miRTarBase - #MIRT555229 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PRKAA1   
Synonyms AMPK, AMPKa1
Description protein kinase AMP-activated catalytic subunit alpha 1
Transcript NM_006251   
Other Transcripts NM_206907   
Expression
Putative miRNA Targets on PRKAA1
3'UTR of PRKAA1
(miRNA target sites are highlighted)
>PRKAA1|NM_006251|3'UTR
   1 ACAGAAAACTTTGCTTATTTCTTTTGCAGCAATAAGCATGCATAATAAGTCACAGCCAAATGCTTCCATTTGTAATCAAG
  81 TTATACATAATTATAACCGAGGGCTGGCGTTTTGGAATGCAATTTGCACAGGGATTGGAACATGATTTATAGTTAAAAGC
 161 CTAATATGCAGAAATGAATTAAGATCATTTTGTTGTTCATTGTGCAGTATGTATATAGCATAATATACACAGTGAATTAT
 241 AGGTCTCAGGCTTACTTGATTTTTGGCTATTTTATATTTAGTGTACACAGGGCTTTGAAATATTAATTTACATAAAGGCC
 321 TTCATATATTATTACGTGTTATATATTACGTGTTATAAATTTATTCAATAAATATTTGCCTAGAATTCCCAAGACCTTTA
 401 TAGGTGATTTTGTTTTCTGGGCTCCTTAACTTCATAAATAGCTAGTATCTTCCAGCAGTAGTAACAGTCTGGATAACTTC
 481 TTCCATATCCCTCCCTCTTTGTTTTTTTGAGACAGTGTCACTTTGTCACCCAGGCTGGAGTGCAATGGTGTGGTCTCGGC
 561 TCACTGCAACCTCCACCTCCCGGGTTCAAGTGATTCTCCCGCCTCAGCTTCCTGAGTAGCTGGAACTACAGGCGTGTGCC
 641 ACCACACCCGGCTAATTTTTCGTATTTTTAGTGTAGACGGGGTTTCACTATGTTGCCCAGGCTGGTCTCGAACTCCTGAC
 721 CGCGTGATCCACCACCTCAGCTTCCCAAAGTGGTGGGATTACAGGCGTGAGCCACCGCACCCGGCCTCCATATCCCCCTT
 801 TTAAAATTCTGTAGTGTATGGTAAGTCATATCAGATATCAGACCTAATTTAAATTTCATTTTAGCTTTACAAGTCCAAAA
 881 ACACAGAATTTATATATTCAGATACTCTAGCACTAATTTTAGTCTTAAAATATTCCCACGATATTCTGTACACAAAATGT
 961 TCTTTTTGTTACAAGAGCTGAGTTGCATATACTGTAGATAAATCATATTATTTTTGCCAATTTCACAAATTCCTCTGGCC
1041 CATCATGTCAGTCATTATTGAGTATATGCACACATTGCTACTTATTTGATTATGTATCTTTTAAATTGATTCAGTGCATA
1121 GAAAACTATCTCTTACAAACTTTAAGTGCTCTGATATGACTTCCCCCCCAAATTTTATTATGAACATTTTTAAAAACAGA
1201 AAAATTGAAAAACTGTTTGGTAAGCACATGTATATCTACCATTTAGATTCAGCAGTTGTTAATGTTTTGTCATTTGTTTT
1281 CTCTATACCTATATATGTATAGATACAGCTAGTTATGCATATATATGCATATATGTGTTTGTTTGTGTATGTATATATGC
1361 TTTTTTCCCCCTGAACCATTTGGATGTTACAGACATACTTATCACCGTGAAAATACTTCAAGTATCTCCTACAGATAATG
1441 ACATTCTCCTAAAAATCCGTAATACCATTGTAAAAGTAATAATTCCCCAATATCATCTAATCAAGCCATATTTAAATTTC
1521 TGAAGTTAACTCCAAATTTCTTTATAGCTGATTATTTCAAACTAGGATCCAATTAAAGTTTACATATGACACTTGGTTAT
1601 AACTCTTTAGTTGGATATAACATTATTATTATTTTGATAAAATATGGAACAAATCAATTCTATTAATAAGTGGTCACATT
1681 TGTTTTGGGCTTAAATTACTTTTTAAAGATACTGGATTTTCCTAAGATTTCTGATTTACACTGATATTTTTTTTTGTCAT
1761 TCTTAATTGCATCACACAATAGATGTAAATGAAGATGTAGTCACCTCAGATAAAATTGGTATCGTGTATGATAATATTGT
1841 ATCATTTATATTTGCCTTATGTTAACTTTAAGAAATTGATTTTTTTGTATTAATCATTTTCCCATTGCAACAGAGCTATA
1921 TTTTTTCTATTTTAAGAATCATATTTTAGGATTATTTTTGGCAAATACAGTGAGCACTTATGTAACCAGATGATAATGAA
2001 CTCAAATGTCATGATAGCTTGCATAAATGGTGACTCTAGTAGATTTGACTCAAGCACTTCTAGAATCATGCACTGAATTC
2081 AAAAGAAAAATCTTGCTGCTTTTTGTCCAGGGCTTGTTCTATTCAACTTCTAATTTGAAAGCTGTACAAAGTAATAGAAG
2161 TTCCATTTAAATATGAGTTCAAAACTGTATTTACTTTTTATGTGGCCCTCTCTTTAGGGGATTCTAATTTTACTTAGGGT
2241 CTCTAAGTGCAGCATAATGTTCCTGATGTTAACAGAAGACTGTATTTTTAAAGTTACAAATTTGTATATGGAATTAAGTA
2321 ATGGCGCTATATACGCTGTTGTGGGGAGGGGGGAAGAAAAGGAGGAACCAATTAAATAGGACCTTTTAAAAATTGTTAAT
