miRTarBase - #MIRT558041 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EXT1   
Description exostosin glycosyltransferase 1
Transcript NM_000127   
Putative miRNA Targets on EXT1
3'UTR of EXT1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
miRNA  3' guguuugguaauacaCGACGAu 5'
Target 5' agggatgggggtcaaGCTGCTc 3'
34 - 55 120.00 -9.20
            :|||: ||||    ||   || :|||| 
256 - 285 110.00 -7.10
miRNA  3' guguuugguaauacacGACGAu 5'
Target 5' ctgggactgcaccagaCTGCTc 3'
172 - 193 100.00 -11.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
361652 82 ClinVar
1190764 145 ClinVar
361651 146 ClinVar
361650 151 ClinVar
910868 182 ClinVar
COSN30159757 2 COSMIC
COSN30478952 12 COSMIC
COSN30447344 16 COSMIC
COSN30110380 36 COSMIC
COSN30509068 36 COSMIC
COSN31488650 59 COSMIC
COSN30169534 62 COSMIC
COSN30510636 74 COSMIC
COSN30501560 84 COSMIC
COSN30538830 87 COSMIC
COSN30459466 108 COSMIC
COSN31558101 111 COSMIC
COSN1358499 134 COSMIC
COSN20046199 134 COSMIC
COSN30152496 134 COSMIC
COSN30587523 134 COSMIC
COSN31591321 147 COSMIC
COSN30132623 154 COSMIC
COSN8061628 227 COSMIC
COSN31513748 256 COSMIC
COSN5108028 528 COSMIC
COSN27445365 1296 COSMIC
COSN32116278 1344 COSMIC
COSN18905324 2146 COSMIC
COSN9253712 2224 COSMIC
COSN28204964 2461 COSMIC
COSN6909112 2871 COSMIC
COSN2527904 2876 COSMIC
COSN32065201 2945 COSMIC
COSN22364706 3033 COSMIC
COSN9593177 3082 COSMIC
COSN29892322 3356 COSMIC
COSN8061627 3494 COSMIC
COSN8061626 3495 COSMIC
COSN32065200 3854 COSMIC
COSN6909111 4056 COSMIC
COSN17473507 4141 COSMIC
COSN23887468 4215 COSMIC
COSN19181728 4274 COSMIC
COSN32224946 4571 COSMIC
COSN9253711 4621 COSMIC
COSN17080024 4654 COSMIC
COSN9593176 4868 COSMIC
COSN17384661 5010 COSMIC
COSN27806194 5022 COSMIC
COSN6909110 5118 COSMIC
COSN29645598 5182 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1218434124 5 dbSNP
rs367817136 7 dbSNP
rs139405485 8 dbSNP
rs1408847478 8 dbSNP
rs1017361205 11 dbSNP
rs534749250 16 dbSNP
rs771143144 19 dbSNP
rs1157217041 21 dbSNP
rs747404172 22 dbSNP
rs776405618 26 dbSNP
rs954427122 26 dbSNP
rs570848707 28 dbSNP
rs1365815141 32 dbSNP
rs1272109113 37 dbSNP
rs552255048 38 dbSNP
rs1009473848 39 dbSNP
rs376941234 41 dbSNP
rs779006422 43 dbSNP
rs539757640 44 dbSNP
rs373797260 45 dbSNP
rs770608930 45 dbSNP
rs766314308 48 dbSNP
rs760316025 49 dbSNP
rs1335428341 55 dbSNP
rs1214158424 63 dbSNP
rs1032099532 72 dbSNP
rs1260010738 77 dbSNP
rs895566910 81 dbSNP
rs886062635 82 dbSNP
rs1475361448 89 dbSNP
rs1469699037 103 dbSNP
rs1175554836 108 dbSNP
rs1420416215 110 dbSNP
rs1416305673 125 dbSNP
rs1318566419 127 dbSNP
rs1307398759 130 dbSNP
rs1447855648 131 dbSNP
rs1164702684 132 dbSNP
rs79239764 133 dbSNP
rs79380712 134 dbSNP
rs1330159513 135 dbSNP
rs1335618382 138 dbSNP
rs905249062 139 dbSNP
rs1443108520 140 dbSNP
rs905788820 144 dbSNP
rs1197265227 145 dbSNP
rs1332433373 145 dbSNP
rs1480552734 145 dbSNP
rs71739430 145 dbSNP
rs886062634 146 dbSNP
rs1437154563 147 dbSNP
rs931212857 148 dbSNP
rs1239249198 149 dbSNP
rs1475551141 150 dbSNP
rs751063786 151 dbSNP
rs972706172 154 dbSNP
rs1452253381 161 dbSNP
rs949394800 182 dbSNP
rs1168847747 185 dbSNP
rs569038252 186 dbSNP
rs1365954497 192 dbSNP
rs986043205 196 dbSNP
rs1336672830 202 dbSNP
rs550800616 209 dbSNP
rs1414806088 211 dbSNP
rs896514576 226 dbSNP
rs1047334250 237 dbSNP
rs1159607781 240 dbSNP
rs979707618 255 dbSNP
rs1270532898 278 dbSNP
rs1338717045 281 dbSNP
rs966946247 283 dbSNP
rs930250167 292 dbSNP
rs1486046254 293 dbSNP
rs1210168996 295 dbSNP
rs920177636 300 dbSNP
rs1255753866 346 dbSNP
rs1448942008 348 dbSNP
rs1194403108 357 dbSNP
rs1009868849 379 dbSNP
rs1174842840 381 dbSNP
rs974611614 399 dbSNP
rs144446248 401 dbSNP
rs1035417732 405 dbSNP
rs1434872527 405 dbSNP
rs1373292971 406 dbSNP
rs910276522 408 dbSNP
rs1194966045 411 dbSNP
rs561816740 414 dbSNP
rs767383541 415 dbSNP
rs905719580 427 dbSNP
rs111348774 433 dbSNP
rs1278254915 437 dbSNP
rs1353158845 439 dbSNP
rs1205967545 440 dbSNP
