbSNP
rs1369363526 3189 dbSNP
rs1167706618 3190 dbSNP
rs946109076 3191 dbSNP
rs932353235 3194 dbSNP
rs1374434673 3197 dbSNP
rs576846351 3198 dbSNP
rs976725274 3199 dbSNP
rs1422742049 3210 dbSNP
rs976505772 3212 dbSNP
rs1254691470 3216 dbSNP
rs966828530 3225 dbSNP
rs1272608447 3227 dbSNP
rs944021336 3229 dbSNP
rs1341481545 3247 dbSNP
rs1206199987 3250 dbSNP
rs756021454 3251 dbSNP
rs1276999183 3254 dbSNP
rs1449720726 3256 dbSNP
rs986106964 3262 dbSNP
rs7841336 3263 dbSNP
rs914066225 3264 dbSNP
rs953029200 3282 dbSNP
rs989694897 3284 dbSNP
rs958514385 3295 dbSNP
rs1033955518 3298 dbSNP
rs1170169317 3298 dbSNP
rs1388120290 3308 dbSNP
rs1486910729 3312 dbSNP
rs1002588720 3314 dbSNP
rs1027551116 3319 dbSNP
rs972956917 3326 dbSNP
rs961086146 3342 dbSNP
rs1024700706 3343 dbSNP
rs1013166343 3346 dbSNP
rs894822679 3351 dbSNP
rs1443776767 3354 dbSNP
rs750314447 3357 dbSNP
rs1337771370 3358 dbSNP
rs993538997 3361 dbSNP
rs558558538 3362 dbSNP
rs1037257411 3373 dbSNP
rs1354514808 3388 dbSNP
rs767123288 3394 dbSNP
rs537537133 3398 dbSNP
rs1042584578 3399 dbSNP
rs781329092 3401 dbSNP
rs1206794294 3407 dbSNP
rs891844856 3408 dbSNP
rs12677683 3414 dbSNP
rs1416599813 3417 dbSNP
rs188019321 3418 dbSNP
rs751263292 3423 dbSNP
rs371999002 3427 dbSNP
rs1163425807 3432 dbSNP
rs1391960045 3438 dbSNP
rs7841412 3439 dbSNP
rs7841174 3441 dbSNP
rs562457214 3448 dbSNP
rs1183407568 3449 dbSNP
rs1389452715 3456 dbSNP
rs931546492 3464 dbSNP
rs544277757 3465 dbSNP
rs1457062462 3466 dbSNP
rs945095030 3468 dbSNP
rs1415054015 3469 dbSNP
rs1226336539 3471 dbSNP
rs920204833 3496 dbSNP
rs1166436657 3503 dbSNP
rs1421889385 3519 dbSNP
rs775862353 3535 dbSNP
rs973290161 3542 dbSNP
rs1267198616 3544 dbSNP
rs1476495374 3545 dbSNP
rs1465296998 3547 dbSNP
rs1381488140 3549 dbSNP
rs961528614 3553 dbSNP
rs913678583 3554 dbSNP
rs1187859475 3555 dbSNP
rs768680445 3571 dbSNP
rs1476424241 3576 dbSNP
rs7840866 3578 dbSNP
rs777807617 3582 dbSNP
rs1458251302 3588 dbSNP
rs917633164 3605 dbSNP
rs926835095 3607 dbSNP
rs184781290 3614 dbSNP
rs959156390 3615 dbSNP
rs192385796 3618 dbSNP
rs1408163800 3624 dbSNP
rs972065712 3630 dbSNP
rs1271394463 3633 dbSNP
rs1000549696 3636 dbSNP
rs968345630 3637 dbSNP
rs1254135979 3650 dbSNP
rs1005768490 3651 dbSNP
rs1200519340 3652 dbSNP
rs888293240 3660 dbSNP
rs542954347 3667 dbSNP
rs1287664766 3669 dbSNP
rs1439848383 3670 dbSNP
rs574624750 3673 dbSNP
rs996762988 3695 dbSNP
rs1329243842 3710 dbSNP
rs1009778736 3711 dbSNP
rs1473106287 3720 dbSNP
rs1161998557 3730 dbSNP
rs753158884 3730 dbSNP
rs901667138 3731 dbSNP
rs1376420899 3732 dbSNP
rs901119136 3733 dbSNP