2401 TTTGTAAACTTTGCTTCTCTTATAAGTTATTGTGATTCATTTTAGTTACTGTGTTTTATTTTGAAAATATTTAAATATTG
2481 CACTTCTATAAATAGTATGATAAATGCACAGACAATTGCAGTAAATTCTTTTTTAAGCTAGGATATTTGAAATGACAACC
2561 TTTGGTTAAGTGTGTCAAGGTTGCAACAGAATTTTCACAATTTTTTTGTTGTTTGCAAATTGTTACTAATATTGAAGAGG
2641 TAAGGGAGGCAATGCAAATGATTTTTAATCTTTTTTTATTATCTTTTCAGCAGTTTATATTTTTTGTGACTTTATGCAAC
2721 CATATTTTTACTTTGTCTTGACAACTGAAAGATGTATAAGGTTTTTTGCCAGAAATGTACTGTATACATAGTTTTAAGTA
2801 TAACAGATTTTACTGATATGTAAAAATTTTGCCATTAAAATAAATGATTTCTCACTGAGAGGAACTTTTCTACCAGGTTG
2881 GGGCATATGGGAGCTTAATATATCATATCTAATTTAAAATAATTTCACTGAAATAAACTCCATTGCTTTTACCTAATTTT
2961 TTTCTTGAGATGCTTTTGTAGTTTTTCAGAGTTTTAGATGATTTTATACAAAATCCTCTGCCTAGCACTGCTCTTTTTGA
3041 TGTTGTAGTGACACCATTTACATTGAATTAATGCTTGGTAGCCTGGGGCTAGATGTGGAACTCCATGGATCTGTGTTCTG
3121 ACTGGCACCTTTGGAATGAAAGAAAAGTGTGTGCTGTCCAAATTTTTTCCCCTTAATTCTTTCCCTCATCTTCTCACCCA
3201 TAATAGAAATTTTATTTCCATTGTGAGTTCTGACAAGAATGAAATTCCACATACAACATAACTGTAAATTGTTGGTAGGT
3281 AGAAGTTAATATTTGTGGTTCATGTATATTTTGACCAGAGTATATTTAAGTATATAATTTCAGCTTCCTTGATTTAGAAA
3361 TATGATATAATAAAGAAAAACTCCATTTATCATCTGTTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUA-CACGACGAu 5'
             |||  |  ||  ||||||| 
Target 5' tcaAAAGAAAAATCTTGCTGCTt 3'
2079 - 2101 147.00 -9.50
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |:|:|||| | ||:||:| 
Target 5' ttaAGATCATT-T-TGTTGTTc 3'
179 - 198 129.00 -10.20
3
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             |:|  | |:|||||||:  
Target 5' gaaAGAAAAGTGTGTGCTGTcc 3'
3138 - 3159 127.00 -12.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31497176 5 COSMIC
COSN31571151 27 COSMIC
COSN30486563 48 COSMIC
COSN31504439 75 COSMIC
COSN26565368 98 COSMIC
COSN30452129 99 COSMIC
COSN30459318 114 COSMIC
COSN31598911 168 COSMIC
COSN26552013 169 COSMIC
COSN26672987 368 COSMIC
COSN26455372 601 COSMIC
COSN15985740 678 COSMIC
COSN5605475 1363 COSMIC
COSN20120215 1843 COSMIC
COSN32061035 1881 COSMIC
COSN31549503 2042 COSMIC
COSN21870894 2047 COSMIC
COSN31609745 2260 COSMIC
COSN30541553 2325 COSMIC
COSN31539612 2325 COSMIC
COSN31553402 2326 COSMIC
COSN8492777 2334 COSMIC
COSN22481121 2373 COSMIC
COSN16500072 2443 COSMIC
COSN31523065 2493 COSMIC
COSN31570658 2524 COSMIC
COSN31567586 2586 COSMIC
COSN30165186 2588 COSMIC
COSN31570666 2650 COSMIC
COSN31570184 2660 COSMIC
COSN31532987 2662 COSMIC
COSN31479617 2670 COSMIC
COSN31535815 2696 COSMIC
COSN31490102 2761 COSMIC
COSN6297151 3044 COSMIC
COSN4849891 3112 COSMIC
COSN19506432 3239 COSMIC
COSN20091186 3385 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1044253 2 dbSNP
rs1044254 4 dbSNP
rs1375114846 9 dbSNP
rs550631477 11 dbSNP
rs1267204323 13 dbSNP
rs765785940 13 dbSNP
rs1370256374 14 dbSNP
rs758084732 15 dbSNP
rs766848274 24 dbSNP
rs1221413815 26 dbSNP
rs762251206 26 dbSNP
rs920984352 32 dbSNP
rs1260166937 34 dbSNP
rs1212108053 35 dbSNP
rs1485530426 37 dbSNP
rs752177993 38 dbSNP
rs1217515466 44 dbSNP
rs1317070865 45 dbSNP