rs1261231030 445 dbSNP
rs536418133 450 dbSNP
rs1029993332 451 dbSNP
rs764616466 454 dbSNP
rs1454204938 456 dbSNP
rs1172524351 460 dbSNP
rs528157061 463 dbSNP
rs1375463170 471 dbSNP
rs1454844340 478 dbSNP
rs1272669530 479 dbSNP
rs1158796349 499 dbSNP
rs567852709 500 dbSNP
rs1236753456 504 dbSNP
rs1380379499 506 dbSNP
rs370679586 518 dbSNP
rs1327653846 522 dbSNP
rs1371705109 523 dbSNP
rs1440042089 524 dbSNP
rs1301110487 526 dbSNP
rs1337625824 529 dbSNP
rs146852675 531 dbSNP
rs545459686 547 dbSNP
rs1215992807 549 dbSNP
rs1348791754 549 dbSNP
rs932713573 552 dbSNP
rs925474442 553 dbSNP
rs188472207 562 dbSNP
rs969271411 566 dbSNP
rs548069105 567 dbSNP
rs1362923810 570 dbSNP
rs1455299181 579 dbSNP
rs966956035 584 dbSNP
rs914125108 591 dbSNP
rs1013703194 592 dbSNP
rs959709612 598 dbSNP
rs149676910 602 dbSNP
rs1306353689 609 dbSNP
rs1047056836 615 dbSNP
rs1190332693 616 dbSNP
rs1430264779 623 dbSNP
rs1035747797 624 dbSNP
rs1263725538 634 dbSNP
rs765696637 637 dbSNP
rs1334631050 638 dbSNP
rs1212142281 666 dbSNP
rs542076070 667 dbSNP
rs1253669035 668 dbSNP
rs1001321349 670 dbSNP
rs1195925997 671 dbSNP
rs970208277 672 dbSNP
rs1471302272 676 dbSNP
rs994176504 677 dbSNP
rs139984616 685 dbSNP
rs1474795973 686 dbSNP
rs150700525 688 dbSNP
rs1282190867 689 dbSNP
rs1038634210 690 dbSNP
rs183787391 692 dbSNP
rs756470596 693 dbSNP
rs1313724946 694 dbSNP
rs1355060376 694 dbSNP
rs549683867 694 dbSNP
rs1269697707 697 dbSNP
rs1036884012 699 dbSNP
rs1227384458 701 dbSNP
rs1308642337 701 dbSNP
rs1050596671 707 dbSNP
rs1250074817 710 dbSNP
rs753068957 721 dbSNP
rs891154730 723 dbSNP
rs1257857704 725 dbSNP
rs1050182715 727 dbSNP
rs923034866 729 dbSNP
rs932793318 736 dbSNP
rs1279330027 737 dbSNP
rs1421423906 738 dbSNP
rs1428840180 742 dbSNP
rs987739540 743 dbSNP
rs1169669540 757 dbSNP
rs1414695786 757 dbSNP
rs1354035604 759 dbSNP
rs1436740701 770 dbSNP
rs73318268 773 dbSNP
rs1375124331 775 dbSNP
rs759822532 780 dbSNP
rs979400461 784 dbSNP
rs1395265370 791 dbSNP
rs1165652469 798 dbSNP
rs1290814543 798 dbSNP
rs1363119751 815 dbSNP
rs969616460 825 dbSNP
rs1296131672 827 dbSNP
rs1463017988 830 dbSNP
rs1350663482 832 dbSNP
rs1280376800 835 dbSNP
rs1023505700 836 dbSNP
rs1187215125 838 dbSNP
rs1243428103 839 dbSNP
rs1474166999 839 dbSNP
rs558941321 841 dbSNP
rs867837611 842 dbSNP
rs1025746205 843 dbSNP
rs914176609 844 dbSNP
rs751550311 852 dbSNP
rs1174385267 853 dbSNP
rs766448948 859 dbSNP
rs1394589858 864 dbSNP
rs1412785772 873 dbSNP
rs537050247 874 dbSNP
rs1194166493 876 dbSNP
rs565679334 879 dbSNP
rs1039019298 883 dbSNP
rs1318928971 885 dbSNP
rs1258794793 887 dbSNP
rs569174458 904 dbSNP
rs928355852 906 dbSNP
rs1007182511 913 dbSNP
rs1333263428 924 dbSNP
rs1366304283 926 dbSNP
rs552233830 931 dbSNP
rs1280061486 945 dbSNP
rs773267360 946 dbSNP
rs1317128920 947 dbSNP
rs934177154 957 dbSNP
rs1334815447 960 dbSNP
rs1326510145 962 dbSNP
rs1469618018 964 dbSNP
rs1194210965 965 dbSNP
rs969786259 972 dbSNP
rs1477084707 974 dbSNP
rs1179010965 987 dbSNP
rs776922031 992 dbSNP
rs1418688492 994 dbSNP
rs1157163541 997 dbSNP
rs1400442037 999 dbSNP
rs769918528 1004 dbSNP
rs923002143 1006 dbSNP
rs1325824484 1011 dbSNP
rs1052162218 1013 dbSNP
rs535717484 1020 dbSNP
rs925004204 1021 dbSNP
rs1163553818 1022 dbSNP
rs761634131 1028 dbSNP
rs1459832300 1036 dbSNP
rs114591177 1038 dbSNP
rs969291291 1039 dbSNP
rs961216241 1040 dbSNP
rs1015365787 1044 dbSNP
rs1230952804 1048 dbSNP
rs1289131167 1049 dbSNP
rs1449773018 1051 dbSNP
rs1180016321 1066 dbSNP
rs1459237220 1067 dbSNP
rs532231851 1068 dbSNP
rs891033000 1073 dbSNP
rs528215579 1076 dbSNP
rs771307418 1080 dbSNP
rs564022010 1083 dbSNP
rs1229377630 1086 dbSNP
rs1025715226 1087 dbSNP
rs903954946 1088 dbSNP
rs200281543 1093 dbSNP
rs746643235 1093 dbSNP
rs945424950 1103 dbSNP
rs11778935 1115 dbSNP
rs1408627874 1126 dbSNP
rs180703054 1128 dbSNP
rs1356971189 1130 dbSNP
rs1241932614 1131 dbSNP
rs1007312351 1138 dbSNP
rs939620742 1140 dbSNP
rs1377118341 1145 dbSNP
rs926833144 1150 dbSNP