rs1173242839 3742 dbSNP
rs1040714217 3745 dbSNP
rs1428086559 3747 dbSNP
rs1307626712 3749 dbSNP
rs1350922777 3753 dbSNP
rs560367722 3757 dbSNP
rs1008295649 3758 dbSNP
rs889904940 3759 dbSNP
rs1050163981 3766 dbSNP
rs545096232 3768 dbSNP
rs1281873389 3792 dbSNP
rs577936278 3795 dbSNP
rs7824390 3798 dbSNP
rs1339422015 3799 dbSNP
rs920134875 3804 dbSNP
rs1037294672 3805 dbSNP
rs1158498650 3808 dbSNP
rs892182899 3812 dbSNP
rs1053549378 3816 dbSNP
rs556419478 3819 dbSNP
rs936798506 3820 dbSNP
rs1200134737 3826 dbSNP
rs771180998 3829 dbSNP
rs918083707 3830 dbSNP
rs868765988 3833 dbSNP
rs1365933557 3834 dbSNP
rs1168265936 3842 dbSNP
rs1371385724 3846 dbSNP
rs926811611 3849 dbSNP
rs1291574186 3858 dbSNP
rs1389696795 3859 dbSNP
rs765634110 3860 dbSNP
rs1362486872 3862 dbSNP
rs1227010221 3880 dbSNP
rs1297625403 3888 dbSNP
rs959085189 3890 dbSNP
rs186930055 3894 dbSNP
rs1218877872 3899 dbSNP
rs1264078299 3899 dbSNP
rs1488344905 3909 dbSNP
rs926411194 3915 dbSNP
rs1215728400 3916 dbSNP
rs1214903192 3931 dbSNP
rs1255433362 3944 dbSNP
rs1447791775 3948 dbSNP
rs949623236 3950 dbSNP
rs1283601860 3953 dbSNP
rs979467979 3978 dbSNP
rs972013489 3979 dbSNP
rs573932457 3987 dbSNP
rs1352728849 3991 dbSNP
rs962032500 4005 dbSNP
rs114990758 4006 dbSNP
rs1434198395 4007 dbSNP
rs1320682205 4013 dbSNP
rs1226302151 4014 dbSNP
rs984896511 4018 dbSNP
rs1321560605 4022 dbSNP
rs1234264796 4029 dbSNP
rs533924646 4031 dbSNP
rs1275377676 4040 dbSNP
rs1463938189 4053 dbSNP
rs760785382 4065 dbSNP
rs965974177 4078 dbSNP
rs375330505 4079 dbSNP
rs1007414129 4094 dbSNP
rs772351885 4101 dbSNP
rs1180408452 4105 dbSNP
rs1441097122 4114 dbSNP
rs1187614840 4116 dbSNP
rs996705825 4125 dbSNP
rs1475626169 4126 dbSNP
rs1387312517 4132 dbSNP
rs901068293 4141 dbSNP
rs1049842547 4155 dbSNP
rs995880190 4157 dbSNP
rs1009205002 4162 dbSNP
rs1346492716 4166 dbSNP
rs1399512981 4168 dbSNP
rs749049930 4178 dbSNP
rs892134617 4179 dbSNP
rs898489132 4184 dbSNP
rs1379458204 4187 dbSNP
rs1416172212 4193 dbSNP
rs566791492 4202 dbSNP
rs1327459813 4204 dbSNP
rs940260316 4204 dbSNP
rs1318872083 4205 dbSNP
rs62511576 4206 dbSNP
rs1236913290 4219 dbSNP
rs1393590615 4220 dbSNP
rs1056532646 4221 dbSNP
rs182195133 4225 dbSNP
rs1249414939 4226 dbSNP
rs769472942 4226 dbSNP
rs745858236 4235 dbSNP
rs62511575 4236 dbSNP
rs1410046710 4242 dbSNP
rs1412624803 4243 dbSNP
rs1218598046 4247 dbSNP
rs192698189 4251 dbSNP
rs1375478909 4253 dbSNP
rs756783031 4259 dbSNP
rs1436221599 4260 dbSNP
rs1241648642 4263 dbSNP
rs1213690630 4264 dbSNP
rs145256849 4265 dbSNP
rs1284851711 4274 dbSNP
rs1036580525 4275 dbSNP