rs1305711149 46 dbSNP
rs371313459 47 dbSNP
rs532628920 48 dbSNP
rs750838337 50 dbSNP
rs565126169 53 dbSNP
rs1388341553 58 dbSNP
rs1195604413 62 dbSNP
rs1387584404 63 dbSNP
rs540568879 66 dbSNP
rs890697637 75 dbSNP
rs1267234991 77 dbSNP
rs1361637039 79 dbSNP
rs1026994106 87 dbSNP
rs1287373055 93 dbSNP
rs763546732 98 dbSNP
rs747144751 99 dbSNP
rs1037419557 108 dbSNP
rs528762464 109 dbSNP
rs894267989 112 dbSNP
rs994827914 122 dbSNP
rs574542332 125 dbSNP
rs938377896 159 dbSNP
rs1213173333 171 dbSNP
rs1294702692 174 dbSNP
rs1044852696 181 dbSNP
rs1014345440 194 dbSNP
rs1201606140 198 dbSNP
rs1240738268 199 dbSNP
rs542669433 201 dbSNP
rs1443309721 205 dbSNP
rs1183581897 209 dbSNP
rs1381273038 210 dbSNP
rs768221146 212 dbSNP
rs575564988 213 dbSNP
rs924523809 216 dbSNP
rs1421305162 221 dbSNP
rs1157409461 230 dbSNP
rs1344791473 247 dbSNP
rs778062822 250 dbSNP
rs1331217339 261 dbSNP
rs1052994948 269 dbSNP
rs1309938616 275 dbSNP
rs1300477441 281 dbSNP
rs1375469888 282 dbSNP
rs934552686 285 dbSNP
rs545630791 287 dbSNP
rs570597736 288 dbSNP
rs1398359717 297 dbSNP
rs1235028944 303 dbSNP
rs139553829 309 dbSNP
rs1429294257 312 dbSNP
rs975280868 318 dbSNP
rs1460514483 319 dbSNP
rs964789511 320 dbSNP
rs1239271918 321 dbSNP
rs1481927368 324 dbSNP
rs1175782348 335 dbSNP
rs910665411 336 dbSNP
rs1433970741 340 dbSNP
rs943836294 342 dbSNP
rs774965044 348 dbSNP
rs1382135067 349 dbSNP
rs954891149 350 dbSNP
rs1297380102 352 dbSNP
rs554691600 358 dbSNP
rs1368116747 359 dbSNP
rs1026525423 368 dbSNP
rs983662463 371 dbSNP
rs545475811 375 dbSNP
rs994162046 379 dbSNP
rs1197371784 391 dbSNP
rs1421406932 396 dbSNP
rs532169437 397 dbSNP
rs963696299 401 dbSNP
rs950955758 408 dbSNP
rs1274510987 421 dbSNP
rs1027834644 430 dbSNP
rs1203107536 442 dbSNP
rs973645776 449 dbSNP
rs375384537 452 dbSNP
rs183831823 467 dbSNP
rs1482498836 469 dbSNP
rs1489035666 485 dbSNP
rs1016382759 487 dbSNP
rs771723975 489 dbSNP
rs894215612 494 dbSNP
rs1480234387 495 dbSNP
rs558789481 500 dbSNP
rs1171402721 501 dbSNP
rs1022975712 506 dbSNP
rs1345093258 514 dbSNP
rs1056822558 516 dbSNP
rs1169700430 516 dbSNP
rs533936671 517 dbSNP
rs895922007 525 dbSNP
rs1031906698 530 dbSNP
rs1230887807 532 dbSNP
rs902851988 540 dbSNP
rs1041602093 543 dbSNP
rs745698469 545 dbSNP
rs1348454221 547 dbSNP
rs566791364 549 dbSNP
rs1272986958 554 dbSNP
rs554822271 557 dbSNP
rs192483418 558 dbSNP
rs932563276 560 dbSNP
rs1490243968 561 dbSNP
rs1194248111 563 dbSNP
rs1243883946 567 dbSNP
rs969621309 569 dbSNP
rs1474493658 570 dbSNP
rs1186024580 572 dbSNP
rs916384362 575 dbSNP
rs1414395173 581 dbSNP
rs1170910627 582 dbSNP
rs899489043 589 dbSNP
rs1364800184 598 dbSNP
rs1419925819 600 dbSNP
rs914535581 601 dbSNP
rs1039542208 612 dbSNP
rs942541711 613 dbSNP
rs910614715 618 dbSNP
rs758617536 619 dbSNP
rs1384104052 620 dbSNP
rs568817943 633 dbSNP
rs954698400 634 dbSNP
rs1205915089 644 dbSNP
rs919241946 645 dbSNP
rs972128499 648 dbSNP
rs1445524702 649 dbSNP
rs963945290 650 dbSNP