rs1216278154 1164 dbSNP
rs1273552406 1169 dbSNP
rs890016786 1172 dbSNP
rs1030348090 1178 dbSNP
rs369016901 1182 dbSNP
rs1486110913 1183 dbSNP
rs998293604 1185 dbSNP
rs1236121058 1187 dbSNP
rs1351562303 1197 dbSNP
rs1169014571 1198 dbSNP
rs1324194097 1201 dbSNP
rs1400038882 1203 dbSNP
rs1428623745 1205 dbSNP
rs1166147014 1210 dbSNP
rs11775019 1240 dbSNP
rs1415049923 1255 dbSNP
rs1333035203 1261 dbSNP
rs1338496823 1270 dbSNP
rs1160068484 1275 dbSNP
rs1441806583 1287 dbSNP
rs1381075697 1288 dbSNP
rs745452535 1289 dbSNP
rs1467240465 1290 dbSNP
rs1270763271 1293 dbSNP
rs1248521890 1294 dbSNP
rs1222995138 1295 dbSNP
rs1446907539 1296 dbSNP
rs1282623011 1297 dbSNP
rs11775016 1304 dbSNP
rs1409254060 1307 dbSNP
rs546398058 1307 dbSNP
rs1254272128 1308 dbSNP
rs1353979103 1308 dbSNP
rs541166746 1310 dbSNP
rs903601031 1311 dbSNP
rs574758275 1314 dbSNP
rs1248013611 1322 dbSNP
rs1302167625 1322 dbSNP
rs1231609853 1332 dbSNP
rs1396385040 1333 dbSNP
rs987001676 1333 dbSNP
rs1434733554 1334 dbSNP
rs6988932 1339 dbSNP
rs879150208 1344 dbSNP
rs377206369 1347 dbSNP
rs753007505 1354 dbSNP
rs1318698008 1358 dbSNP
rs541207600 1385 dbSNP
rs1364429033 1389 dbSNP
rs189538341 1389 dbSNP
rs755334919 1405 dbSNP
rs992099499 1406 dbSNP
rs939159873 1408 dbSNP
rs1022292612 1416 dbSNP
rs185454824 1421 dbSNP
rs1343317371 1425 dbSNP
rs918462803 1426 dbSNP
rs1254555061 1431 dbSNP
rs1299807755 1435 dbSNP
rs1009690559 1437 dbSNP
rs11785084 1443 dbSNP
rs1267927706 1445 dbSNP
rs766566862 1449 dbSNP
rs1452775181 1453 dbSNP
rs755847029 1455 dbSNP
rs1216111761 1471 dbSNP
rs1469936559 1480 dbSNP
rs939486072 1487 dbSNP
rs1004586585 1504 dbSNP
rs1197529333 1514 dbSNP
rs962793669 1521 dbSNP
rs1375620828 1522 dbSNP
rs1470943391 1524 dbSNP
rs1159396858 1527 dbSNP
rs576378815 1528 dbSNP
rs1427410830 1538 dbSNP
rs1455395768 1549 dbSNP
rs1045750140 1563 dbSNP
rs1395120731 1569 dbSNP
rs758499802 1582 dbSNP
rs554965475 1583 dbSNP
rs985456074 1585 dbSNP
rs1475392021 1590 dbSNP
rs750534547 1591 dbSNP
rs1287899589 1598 dbSNP
rs141937592 1600 dbSNP
rs765217147 1603 dbSNP
rs117136137 1607 dbSNP
rs558513085 1610 dbSNP
rs113168389 1611 dbSNP
rs939774797 1615 dbSNP
rs1182471830 1617 dbSNP
rs908256296 1617 dbSNP
rs1031760126 1622 dbSNP
rs955363495 1626 dbSNP
rs545316153 1646 dbSNP
rs975356431 1647 dbSNP
rs756927786 1658 dbSNP
rs193184758 1659 dbSNP
rs1398743511 1663 dbSNP
rs947727588 1666 dbSNP
rs940731384 1668 dbSNP
rs115012705 1671 dbSNP
rs1310821169 1685 dbSNP
rs1009535706 1698 dbSNP
rs1235582785 1700 dbSNP
rs763928861 1702 dbSNP
rs892563241 1703 dbSNP
rs530600505 1713 dbSNP
rs1321459449 1721 dbSNP
rs1243285728 1727 dbSNP
rs1464752111 1728 dbSNP
rs1253542400 1730 dbSNP
rs1361071198 1745 dbSNP
rs569326137 1756 dbSNP
rs1340870894 1757 dbSNP
rs1176889471 1764 dbSNP
rs1205249490 1766 dbSNP
rs544967426 1767 dbSNP
rs775207744 1768 dbSNP
rs905386396 1773 dbSNP
rs1421560315 1781 dbSNP
rs939211977 1782 dbSNP
rs1478418605 1787 dbSNP
rs1430544095 1797 dbSNP
rs1168008990 1798 dbSNP
rs138428999 1799 dbSNP
rs751277810 1809 dbSNP
rs576406089 1818 dbSNP
rs559617731 1819 dbSNP
rs1378923031 1825 dbSNP
rs745328316 1828 dbSNP
rs899383276 1841 dbSNP
rs1308586738 1844 dbSNP
rs541652431 1856 dbSNP
rs866748953 1865 dbSNP
rs939661332 1866 dbSNP
rs1256153518 1867 dbSNP
rs954062315 1875 dbSNP
rs1482842904 1884 dbSNP
rs1179885410 1886 dbSNP
rs1305323709 1890 dbSNP
rs189931942 1897 dbSNP
rs922641606 1901 dbSNP
rs976722611 1903 dbSNP
rs1051315086 1923 dbSNP
rs1219223844 1929 dbSNP
rs956256157 1931 dbSNP
rs565433579 1937 dbSNP
rs1177067117 1938 dbSNP
rs1358801578 1953 dbSNP
rs1464909939 1957 dbSNP
rs543565871 1960 dbSNP
rs1000344497 1965 dbSNP
rs975242786 1972 dbSNP
rs1291242936 1981 dbSNP
rs1284758082 1984 dbSNP
rs969315282 1990 dbSNP
rs1235844274 1991 dbSNP
rs1301612250 1998 dbSNP
rs1397491535 2007 dbSNP
rs570661480 2009 dbSNP
rs1381633158 2033 dbSNP
rs866352335 2035 dbSNP
rs185039146 2043 dbSNP
rs967961492 2045 dbSNP
rs555956690 2046 dbSNP