rs965924085 4282 dbSNP
rs1018893158 4283 dbSNP
rs79377537 4285 dbSNP
rs953249648 4286 dbSNP
rs1348660889 4287 dbSNP
rs1027936344 4295 dbSNP
rs1234594264 4297 dbSNP
rs73243941 4311 dbSNP
rs527851736 4315 dbSNP
rs1226500239 4321 dbSNP
rs985230616 4322 dbSNP
rs1234325529 4331 dbSNP
rs1477017731 4336 dbSNP
rs1432277685 4338 dbSNP
rs1326445879 4357 dbSNP
rs1455169678 4358 dbSNP
rs1166391955 4369 dbSNP
rs1369574455 4369 dbSNP
rs187866759 4372 dbSNP
rs868424546 4377 dbSNP
rs1004187407 4378 dbSNP
rs866575909 4379 dbSNP
rs1303278070 4388 dbSNP
rs1019505560 4406 dbSNP
rs577094655 4413 dbSNP
rs1435618044 4425 dbSNP
rs956872989 4433 dbSNP
rs1184915260 4435 dbSNP
rs896703346 4439 dbSNP
rs1341725292 4443 dbSNP
rs1196562379 4444 dbSNP
rs1274881681 4445 dbSNP
rs1476439527 4447 dbSNP
rs1449632598 4450 dbSNP
rs1031991602 4452 dbSNP
rs1056650631 4455 dbSNP
rs1000961227 4459 dbSNP
rs751032248 4462 dbSNP
rs1186131682 4467 dbSNP
rs568845898 4473 dbSNP
rs905356140 4474 dbSNP
rs1044306216 4475 dbSNP
rs1169265506 4476 dbSNP
rs1422150120 4478 dbSNP
rs545669273 4482 dbSNP
rs913656380 4484 dbSNP
rs552221945 4488 dbSNP
rs909478327 4493 dbSNP
rs73243940 4497 dbSNP
rs1228489886 4499 dbSNP
rs752282877 4502 dbSNP
rs1272114442 4503 dbSNP
rs765670706 4509 dbSNP
rs1354076861 4512 dbSNP
rs1227546209 4514 dbSNP
rs1215893759 4516 dbSNP
rs931989937 4517 dbSNP
rs1339519069 4518 dbSNP
rs1206691548 4520 dbSNP
rs759793976 4524 dbSNP
rs1447051862 4530 dbSNP
rs1194972981 4532 dbSNP
rs1235367895 4541 dbSNP
rs1292085003 4543 dbSNP
rs1164663615 4544 dbSNP
rs1418974330 4545 dbSNP
rs1463494069 4556 dbSNP
rs976169345 4562 dbSNP
rs1414772295 4565 dbSNP
rs966157624 4573 dbSNP
rs1382842838 4576 dbSNP
rs953459832 4577 dbSNP
rs1027472245 4581 dbSNP
rs912394795 4582 dbSNP
rs988411348 4583 dbSNP
rs1315263258 4590 dbSNP
rs868663434 4599 dbSNP
rs1336651337 4600 dbSNP
rs973674779 4602 dbSNP
rs1449191712 4605 dbSNP
rs962802036 4607 dbSNP
rs754388959 4608 dbSNP
rs1032689152 4616 dbSNP
rs1441515957 4631 dbSNP
rs1004135111 4636 dbSNP
rs896482994 4645 dbSNP
rs1476372017 4648 dbSNP
rs1180730979 4649 dbSNP
rs1363712709 4651 dbSNP
rs183484084 4661 dbSNP
rs544423039 4662 dbSNP
rs1400100046 4664 dbSNP
rs1013285175 4665 dbSNP
rs1313683218 4665 dbSNP
rs905469942 4677 dbSNP
rs1043870017 4686 dbSNP
rs77100415 4687 dbSNP
rs1480190540 4690 dbSNP
rs1336279262 4691 dbSNP
rs1005480770 4693 dbSNP
rs1272593412 4703 dbSNP
rs1346488966 4705 dbSNP
rs760840708 4707 dbSNP
rs1282016442 4715 dbSNP
rs555867275 4720 dbSNP
rs1486890916 4727 dbSNP
rs1194442414 4728 dbSNP
rs1230924242 4730 dbSNP
rs1206215219 4740 dbSNP