rs748249455 655 dbSNP
rs908316645 659 dbSNP
rs868645997 661 dbSNP
rs779187617 662 dbSNP
rs1035363814 672 dbSNP
rs1440134031 676 dbSNP
rs868764960 678 dbSNP
rs1382276938 679 dbSNP
rs534517133 689 dbSNP
rs749158711 690 dbSNP
rs1334230318 691 dbSNP
rs1003045062 696 dbSNP
rs1407746164 698 dbSNP
rs902967379 702 dbSNP
rs1020369336 705 dbSNP
rs1277219767 709 dbSNP
rs1198263441 710 dbSNP
rs1240153847 717 dbSNP
rs1281641361 720 dbSNP
rs111924809 721 dbSNP
rs929453755 722 dbSNP
rs532071268 723 dbSNP
rs1227771457 724 dbSNP
rs973593538 726 dbSNP
rs1326813911 729 dbSNP
rs1438359042 732 dbSNP
rs1183644983 736 dbSNP
rs1294912510 741 dbSNP
rs1361905163 748 dbSNP
rs1039658224 749 dbSNP
rs970319821 761 dbSNP
rs746897375 762 dbSNP
rs572235839 763 dbSNP
rs890969751 765 dbSNP
rs1340117001 766 dbSNP
rs1050947542 767 dbSNP
rs1332228287 771 dbSNP
rs552197873 776 dbSNP
rs1441715143 777 dbSNP
rs1284223929 780 dbSNP
rs558560354 782 dbSNP
rs1031730473 783 dbSNP
rs112080650 794 dbSNP
rs1159057895 795 dbSNP
rs767676019 796 dbSNP
rs1197549789 808 dbSNP
rs1021501257 816 dbSNP
rs996763015 818 dbSNP
rs1420388961 820 dbSNP
rs942054976 821 dbSNP
rs1164212120 837 dbSNP
rs1472899995 838 dbSNP
rs1479252875 839 dbSNP
rs561266626 840 dbSNP
rs1185025133 841 dbSNP
rs538512072 846 dbSNP
rs1041097485 853 dbSNP
rs1170193470 858 dbSNP
rs1394757163 869 dbSNP
rs1409701978 875 dbSNP
rs1304165942 876 dbSNP
rs991703768 882 dbSNP
rs958832186 895 dbSNP
rs1035813709 905 dbSNP
rs1403397458 913 dbSNP
rs751931572 921 dbSNP
rs981674569 930 dbSNP
rs943690131 932 dbSNP
rs886793593 935 dbSNP
rs1229489832 937 dbSNP
rs137946058 939 dbSNP
rs758375975 940 dbSNP
rs1020063731 953 dbSNP
rs1291701496 964 dbSNP
rs1011631816 978 dbSNP
rs1293687589 985 dbSNP
rs1228702067 1000 dbSNP
rs1198329392 1009 dbSNP
rs931074243 1011 dbSNP
rs1429830483 1013 dbSNP
rs892807696 1028 dbSNP
rs1037874954 1033 dbSNP
rs916133992 1044 dbSNP
rs993503568 1048 dbSNP
rs1422940426 1058 dbSNP
rs1293209076 1071 dbSNP
rs1229960190 1081 dbSNP
rs960026678 1092 dbSNP
rs1366017573 1118 dbSNP
rs1018167842 1119 dbSNP
rs924613547 1120 dbSNP
rs977494570 1127 dbSNP
rs1397350365 1128 dbSNP
rs1006802399 1140 dbSNP
rs766696335 1143 dbSNP
rs915415639 1144 dbSNP
rs569637543 1146 dbSNP
rs1405119901 1153 dbSNP
rs1260898470 1161 dbSNP
rs79292371 1163 dbSNP
rs1260452696 1164 dbSNP
rs996711995 1165 dbSNP
rs891086112 1166 dbSNP
rs1164551216 1170 dbSNP
rs1387447243 1170 dbSNP
rs34482915 1170 dbSNP
rs530852178 1171 dbSNP
rs1161091197 1175 dbSNP
rs1455548930 1181 dbSNP
rs1287174141 1185 dbSNP
rs929853840 1206 dbSNP
rs897876733 1212 dbSNP
rs1453250580 1214 dbSNP
rs1450953446 1218 dbSNP
rs556093072 1221 dbSNP
rs941996762 1224 dbSNP
rs909225382 1225 dbSNP
rs563699720 1226 dbSNP
rs1318289570 1232 dbSNP
rs1236506809 1234 dbSNP
rs1259595795 1236 dbSNP
rs1008565187 1238 dbSNP
rs1461416324 1238 dbSNP
rs1248352586 1242 dbSNP
rs1460372263 1243 dbSNP
rs991485793 1254 dbSNP
rs1251758874 1255 dbSNP