rs146325415 2048 dbSNP
rs1455692059 2053 dbSNP
rs1056110650 2056 dbSNP
rs574824557 2063 dbSNP
rs1191836744 2075 dbSNP
rs1172885787 2093 dbSNP
rs1161505065 2096 dbSNP
rs1003224268 2105 dbSNP
rs1456982079 2112 dbSNP
rs1319214578 2116 dbSNP
rs897053456 2127 dbSNP
rs1397307846 2133 dbSNP
rs191658668 2139 dbSNP
rs10955831 2146 dbSNP
rs941192955 2149 dbSNP
rs1163133608 2153 dbSNP
rs1366236561 2153 dbSNP
rs909743241 2159 dbSNP
rs1049832292 2160 dbSNP
rs1329612796 2164 dbSNP
rs1004068256 2168 dbSNP
rs1266230674 2171 dbSNP
rs1469747663 2173 dbSNP
rs1222455638 2182 dbSNP
rs1176307113 2196 dbSNP
rs969494595 2201 dbSNP
rs112873486 2204 dbSNP
rs1239487495 2209 dbSNP
rs1198679626 2210 dbSNP
rs1467980180 2216 dbSNP
rs993378006 2217 dbSNP
rs994929452 2218 dbSNP
rs1157368309 2226 dbSNP
rs1420698607 2242 dbSNP
rs922695154 2249 dbSNP
rs1323416980 2253 dbSNP
rs899438967 2258 dbSNP
rs1433595882 2259 dbSNP
rs976691453 2266 dbSNP
rs1322177787 2269 dbSNP
rs1309543962 2270 dbSNP
rs558684550 2279 dbSNP
rs1223484437 2282 dbSNP
rs536780114 2283 dbSNP
rs1005075462 2286 dbSNP
rs1228844021 2300 dbSNP
rs1320064998 2307 dbSNP
rs1207364670 2309 dbSNP
rs753135236 2312 dbSNP
rs1252873612 2314 dbSNP
rs1333485230 2314 dbSNP
rs1180233860 2318 dbSNP
rs1260075051 2326 dbSNP
rs1473295991 2332 dbSNP
rs886806401 2335 dbSNP
rs569391049 2336 dbSNP
rs36123499 2339 dbSNP
rs142047258 2342 dbSNP
rs920985059 2346 dbSNP
rs1169918925 2349 dbSNP
rs1292357009 2352 dbSNP
rs748620158 2353 dbSNP
rs1428740474 2357 dbSNP
rs1023516684 2366 dbSNP
rs1305745339 2370 dbSNP
rs1013092833 2372 dbSNP
rs1039569715 2375 dbSNP
rs1448472173 2378 dbSNP
rs959083072 2390 dbSNP
rs1283582619 2396 dbSNP
rs946508549 2408 dbSNP
rs565298944 2415 dbSNP
rs547780769 2416 dbSNP
rs1286748074 2420 dbSNP
rs186829498 2426 dbSNP
rs1203295310 2430 dbSNP
rs1280917419 2432 dbSNP
rs554455118 2434 dbSNP
rs1443423422 2441 dbSNP
rs182224215 2447 dbSNP
rs1236288495 2452 dbSNP
rs1036945147 2455 dbSNP
rs6983422 2456 dbSNP
rs982093462 2457 dbSNP
rs888370296 2460 dbSNP
rs1049990980 2467 dbSNP
rs1390277345 2467 dbSNP
rs1166397963 2479 dbSNP
rs1211608131 2483 dbSNP
rs932512977 2484 dbSNP
rs138791424 2487 dbSNP
rs1414873724 2490 dbSNP
rs561358371 2512 dbSNP
rs1333224196 2513 dbSNP
rs1023648788 2520 dbSNP
rs1437211331 2521 dbSNP
rs1041133620 2522 dbSNP
rs1259952213 2523 dbSNP
rs543102879 2541 dbSNP
rs143234224 2543 dbSNP
rs924648539 2544 dbSNP
rs1226272478 2545 dbSNP
rs112592745 2546 dbSNP
rs947592604 2547 dbSNP
rs1311669564 2552 dbSNP
rs1241139128 2560 dbSNP
rs1466491313 2566 dbSNP
rs916179537 2570 dbSNP
rs1209922818 2571 dbSNP
rs992044343 2580 dbSNP
rs960221019 2581 dbSNP
rs1160846134 2595 dbSNP
rs867704399 2600 dbSNP
rs1034756589 2624 dbSNP
rs890712271 2627 dbSNP
rs149145225 2637 dbSNP
rs1299251559 2639 dbSNP
rs1379047754 2651 dbSNP
rs1029745663 2655 dbSNP
rs1171583418 2667 dbSNP
rs138634968 2668 dbSNP
rs997829412 2669 dbSNP
rs899601536 2670 dbSNP
rs1039495752 2672 dbSNP
rs1387805431 2673 dbSNP
rs1433056788 2673 dbSNP
rs1325577865 2683 dbSNP
rs1331718545 2689 dbSNP
rs1288659482 2695 dbSNP
rs558500051 2696 dbSNP
rs893677778 2702 dbSNP
rs1331667241 2703 dbSNP
rs1418193109 2705 dbSNP
rs1433356427 2706 dbSNP
rs1463910772 2711 dbSNP
rs1015634791 2713 dbSNP
rs116969898 2717 dbSNP
rs113540172 2718 dbSNP
rs948058243 2719 dbSNP
rs1426763533 2721 dbSNP
rs1473485144 2726 dbSNP
rs1159601617 2735 dbSNP
rs916564900 2742 dbSNP
rs760774922 2743 dbSNP
rs1200315844 2746 dbSNP
rs996615972 2757 dbSNP
rs1015086074 2763 dbSNP
rs191144782 2785 dbSNP
rs1041100528 2787 dbSNP
rs1191258592 2809 dbSNP
rs1352536653 2821 dbSNP
rs1410868991 2827 dbSNP
rs1288147498 2837 dbSNP
rs1489184863 2844 dbSNP
rs955138040 2845 dbSNP
rs1286424018 2846 dbSNP
rs150170359 2848 dbSNP
rs529841518 2853 dbSNP
rs1254366356 2854 dbSNP
rs1235425954 2865 dbSNP
rs189140772 2871 dbSNP
rs1266395182 2872 dbSNP
rs142137532 2882 dbSNP
rs1182400790 2885 dbSNP
rs1250830989 2895 dbSNP
rs1417027720 2904 dbSNP
rs1189545108 2912 dbSNP