rs1250209267 4743 dbSNP
rs1307698720 4745 dbSNP
rs538689993 4755 dbSNP
rs1453870341 4756 dbSNP
rs1049787556 4764 dbSNP
rs113745810 4771 dbSNP
rs1052193898 4775 dbSNP
rs533990756 4776 dbSNP
rs1230920160 4783 dbSNP
rs1333406675 4788 dbSNP
rs1396879299 4792 dbSNP
rs944476146 4796 dbSNP
rs573057780 4797 dbSNP
rs557793309 4805 dbSNP
rs1050112074 4806 dbSNP
rs944762491 4813 dbSNP
rs1304916617 4822 dbSNP
rs28481593 4823 dbSNP
rs566451913 4826 dbSNP
rs772266006 4836 dbSNP
rs1251155838 4840 dbSNP
rs987966391 4845 dbSNP
rs1198154326 4848 dbSNP
rs547123749 4850 dbSNP
rs1468387650 4856 dbSNP
rs1194340392 4860 dbSNP
rs867493391 4867 dbSNP
rs1396921024 4872 dbSNP
rs1459956563 4878 dbSNP
rs147274338 4885 dbSNP
rs1165603291 4886 dbSNP
rs1169979335 4888 dbSNP
rs1418380444 4890 dbSNP
rs962193721 4892 dbSNP
rs1405586655 4916 dbSNP
rs979759335 4919 dbSNP
rs1178699053 4920 dbSNP
rs969314585 4928 dbSNP
rs1480794478 4933 dbSNP
rs1327359748 4940 dbSNP
rs907747688 4948 dbSNP
rs1211370671 4954 dbSNP
rs1469419794 4955 dbSNP
rs1230093871 4963 dbSNP
rs991815555 4963 dbSNP
rs762161990 4967 dbSNP
rs960421187 4970 dbSNP
rs1334796603 4972 dbSNP
rs960799778 4977 dbSNP
rs1214806507 4980 dbSNP
rs1255012119 4981 dbSNP
rs535038369 4982 dbSNP
rs1484914983 4984 dbSNP
rs1014640955 4987 dbSNP
rs567837750 4987 dbSNP
rs1430463220 4989 dbSNP
rs1316819968 4993 dbSNP
rs1416836330 4994 dbSNP
rs28624458 4996 dbSNP
rs1225824547 5000 dbSNP
rs374515759 5001 dbSNP
rs1429400408 5003 dbSNP
rs996826138 5018 dbSNP
rs1022973563 5022 dbSNP
rs1011041210 5032 dbSNP
rs900785809 5042 dbSNP
rs1393886567 5043 dbSNP
rs1302957858 5049 dbSNP
rs1040382666 5050 dbSNP
rs1438931062 5051 dbSNP
rs1234481623 5053 dbSNP
rs892631052 5063 dbSNP
rs1315260352 5071 dbSNP
rs891854895 5078 dbSNP
rs1053618119 5081 dbSNP
rs1486985067 5095 dbSNP
rs1294172744 5103 dbSNP
rs1052645133 5105 dbSNP
rs1256592641 5108 dbSNP
rs1008635661 5111 dbSNP
rs1190057013 5112 dbSNP
rs1161097751 5113 dbSNP
rs1405724329 5113 dbSNP
rs1440089436 5119 dbSNP
rs769680786 5120 dbSNP
rs1159241071 5121 dbSNP
rs1050066748 5134 dbSNP
rs931641607 5147 dbSNP
rs1311863337 5153 dbSNP
rs1375292481 5164 dbSNP
rs527915176 5170 dbSNP
rs745603994 5180 dbSNP
rs1394177120 5181 dbSNP
rs1295437092 5185 dbSNP
rs1371817525 5187 dbSNP
rs561186131 5195 dbSNP
rs1455264395 5199 dbSNP
rs1318779181 5201 dbSNP
rs1253140121 5208 dbSNP
rs781141049 5217 dbSNP
rs1486089768 5220 dbSNP
rs1485864573 5227 dbSNP
rs1259472342 5242 dbSNP
rs947959735 5243 dbSNP
rs1218479122 5246 dbSNP
rs940648997 5248 dbSNP
rs143823953 5250 dbSNP
rs1172688607 5256 dbSNP
rs1280001231 5259 dbSNP