rs763565371 1260 dbSNP
rs1287548978 1269 dbSNP
rs1207475913 1272 dbSNP
rs928916555 1273 dbSNP
rs147350847 1285 dbSNP
rs1296903413 1287 dbSNP
rs766223652 1288 dbSNP
rs1226237165 1289 dbSNP
rs1447219849 1292 dbSNP
rs1298522718 1293 dbSNP
rs995216224 1296 dbSNP
rs1389298104 1299 dbSNP
rs567650373 1305 dbSNP
rs1323850419 1306 dbSNP
rs1275948869 1310 dbSNP
rs1436481923 1312 dbSNP
rs1224738550 1317 dbSNP
rs1260718309 1325 dbSNP
rs749973791 1332 dbSNP
rs1210113400 1334 dbSNP
rs898276847 1335 dbSNP
rs142677351 1339 dbSNP
rs1175875431 1341 dbSNP
rs188251829 1343 dbSNP
rs761427602 1347 dbSNP
rs1201614465 1351 dbSNP
rs527574612 1359 dbSNP
rs1427361328 1361 dbSNP
rs1370822361 1365 dbSNP
rs1017949809 1366 dbSNP
rs1356226542 1367 dbSNP
rs1307180288 1369 dbSNP
rs1345684352 1372 dbSNP
rs1447105355 1373 dbSNP
rs1006583108 1381 dbSNP
rs1280801611 1384 dbSNP
rs564824934 1401 dbSNP
rs955260829 1401 dbSNP
rs183113419 1402 dbSNP
rs573055558 1405 dbSNP
rs1029593031 1406 dbSNP
rs994382253 1407 dbSNP
rs938964712 1414 dbSNP
rs896990167 1421 dbSNP
rs1036821500 1424 dbSNP
rs1225090693 1431 dbSNP
rs924603172 1453 dbSNP
rs78955876 1458 dbSNP
rs887902922 1459 dbSNP
rs968777057 1462 dbSNP
rs1055705819 1467 dbSNP
rs191771027 1476 dbSNP
rs760301103 1484 dbSNP
rs1366033420 1490 dbSNP
rs41271117 1494 dbSNP
rs963887896 1495 dbSNP
rs1025530065 1501 dbSNP
rs201036313 1502 dbSNP
rs771680417 1505 dbSNP
rs763633699 1515 dbSNP
rs913390134 1518 dbSNP
rs1364633388 1520 dbSNP
rs990762351 1528 dbSNP
rs1297317358 1544 dbSNP
rs1360669965 1545 dbSNP
rs1225210989 1547 dbSNP
rs745530996 1551 dbSNP
rs1287939488 1557 dbSNP
rs1451252722 1559 dbSNP
rs1279428918 1584 dbSNP
rs1243975318 1594 dbSNP
rs957089442 1599 dbSNP
rs1187894446 1603 dbSNP
rs1385608293 1608 dbSNP
rs951397646 1621 dbSNP
rs911002559 1622 dbSNP
rs1412538575 1634 dbSNP
rs756469301 1636 dbSNP
rs985094952 1655 dbSNP
rs571778582 1657 dbSNP
rs955043514 1660 dbSNP
rs1410797711 1665 dbSNP
rs1029953729 1666 dbSNP
rs112364555 1671 dbSNP
rs1307009787 1679 dbSNP
rs574094026 1696 dbSNP
rs538204134 1706 dbSNP
rs1053115 1713 dbSNP
rs1016766314 1715 dbSNP
rs1044771030 1716 dbSNP
rs1005366492 1732 dbSNP
rs1286390398 1745 dbSNP
rs887852162 1746 dbSNP
rs144007197 1747 dbSNP
rs894631511 1747 dbSNP
rs1055821252 1748 dbSNP
rs1057489806 1748 dbSNP
rs1041999311 1756 dbSNP
rs200355780 1756 dbSNP
rs747503242 1756 dbSNP
rs1176170274 1758 dbSNP
rs571025042 1759 dbSNP
rs1423013036 1762 dbSNP
rs1184321084 1766 dbSNP
rs1001469349 1771 dbSNP
rs914593705 1776 dbSNP
rs1250889663 1777 dbSNP
rs1180204665 1793 dbSNP
rs1407402819 1802 dbSNP
rs1455104530 1804 dbSNP
rs770656233 1819 dbSNP
rs1046179142 1821 dbSNP
rs1443174865 1823 dbSNP
rs942806176 1824 dbSNP
rs1348899238 1829 dbSNP
rs1227792345 1832 dbSNP
rs1263849803 1839 dbSNP
rs1325575217 1847 dbSNP
rs1198731813 1864 dbSNP
rs1310563058 1871 dbSNP
rs1270547129 1873 dbSNP
rs1229606036 1875 dbSNP
rs1328900053 1876 dbSNP
rs1183759183 1879 dbSNP
rs1249076659 1880 dbSNP