rs1368984014 2918 dbSNP
rs757459593 2926 dbSNP
rs1457522501 2939 dbSNP
rs1398690319 2957 dbSNP
rs538989741 2968 dbSNP
rs571904846 2969 dbSNP
rs893519286 2970 dbSNP
rs1052704543 2971 dbSNP
rs1398151067 2980 dbSNP
rs935149312 2990 dbSNP
rs1340374657 2993 dbSNP
rs1243485653 2994 dbSNP
rs906462329 2995 dbSNP
rs1433740781 3005 dbSNP
rs938826003 3008 dbSNP
rs928829735 3016 dbSNP
rs753812211 3017 dbSNP
rs550146913 3024 dbSNP
rs1183368335 3034 dbSNP
rs1466056799 3038 dbSNP
rs1371990102 3040 dbSNP
rs1256823824 3041 dbSNP
rs1423203416 3045 dbSNP
rs1168490794 3046 dbSNP
rs1181622533 3046 dbSNP
rs1478747505 3048 dbSNP
rs1392111816 3053 dbSNP
rs916617214 3054 dbSNP
rs1352965802 3055 dbSNP
rs552067034 3055 dbSNP
rs76422012 3055 dbSNP
rs10113582 3058 dbSNP
rs760447992 3064 dbSNP
rs78323809 3068 dbSNP
rs942122617 3071 dbSNP
rs1401896676 3078 dbSNP
rs907931841 3080 dbSNP
rs1300372799 3082 dbSNP
rs1442064023 3083 dbSNP
rs1254270602 3089 dbSNP
rs1296493274 3096 dbSNP
rs984167740 3101 dbSNP
rs954924469 3103 dbSNP
rs952434431 3114 dbSNP
rs1202381050 3119 dbSNP
rs1028644726 3120 dbSNP
rs1345886855 3121 dbSNP
rs1201694845 3123 dbSNP
rs996753324 3125 dbSNP
rs1257472298 3127 dbSNP
rs1217391504 3131 dbSNP
rs183781746 3137 dbSNP
rs1019373169 3138 dbSNP
rs1279236430 3142 dbSNP
rs1414504687 3147 dbSNP
rs1435164393 3153 dbSNP
rs139376714 3156 dbSNP
rs1377437716 3177 dbSNP
rs1335830392 3178 dbSNP
rs1323222242 3184 dbSNP
rs1396250591 3186 dbSNP
rs1017953338 3195 dbSNP
rs1395221806 3197 dbSNP
rs1010541167 3205 dbSNP
rs879418259 3208 dbSNP
rs957785860 3224 dbSNP
rs1328621591 3225 dbSNP
rs998660063 3227 dbSNP
rs1301447301 3230 dbSNP
rs906397872 3231 dbSNP
rs1221451735 3233 dbSNP
rs761966610 3234 dbSNP
rs903244443 3244 dbSNP
rs1465265954 3246 dbSNP
rs1471716924 3250 dbSNP
rs1207991043 3265 dbSNP
rs1369947456 3274 dbSNP
rs767153989 3277 dbSNP
rs1191999198 3282 dbSNP
rs1491565219 3289 dbSNP
rs200981628 3290 dbSNP
rs947363788 3290 dbSNP
rs1413401150 3305 dbSNP
rs759221086 3309 dbSNP
rs1342926895 3312 dbSNP
rs1437982334 3314 dbSNP
rs1037674465 3316 dbSNP
rs1259208095 3322 dbSNP
rs1228226695 3334 dbSNP
rs1402914305 3335 dbSNP
rs942008022 3335 dbSNP
rs1329545495 3336 dbSNP
rs1223159478 3337 dbSNP
rs1354730002 3338 dbSNP
rs1056058029 3339 dbSNP
rs1323655084 3339 dbSNP
rs938877978 3341 dbSNP
rs1265136617 3346 dbSNP
rs1489912972 3347 dbSNP
rs928877116 3348 dbSNP
rs1176049621 3349 dbSNP
rs1472428272 3349 dbSNP
rs1036500958 3350 dbSNP
rs1375616187 3351 dbSNP
rs11353657 3353 dbSNP
rs1164825084 3353 dbSNP
rs1277766613 3353 dbSNP
rs1364362371 3353 dbSNP
rs1422388014 3353 dbSNP
rs796165188 3353 dbSNP
rs940886373 3353 dbSNP
rs1381231648 3354 dbSNP
rs1229006236 3355 dbSNP
rs1235011680 3356 dbSNP
rs1328728276 3359 dbSNP
rs908269144 3365 dbSNP
rs1313404310 3374 dbSNP
rs1357295662 3383 dbSNP
rs1448290256 3384 dbSNP
rs4876390 3385 dbSNP
rs1325185975 3386 dbSNP
rs952474197 3392 dbSNP
rs1275610772 3398 dbSNP
rs1437670524 3398 dbSNP
rs1202839802 3399 dbSNP
rs4876389 3401 dbSNP
rs975274744 3406 dbSNP
rs964964713 3411 dbSNP
rs560319736 3435 dbSNP
rs1442168961 3441 dbSNP
rs1170164491 3444 dbSNP
rs1163564543 3452 dbSNP
rs975051429 3456 dbSNP
rs545365115 3461 dbSNP
rs1326573948 3464 dbSNP
rs1360646325 3478 dbSNP
rs577112164 3479 dbSNP
rs1448683532 3498 dbSNP
rs1314206766 3502 dbSNP
rs565177613 3503 dbSNP
rs544906494 3505 dbSNP
rs1230677783 3510 dbSNP
rs748857219 3512 dbSNP
rs1338947472 3516 dbSNP
rs957716509 3518 dbSNP
rs1031073481 3519 dbSNP
rs543275238 3522 dbSNP
rs1203592445 3553 dbSNP
rs965238232 3563 dbSNP
rs1176879011 3580 dbSNP
rs1019508717 3582 dbSNP
rs998627675 3593 dbSNP
rs967267723 3595 dbSNP
rs1474897172 3614 dbSNP
rs1165748043 3615 dbSNP
rs999319475 3616 dbSNP
rs970883152 3618 dbSNP
rs192013914 3623 dbSNP
rs1011703308 3626 dbSNP
rs1437420094 3631 dbSNP
rs777192311 3632 dbSNP
rs1012002365 3633 dbSNP
rs1428906193 3636 dbSNP
rs1055768082 3644 dbSNP
rs1002885711 3654 dbSNP
rs575837793 3660 dbSNP
rs1346234514 3662 dbSNP