rs992648405 5262 dbSNP
rs960748189 5264 dbSNP
rs1375691713 5269 dbSNP
rs991756066 5275 dbSNP
rs928069732 5277 dbSNP
rs770790798 5281 dbSNP
rs1353098670 5282 dbSNP
rs960370447 5290 dbSNP
rs1373436018 5292 dbSNP
rs1299240794 5301 dbSNP
rs980758986 5307 dbSNP
rs9298026 5308 dbSNP
rs1232202999 5310 dbSNP
rs1302680977 5311 dbSNP
rs1348912256 5314 dbSNP
rs1236717133 5320 dbSNP
rs1022329567 5323 dbSNP
rs1436980565 5328 dbSNP
rs1359881135 5331 dbSNP
rs1011572681 5338 dbSNP
rs1205212058 5340 dbSNP
rs1234517197 5351 dbSNP
rs191627093 5356 dbSNP
rs10106120 5357 dbSNP
rs1028226192 5358 dbSNP
rs752438911 5362 dbSNP
rs1165762209 5364 dbSNP
rs1417895874 5366 dbSNP
rs1409734262 5369 dbSNP
rs1171492854 5377 dbSNP
rs1403087904 5378 dbSNP
rs1439290766 5384 dbSNP
rs1325324390 5394 dbSNP
rs1371784330 5399 dbSNP
rs544636599 5406 dbSNP
rs1268637223 5407 dbSNP
rs1338574780 5410 dbSNP
rs964933526 5411 dbSNP
rs1274776286 5412 dbSNP
rs10216890 5415 dbSNP
rs11989581 5416 dbSNP
rs1253126932 5421 dbSNP
rs1191918236 5422 dbSNP
rs1190649363 5426 dbSNP
rs1241168239 5430 dbSNP
rs891803135 5440 dbSNP
rs1426162350 5454 dbSNP
rs1460378884 5457 dbSNP
rs186447106 5479 dbSNP
rs10216889 5480 dbSNP
rs557923443 5492 dbSNP
rs545639098 5495 dbSNP
rs940598294 5499 dbSNP
rs1316242331 5509 dbSNP
rs28537913 5517 dbSNP
rs904635074 5518 dbSNP
rs1056868678 5519 dbSNP
rs1279884127 5519 dbSNP
rs938522760 5526 dbSNP
rs183124763 5540 dbSNP
rs928037830 5541 dbSNP
rs981256271 5543 dbSNP
rs1350400238 5551 dbSNP
rs1256829073 5553 dbSNP
rs1226885236 5556 dbSNP
rs1056314023 5560 dbSNP
rs190037121 5563 dbSNP
rs1400587056 5570 dbSNP
rs915211618 5576 dbSNP
rs1474431140 5577 dbSNP
rs11989538 5588 dbSNP
rs983168943 5594 dbSNP
rs1416551920 5596 dbSNP
rs956916332 5601 dbSNP
rs1310916665 5603 dbSNP
rs1205248291 5606 dbSNP
rs1401554089 5607 dbSNP
rs951871428 5607 dbSNP
rs1343905967 5608 dbSNP
rs1373459977 5608 dbSNP
rs761321698 5612 dbSNP
rs1293607808 5615 dbSNP
rs974876248 5620 dbSNP
rs1236730302 5638 dbSNP
rs1278489183 5646 dbSNP
rs1416375972 5663 dbSNP
rs1031278369 5667 dbSNP
rs1350721359 5667 dbSNP
rs552679690 5676 dbSNP
rs1210626774 5696 dbSNP
rs375075938 5701 dbSNP
rs1444659404 5706 dbSNP
rs987602898 5716 dbSNP
rs954848747 5722 dbSNP
rs1019167158 5731 dbSNP
rs534411007 5732 dbSNP
rs996308064 5737 dbSNP
rs898943443 5754 dbSNP
rs185179363 5757 dbSNP
rs551963204 5760 dbSNP
rs904581856 5760 dbSNP
rs180823545 5762 dbSNP
rs1335897925 5767 dbSNP
rs1389641449 5767 dbSNP
rs144891609 5767 dbSNP
rs1186356721 5790 dbSNP
rs1300546667 5792 dbSNP
rs1056986196 5793 dbSNP
rs1346743664 5798 dbSNP
rs1234509615 5801 dbSNP