rs1199486962 1887 dbSNP
rs1472065874 1887 dbSNP
rs912377948 1889 dbSNP
rs1468000092 1892 dbSNP
rs946315150 1911 dbSNP
rs913496256 1913 dbSNP
rs1054613755 1915 dbSNP
rs754262936 1927 dbSNP
rs1331297395 1948 dbSNP
rs1348797065 1949 dbSNP
rs1302877210 1950 dbSNP
rs1409505872 1955 dbSNP
rs866821024 1969 dbSNP
rs936166903 1981 dbSNP
rs546259444 1984 dbSNP
rs910950216 1986 dbSNP
rs1025479187 1989 dbSNP
rs534914424 1992 dbSNP
rs116202595 1999 dbSNP
rs1339994727 2001 dbSNP
rs1356988451 2003 dbSNP
rs955180396 2005 dbSNP
rs1161277856 2006 dbSNP
rs1457709575 2017 dbSNP
rs922285616 2023 dbSNP
rs1023287484 2027 dbSNP
rs1270386346 2032 dbSNP
rs1425742575 2034 dbSNP
rs1197584882 2037 dbSNP
rs1053116 2049 dbSNP
rs1053117 2059 dbSNP
rs1053118 2065 dbSNP
rs1377496453 2069 dbSNP
rs1011981300 2073 dbSNP
rs972852173 2078 dbSNP
rs1369166950 2093 dbSNP
rs896265355 2094 dbSNP
rs1304037545 2096 dbSNP
rs1181552215 2101 dbSNP
rs1367711770 2110 dbSNP
rs1482307465 2117 dbSNP
rs1250050210 2126 dbSNP
rs1209828974 2127 dbSNP
rs1322986696 2129 dbSNP
rs1464850293 2139 dbSNP
rs1266570571 2143 dbSNP
rs549459484 2144 dbSNP
rs1035855562 2148 dbSNP
rs1322739768 2160 dbSNP
rs1312971991 2163 dbSNP
rs1227455172 2164 dbSNP
rs961301017 2178 dbSNP
rs1487304832 2187 dbSNP
rs1017295889 2188 dbSNP
rs1208669440 2189 dbSNP
rs1261891598 2197 dbSNP
rs566919666 2202 dbSNP
rs1448079130 2208 dbSNP
rs983892551 2215 dbSNP
rs1191102231 2218 dbSNP
rs1388687882 2221 dbSNP
rs1449195081 2226 dbSNP
rs1379858717 2238 dbSNP
rs903354889 2239 dbSNP
rs1435668345 2258 dbSNP
rs187426278 2263 dbSNP
rs1370355057 2272 dbSNP
rs1387860210 2278 dbSNP
rs1456633270 2281 dbSNP
rs1293007309 2287 dbSNP
rs1183257471 2293 dbSNP
rs1385808926 2294 dbSNP
rs747388870 2297 dbSNP
rs563790226 2299 dbSNP
rs1287089103 2311 dbSNP
rs1364410845 2313 dbSNP
rs1453013609 2318 dbSNP
rs183137075 2326 dbSNP
rs1368892118 2334 dbSNP
rs1243700317 2335 dbSNP
rs907317973 2341 dbSNP
rs761327542 2345 dbSNP
rs1206312309 2346 dbSNP
rs1422286357 2347 dbSNP
rs1024289716 2349 dbSNP
rs1464846923 2353 dbSNP
rs1184575422 2354 dbSNP
rs1392036618 2355 dbSNP
rs942795355 2361 dbSNP
rs912669942 2369 dbSNP
rs533337978 2379 dbSNP
rs552023341 2379 dbSNP
rs986909191 2383 dbSNP
rs559917899 2384 dbSNP
rs112954658 2416 dbSNP
rs541524635 2422 dbSNP
rs765955309 2424 dbSNP
rs573113864 2426 dbSNP
rs112913361 2430 dbSNP
rs1387743839 2439 dbSNP
rs1470297250 2464 dbSNP
rs973950020 2474 dbSNP
rs1489009573 2477 dbSNP
rs1265233021 2478 dbSNP
rs1307209007 2480 dbSNP
rs892017582 2490 dbSNP
rs190893022 2495 dbSNP
rs1351983916 2496 dbSNP
rs1054729735 2499 dbSNP
rs1220302236 2502 dbSNP
rs1267000359 2515 dbSNP
rs936114697 2519 dbSNP
rs962627224 2523 dbSNP
rs1258109164 2531 dbSNP
rs542409179 2533 dbSNP
rs1228457710 2537 dbSNP
rs1482452679 2539 dbSNP
rs889965762 2542 dbSNP
rs184910517 2544 dbSNP
rs933753979 2549 dbSNP
rs756017135 2557 dbSNP
rs1391091680 2558 dbSNP
rs1470226973 2570 dbSNP
rs796808896 2575 dbSNP