rs1223267065 3669 dbSNP
rs1261872349 3670 dbSNP
rs745614145 3671 dbSNP
rs907428363 3672 dbSNP
rs1331804943 3675 dbSNP
rs1209864959 3678 dbSNP
rs554317133 3687 dbSNP
rs1261851041 3688 dbSNP
rs940841041 3697 dbSNP
rs1292479093 3718 dbSNP
rs1445847517 3722 dbSNP
rs1037559876 3733 dbSNP
rs909415298 3735 dbSNP
rs71307403 3742 dbSNP
rs766986922 3742 dbSNP
rs886473671 3743 dbSNP
rs1048187440 3746 dbSNP
rs1048615839 3748 dbSNP
rs1159739041 3751 dbSNP
rs933420369 3752 dbSNP
rs535973226 3765 dbSNP
rs1380602178 3777 dbSNP
rs931037969 3781 dbSNP
rs1331878841 3791 dbSNP
rs921026161 3795 dbSNP
rs1404770087 3798 dbSNP
rs923315632 3799 dbSNP
rs975025526 3799 dbSNP
rs115025764 3810 dbSNP
rs943493060 3812 dbSNP
rs186749792 3822 dbSNP
rs1291626323 3827 dbSNP
rs1241829842 3831 dbSNP
rs1490420106 3843 dbSNP
rs1198177294 3845 dbSNP
rs1266525622 3847 dbSNP
rs1377084676 3848 dbSNP
rs147615651 3850 dbSNP
rs1363146875 3865 dbSNP
rs542752929 3866 dbSNP
rs1434229343 3879 dbSNP
rs1332686066 3886 dbSNP
rs1391497074 3889 dbSNP
rs114271107 3891 dbSNP
rs550451566 3896 dbSNP
rs77826079 3897 dbSNP
rs1418810215 3902 dbSNP
rs1021421489 3906 dbSNP
rs1011834672 3907 dbSNP
rs1285470135 3908 dbSNP
rs1413336477 3908 dbSNP
rs956482484 3908 dbSNP
rs1421744170 3912 dbSNP
rs923670438 3921 dbSNP
rs866628000 3925 dbSNP
rs182866943 3927 dbSNP
rs1190623257 3928 dbSNP
rs567873843 3929 dbSNP
rs758873801 3931 dbSNP
rs190284099 3932 dbSNP
rs1248914981 3937 dbSNP
rs1249781326 3939 dbSNP
rs1417278634 3949 dbSNP
rs1034450825 3953 dbSNP
rs746065005 3967 dbSNP
rs1385962267 3970 dbSNP
rs970513416 3974 dbSNP
rs527815379 3976 dbSNP
rs907230306 3983 dbSNP
rs372594871 3984 dbSNP
rs1036607583 3988 dbSNP
rs779334621 3991 dbSNP
rs4876755 3992 dbSNP
rs1277301532 4002 dbSNP
rs1016041985 4005 dbSNP
rs374345551 4007 dbSNP
rs1216929565 4009 dbSNP
rs1006132073 4010 dbSNP
rs1049194826 4015 dbSNP
rs1382970868 4017 dbSNP
rs1244584952 4019 dbSNP
rs551525516 4025 dbSNP
rs899574658 4029 dbSNP
rs886314005 4033 dbSNP
rs1275413079 4035 dbSNP
rs1399285611 4047 dbSNP
rs1039458432 4048 dbSNP
rs1460963803 4055 dbSNP
rs1181794492 4074 dbSNP
rs554393793 4075 dbSNP
rs943699800 4081 dbSNP
rs997897306 4089 dbSNP
rs1169934033 4090 dbSNP
rs185570588 4097 dbSNP
rs533374506 4098 dbSNP
rs1175482694 4105 dbSNP
rs893343656 4113 dbSNP
rs534358173 4115 dbSNP
rs180958255 4117 dbSNP
rs1294332662 4135 dbSNP
rs1305623877 4138 dbSNP
rs1484847430 4141 dbSNP
rs1235110055 4152 dbSNP
rs34166716 4158 dbSNP
rs914490407 4161 dbSNP
rs1263716420 4163 dbSNP
rs543337934 4165 dbSNP
rs989973277 4167 dbSNP
rs1201634942 4171 dbSNP
rs977800582 4173 dbSNP
rs1427319973 4174 dbSNP
rs949050700 4175 dbSNP
rs1010660193 4178 dbSNP
rs1173743345 4181 dbSNP
rs958549368 4182 dbSNP
rs531470988 4188 dbSNP
rs560774785 4189 dbSNP
rs542407914 4190 dbSNP
rs1428981887 4201 dbSNP
rs1161933672 4202 dbSNP
rs375286731 4202 dbSNP
rs1346464975 4206 dbSNP
rs1236484116 4208 dbSNP
rs959111143 4209 dbSNP
rs1313479462 4210 dbSNP
rs76979449 4211 dbSNP
rs1344571784 4212 dbSNP
rs1429273489 4212 dbSNP
rs199572619 4212 dbSNP
rs1269937920 4214 dbSNP
rs201423677 4215 dbSNP
rs1259224930 4216 dbSNP
rs398009537 4216 dbSNP
rs1016051772 4223 dbSNP
rs1200346780 4224 dbSNP
rs1279898714 4228 dbSNP
rs10624163 4230 dbSNP
rs11410649 4230 dbSNP
rs1419190934 4230 dbSNP
rs1426069347 4230 dbSNP
rs1157767900 4231 dbSNP
rs752279266 4235 dbSNP
rs572084909 4237 dbSNP
rs553839414 4238 dbSNP
rs28461380 4251 dbSNP
rs1303308251 4260 dbSNP
rs1364804073 4271 dbSNP
rs1402856488 4275 dbSNP
rs189094772 4300 dbSNP
rs1373928059 4303 dbSNP
rs555851412 4310 dbSNP
rs996346258 4320 dbSNP
rs1446088830 4328 dbSNP
rs751201847 4345 dbSNP
rs1039424119 4348 dbSNP
rs1223511421 4349 dbSNP
rs943748904 4351 dbSNP
rs890881532 4356 dbSNP
rs997422788 4358 dbSNP
rs901868999 4362 dbSNP
rs1186145774 4365 dbSNP
rs1429530371 4365 dbSNP
rs1207699143 4366 dbSNP
rs1233768524 4371 dbSNP
rs1041352145 4372 dbSNP
rs1413483166 4373 dbSNP
rs1179820078 4377 dbSNP
rs1017611137 4387 dbSNP