rs1257005831 5802 dbSNP
rs569545963 5808 dbSNP
rs1257250625 5809 dbSNP
rs551277510 5810 dbSNP
rs144827319 5812 dbSNP
rs1479765857 5820 dbSNP
rs1253187001 5823 dbSNP
rs1458551988 5825 dbSNP
rs1044260633 5826 dbSNP
rs28549858 5827 dbSNP
rs1454033800 5829 dbSNP
rs1291379193 5833 dbSNP
rs907810820 5847 dbSNP
rs1047828083 5848 dbSNP
rs1235020136 5851 dbSNP
rs1397135908 5853 dbSNP
rs930336514 5857 dbSNP
rs920302191 5862 dbSNP
rs540769341 5863 dbSNP
rs915343842 5866 dbSNP
rs1302951494 5869 dbSNP
rs1305342126 5873 dbSNP
rs371421267 5878 dbSNP
rs1251066972 5881 dbSNP
rs974491460 5886 dbSNP
rs935323088 5888 dbSNP
rs1271389770 5901 dbSNP
rs912055699 5902 dbSNP
rs867776937 5904 dbSNP
rs987666349 5905 dbSNP
rs1398186118 5909 dbSNP
rs1426897772 5911 dbSNP
rs761777048 5914 dbSNP
rs1460480880 5917 dbSNP
rs1414938362 5937 dbSNP
rs956470950 5941 dbSNP
rs564377000 5946 dbSNP
rs1393184589 5951 dbSNP
rs979137097 5959 dbSNP
rs546001772 5961 dbSNP
rs1359467196 5971 dbSNP
rs1022961426 5978 dbSNP
rs955004562 5985 dbSNP
rs1341484301 5986 dbSNP
rs1369452914 5993 dbSNP
rs1271805990 5997 dbSNP
rs1181492705 6001 dbSNP
rs574671065 6007 dbSNP
rs1240247059 6024 dbSNP
rs1222413406 6025 dbSNP
rs1267262225 6027 dbSNP
rs1485030516 6029 dbSNP
rs1195315639 6030 dbSNP
rs1029562340 6031 dbSNP
rs974951049 6036 dbSNP
rs575312339 6037 dbSNP
rs189486123 6051 dbSNP
rs1478677970 6066 dbSNP
rs1185791341 6071 dbSNP
rs1417083867 6085 dbSNP
rs1424283773 6108 dbSNP
rs1271298618 6112 dbSNP
rs895935282 6126 dbSNP
rs1452651904 6129 dbSNP
rs1004472459 6132 dbSNP
rs1289080113 6136 dbSNP
rs1361635216 6139 dbSNP
rs950380010 6153 dbSNP
rs1034800141 6161 dbSNP
rs1211618611 6179 dbSNP
rs1003398863 6183 dbSNP
rs774657945 6193 dbSNP
rs1278808161 6194 dbSNP
rs1002727233 6195 dbSNP
rs886328872 6198 dbSNP
rs1286995894 6210 dbSNP
rs1489355040 6216 dbSNP
rs1236599689 6220 dbSNP
rs1256479754 6221 dbSNP
rs541700064 6229 dbSNP
rs1337253969 6236 dbSNP
rs149440632 6238 dbSNP
rs764185482 6239 dbSNP
rs930263986 6245 dbSNP
rs1158658801 6250 dbSNP
rs1439660570 6253 dbSNP
rs759383126 6260 dbSNP
rs898827380 6260 dbSNP
rs554833679 6265 dbSNP
rs1432440831 6278 dbSNP
rs138953862 6279 dbSNP
rs1375202099 6286 dbSNP
rs145095484 6296 dbSNP
rs1305109092 6302 dbSNP
rs1392076591 6305 dbSNP
rs1223305850 6307 dbSNP
rs943085788 6308 dbSNP
rs1356151716 6313 dbSNP
rs1158410897 6318 dbSNP
rs1232339729 6324 dbSNP
rs570533450 6331 dbSNP
rs1452097141 6332 dbSNP
rs911667066 6333 dbSNP
rs186099161 6340 dbSNP
rs540056106 6341 dbSNP
rs142962346 6342 dbSNP
rs551340967 6345 dbSNP
rs1172598368 6346 dbSNP
rs934858746 6347 dbSNP