rs1178205485 2576 dbSNP
rs556941253 2578 dbSNP
rs1035143408 2579 dbSNP
rs1465329023 2582 dbSNP
rs1298540435 2593 dbSNP
rs1371965126 2600 dbSNP
rs972414332 2601 dbSNP
rs1407681439 2608 dbSNP
rs1287119740 2611 dbSNP
rs1345645650 2621 dbSNP
rs1220474506 2626 dbSNP
rs1292741648 2632 dbSNP
rs1303999528 2642 dbSNP
rs939696057 2642 dbSNP
rs909781289 2652 dbSNP
rs1252317432 2655 dbSNP
rs984008497 2657 dbSNP
rs959167954 2659 dbSNP
rs1422920556 2662 dbSNP
rs1203330919 2665 dbSNP
rs748230047 2668 dbSNP
rs1480778614 2671 dbSNP
rs1193026278 2678 dbSNP
rs1372673689 2686 dbSNP
rs1422898673 2688 dbSNP
rs1169509065 2706 dbSNP
rs1432540150 2706 dbSNP
rs1391821496 2709 dbSNP
rs1020492918 2714 dbSNP
rs1306968720 2734 dbSNP
rs1365840338 2740 dbSNP
rs1011815514 2744 dbSNP
rs1291301076 2752 dbSNP
rs781324065 2753 dbSNP
rs1201560066 2754 dbSNP
rs971490567 2755 dbSNP
rs1434270032 2769 dbSNP
rs1344819868 2776 dbSNP
rs1267053541 2788 dbSNP
rs1189876458 2792 dbSNP
rs1452414079 2794 dbSNP
rs1024821683 2796 dbSNP
rs35980452 2796 dbSNP
rs1223791785 2803 dbSNP
rs1245119351 2804 dbSNP
rs1039697438 2816 dbSNP
rs1484265573 2818 dbSNP
rs1007266430 2819 dbSNP
rs1167730287 2825 dbSNP
rs1276312307 2829 dbSNP
rs755156746 2831 dbSNP
rs11559002 2838 dbSNP
rs1162087378 2844 dbSNP
rs538267468 2847 dbSNP
rs1249113770 2855 dbSNP
rs114336915 2883 dbSNP
rs1368016689 2884 dbSNP
rs1433267264 2893 dbSNP
rs1331630622 2902 dbSNP
rs1300284668 2910 dbSNP
rs1357308711 2924 dbSNP
rs930091997 2926 dbSNP
rs1287780897 2929 dbSNP
rs1321144750 2930 dbSNP
rs1402838625 2930 dbSNP
rs918402694 2933 dbSNP
rs1352151404 2937 dbSNP
rs1038207320 2942 dbSNP
rs1243598716 2952 dbSNP
rs1000442139 2954 dbSNP
rs890081848 2955 dbSNP
rs531993749 2956 dbSNP
rs1412652224 2958 dbSNP
rs1400745741 2964 dbSNP
rs934183399 2964 dbSNP
rs1160753809 2969 dbSNP
rs1429353458 2980 dbSNP
rs1394354398 2991 dbSNP
rs1391399553 2994 dbSNP
rs1174412786 2995 dbSNP
rs552683830 2998 dbSNP
rs900893956 3020 dbSNP
rs1320304619 3027 dbSNP
rs1341493215 3028 dbSNP
rs563183093 3031 dbSNP
rs1282600246 3033 dbSNP
rs1377532188 3034 dbSNP
rs1229018209 3036 dbSNP
rs939666416 3041 dbSNP
rs1326987365 3042 dbSNP
rs534410671 3043 dbSNP
rs1174970201 3045 dbSNP
rs567203353 3047 dbSNP
rs1253075868 3051 dbSNP
rs759987513 3055 dbSNP
rs1207795981 3065 dbSNP
rs549564686 3067 dbSNP
rs990755112 3070 dbSNP
rs1472723442 3074 dbSNP
rs960628382 3077 dbSNP
rs927665057 3083 dbSNP
rs926568754 3092 dbSNP
rs981936371 3099 dbSNP
rs1247738714 3101 dbSNP
rs1020460441 3102 dbSNP
rs34246121 3105 dbSNP
rs72747971 3105 dbSNP
rs1290255730 3117 dbSNP
rs917300647 3118 dbSNP
rs1018921586 3122 dbSNP
rs529744210 3123 dbSNP
rs956142634 3126 dbSNP
rs891109614 3128 dbSNP
rs1277729520 3140 dbSNP
rs1330866410 3144 dbSNP
rs552082851 3158 dbSNP
rs1033009687 3161 dbSNP
rs1000221103 3163 dbSNP
rs1288765683 3171 dbSNP
rs954265067 3178 dbSNP
rs1249188480 3179 dbSNP
rs1482417608 3184 dbSNP
rs1028594555 3185 dbSNP
rs1198955303 3195 dbSNP