rs538573323 4392 dbSNP
rs866853012 4394 dbSNP
rs945723118 4413 dbSNP
rs1007687484 4418 dbSNP
rs1445918419 4428 dbSNP
rs1163893050 4441 dbSNP
rs766089074 4448 dbSNP
rs1422559880 4449 dbSNP
rs990503835 4451 dbSNP
rs937150914 4454 dbSNP
rs762383581 4457 dbSNP
rs558449893 4458 dbSNP
rs1054635378 4465 dbSNP
rs1197419184 4470 dbSNP
rs1296315117 4493 dbSNP
rs1385169989 4495 dbSNP
rs971438661 4499 dbSNP
rs187626924 4505 dbSNP
rs1015436864 4508 dbSNP
rs1314694095 4510 dbSNP
rs1357589787 4511 dbSNP
rs983453200 4512 dbSNP
rs1219134793 4520 dbSNP
rs1437539799 4523 dbSNP
rs1046429540 4525 dbSNP
rs534384216 4529 dbSNP
rs917620278 4535 dbSNP
rs566911188 4545 dbSNP
rs1226836309 4547 dbSNP
rs1241943602 4554 dbSNP
rs1442421691 4555 dbSNP
rs1169230695 4557 dbSNP
rs1419972960 4561 dbSNP
rs990405085 4563 dbSNP
rs1168314086 4564 dbSNP
rs762099721 4567 dbSNP
rs1453231421 4571 dbSNP
rs1336183909 4590 dbSNP
rs952170880 4597 dbSNP
rs76555305 4601 dbSNP
rs145088923 4608 dbSNP
rs1270982853 4614 dbSNP
rs1339201555 4621 dbSNP
rs1213153310 4624 dbSNP
rs1265583495 4625 dbSNP
rs182051766 4635 dbSNP
rs567852017 4636 dbSNP
rs984659174 4654 dbSNP
rs1446062687 4664 dbSNP
rs1261981805 4665 dbSNP
rs996870285 4667 dbSNP
rs919082742 4668 dbSNP
rs1242329023 4674 dbSNP
rs1398175363 4681 dbSNP
rs965950114 4682 dbSNP
rs976440442 4682 dbSNP
rs544937694 4685 dbSNP
rs550536560 4685 dbSNP
rs1404083209 4686 dbSNP
rs1402508241 4687 dbSNP
rs900764059 4691 dbSNP
rs1319284070 4692 dbSNP
rs1326043157 4701 dbSNP
rs1428842647 4705 dbSNP
rs1019034354 4708 dbSNP
rs35291948 4708 dbSNP
rs1009030978 4709 dbSNP
rs1346482025 4716 dbSNP
rs1349717398 4723 dbSNP
rs1261813305 4725 dbSNP
rs1163046904 4734 dbSNP
rs890850235 4762 dbSNP
rs1033072467 4766 dbSNP
rs998933762 4768 dbSNP
rs1041883835 4773 dbSNP
rs1446083935 4780 dbSNP
rs1009894152 4790 dbSNP
rs531544575 4791 dbSNP
rs1480636575 4792 dbSNP
rs1198675277 4795 dbSNP
rs776113774 4799 dbSNP
rs937203095 4801 dbSNP
rs560837422 4803 dbSNP
rs1177604245 4806 dbSNP
rs762707821 4815 dbSNP
rs376455491 4827 dbSNP
rs1239464272 4841 dbSNP
rs1384283460 4841 dbSNP
rs1399188257 4842 dbSNP
rs1305118456 4844 dbSNP
rs866373639 4852 dbSNP
rs772550679 4861 dbSNP
rs1281989778 4862 dbSNP
rs937655662 4863 dbSNP
rs373151123 4867 dbSNP
rs190414821 4868 dbSNP
rs1349268501 4871 dbSNP
rs1223445664 4872 dbSNP
rs1237587261 4876 dbSNP
rs1293489429 4885 dbSNP
rs949887529 4900 dbSNP
rs569544287 4901 dbSNP
rs1323753312 4903 dbSNP
rs761159113 4908 dbSNP
rs1182351100 4912 dbSNP
rs1292839443 4921 dbSNP
rs1437889975 4922 dbSNP
rs929061623 4931 dbSNP
rs919125606 4939 dbSNP
rs1424478268 4947 dbSNP
rs907939495 4948 dbSNP
rs983974836 4952 dbSNP
rs1399007319 4956 dbSNP
rs545103207 4959 dbSNP
rs952075911 4963 dbSNP
rs910443067 4964 dbSNP
rs920551704 4981 dbSNP
rs1334731645 4982 dbSNP
rs1237288043 4984 dbSNP
rs34253625 4985 dbSNP
rs974721500 4989 dbSNP
rs1392489970 4992 dbSNP
rs1263461762 4994 dbSNP
rs964901002 5001 dbSNP
rs1196368735 5004 dbSNP
rs1249724086 5005 dbSNP
rs867614175 5006 dbSNP
rs1185468829 5007 dbSNP
rs1033004281 5010 dbSNP
rs577589491 5010 dbSNP
rs1366552907 5012 dbSNP
rs746299321 5013 dbSNP
rs577648721 5020 dbSNP
rs1167889790 5022 dbSNP
rs967448175 5023 dbSNP
rs1417471124 5028 dbSNP
rs1338171396 5029 dbSNP
rs1382801007 5032 dbSNP
rs556223070 5034 dbSNP
rs1381639076 5036 dbSNP
rs1310118297 5038 dbSNP
rs1328049731 5039 dbSNP
rs1181819318 5041 dbSNP
rs779208054 5044 dbSNP
rs1020026145 5045 dbSNP
rs544224612 5046 dbSNP
rs116644756 5047 dbSNP
rs1055994330 5059 dbSNP
rs1490463355 5064 dbSNP
rs1054495771 5066 dbSNP
rs1005744510 5069 dbSNP
rs556106468 5074 dbSNP
rs1001215205 5076 dbSNP
rs1192950026 5077 dbSNP
rs1216234949 5090 dbSNP
rs1351703334 5096 dbSNP
rs1471245217 5099 dbSNP
rs1177710755 5106 dbSNP
rs1406245859 5108 dbSNP
rs1465102408 5116 dbSNP
rs887477043 5117 dbSNP
rs905755148 5118 dbSNP
rs1382387840 5119 dbSNP
rs1048719975 5120 dbSNP
rs929051359 5121 dbSNP
rs1225341653 5123 dbSNP
rs1045706755 5127 dbSNP
rs949856262 5147 dbSNP
rs1322974815 5148 dbSNP
rs1208087440 5153 dbSNP
rs1239806444 5159 dbSNP
rs1262521378 5166 dbSNP
rs907738797 5173 dbSNP
rs1311660849 5177 dbSNP
rs918979998 5178 dbSNP
rs1299872077 5179 dbSNP
rs1389034315 5182 dbSNP
rs1047558941 5183 dbSNP
rs1346603881 5185 dbSNP
rs534181581 5192 dbSNP
rs149709644 5193 dbSNP
rs549773307 5193 dbSNP
rs1297911580 5194 dbSNP
rs1397755246 5195 dbSNP
rs1297191058 5196 dbSNP
rs1226062305 5197 dbSNP
rs769320685 5197 dbSNP
rs1406513671 5204 dbSNP
rs944501044 5209 dbSNP
rs930687532 5210 dbSNP
rs759010084 5217 dbSNP
rs749337415 5219 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 2131.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guguuugguaauacaCGACGAu 5'
Target 5' ----aauauuucaaaGCUGCUa 3'
1 - 18
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000378204.2 | 3UTR | AAUAUUUCAAAGCUGCUAUUCCUUUUCCCACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER+ ER+ breast cancer -0.566 4.6e-3 -0.522 9.1e-3 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.473 1.1e-2 -0.448 1.6e-2 23 Click to see details
GSE19536 Breast cancer -0.156 6.1e-2 -0.191 2.8e-2 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.295 7.6e-2 0.260 1.0e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.122 1.3e-1 0.109 1.5e-1 90 Click to see details
GSE17498 Multiple myeloma 0.178 1.4e-1 0.303 2.9e-2 40 Click to see details
GSE28544 Breast cancer 0.218 1.5e-1 0.696 7.9e-5 24 Click to see details
GSE17306 Multiple myeloma 0.143 1.6e-1 0.241 4.8e-2 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.159 2.2e-1 0.061 3.9e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.228 2.3e-1 -0.165 3.0e-1 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.169 2.4e-1 0.244 1.5e-1 20 Click to see details
GSE21849 B cell lymphoma 0.136 2.4e-1 0.245 1.0e-1 29 Click to see details
GSE19783 ER- ER- breast cancer -0.078 2.5e-1 -0.074 2.6e-1 79 Click to see details
GSE21032 Prostate cancer 0.053 3.2e-1 0.033 3.8e-1 83 Click to see details
GSE21687 Ependynoma primary tumors 0.056 3.3e-1 0.026 4.2e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.074 3.7e-1 0.065 3.8e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.052 3.9e-1 -0.034 4.3e-1 32 Click to see details
GSE27834 Pluripotent stem cells 0.065 4.1e-1 -0.082 3.8e-1 16 Click to see details
GSE38226 Liver fibrosis 0.054 4.1e-1 -0.082 3.6e-1 21 Click to see details
GSE19350 CNS germ cell tumors -0.056 4.3e-1 -0.007 4.9e-1 12 Click to see details
GSE19350 CNS germ cell tumors -0.056 4.3e-1 -0.007 4.9e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
COAD -0.679 0.03 -0.524 0.09 8 Click to see details
PRAD -0.257 0.04 -0.257 0.04 50 Click to see details
STAD 0.311 0.04 0.375 0.02 32 Click to see details
KIRC 0.178 0.07 0.171 0.08 68 Click to see details
CHOL -0.498 0.09 -0.600 0.04 9 Click to see details
CESC -0.911 0.14 -1.000 0.5 3 Click to see details
BRCA 0.081 0.23 0.092 0.2 84 Click to see details
UCEC 0.173 0.24 0.123 0.31 19 Click to see details
PAAD -0.447 0.28 -0.200 0.4 4 Click to see details
HNSC 0.081 0.31 0.154 0.17 42 Click to see details
THCA -0.064 0.32 -0.152 0.13 59 Click to see details
KIRP 0.087 0.32 0.057 0.38 32 Click to see details
BLCA -0.099 0.35 -0.009 0.49 18 Click to see details
LUAD -0.092 0.39 -0.035 0.46 12 Click to see details
KICH 0.046 0.41 0.069 0.37 25 Click to see details
LIHC 0.032 0.41 0.042 0.39 49 Click to see details
LUSC -0.022 0.45 -0.067 0.34 38 Click to see details
ESCA -0.042 0.45 0.118 0.36 11 Click to see details
PCPG 0.075 0.48 0.500 0.33 3 Click to see details
PCPG 0.075 0.48 0.500 0.33 3 Click to see details
PCPG 0.075 0.48 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000285 CCND2 cyclin D2 4 7
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 3 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472263 NFIC nuclear factor I C 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505116 YTHDC1 YTH domain containing 1