rs1378658978 3196 dbSNP
rs747397692 3202 dbSNP
rs1409390832 3208 dbSNP
rs145077370 3218 dbSNP
rs1334235713 3221 dbSNP
rs998343138 3225 dbSNP
rs548581147 3227 dbSNP
rs1051127295 3233 dbSNP
rs141296428 3237 dbSNP
rs1396659215 3239 dbSNP
rs1310035397 3251 dbSNP
rs1401665344 3252 dbSNP
rs547955852 3254 dbSNP
rs529388835 3255 dbSNP
rs1368982214 3256 dbSNP
rs1409216424 3257 dbSNP
rs1324300179 3274 dbSNP
rs180893924 3280 dbSNP
rs1231069850 3283 dbSNP
rs190901221 3289 dbSNP
rs560801403 3298 dbSNP
rs1038425441 3306 dbSNP
rs541158100 3320 dbSNP
rs542821753 3328 dbSNP
rs888217672 3330 dbSNP
rs1048034396 3336 dbSNP
rs941158795 3337 dbSNP
rs1341035040 3341 dbSNP
rs1413082543 3347 dbSNP
rs937690250 3349 dbSNP
rs1453800698 3362 dbSNP
rs916435045 3363 dbSNP
rs926516503 3365 dbSNP
rs1450435934 3368 dbSNP
rs1055422648 3369 dbSNP
rs373859829 3369 dbSNP
rs1388492211 3370 dbSNP
rs539202961 3376 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000397128.2 | 3UTR | AAAAAUCUUGCUGCUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000397128.2 | 3UTR | AAAAAUCUUGCUGCUUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000397128.2 | 3UTR | AAAAAUCUUGCUGCUUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000397128.2 | 3UTR | AAAAAUCUUGCUGCUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000397128.2 | 3UTR | AAAAAUCUUGCUGCUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.689 3.9e-4 0.782 2.3e-5 20 Click to see details
GSE21032 Prostate cancer 0.306 2.5e-3 0.209 2.9e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.417 3.4e-2 -0.319 8.5e-2 20 Click to see details
GSE32688 Pancreatic cancer 0.318 3.8e-2 0.199 1.4e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.358 3.9e-2 0.436 1.5e-2 25 Click to see details
GSE19536 Breast cancer -0.163 5.3e-2 -0.194 2.7e-2 100 Click to see details
GSE38226 Liver fibrosis 0.361 5.4e-2 0.427 2.7e-2 21 Click to see details
GSE28260 Renal cortex and medulla -0.444 6.4e-2 -0.374 1.0e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.375 1.1e-1 0.273 2.0e-1 12 Click to see details
GSE17306 Multiple myeloma -0.17 1.2e-1 -0.118 2.1e-1 49 Click to see details
GSE19783 ER- ER- breast cancer -0.125 1.4e-1 -0.159 8.1e-2 79 Click to see details
GSE27834 Pluripotent stem cells -0.288 1.4e-1 -0.294 1.3e-1 16 Click to see details
GSE28544 Breast cancer -0.214 1.6e-1 -0.503 6.1e-3 24 Click to see details
GSE21687 Ependynoma primary tumors 0.124 1.6e-1 0.247 2.5e-2 64 Click to see details
GSE17498 Multiple myeloma -0.12 2.3e-1 0.001 5.0e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells -0.145 2.5e-1 -0.190 1.9e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.104 3.1e-1 0.028 4.5e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.092 3.4e-1 0.006 4.9e-1 23 Click to see details
GSE21849 B cell lymphoma 0.075 3.5e-1 0.225 1.2e-1 29 Click to see details
GSE14794 Lymphoblastoid cells -0.032 3.8e-1 0.026 4.0e-1 90 Click to see details
GSE14794 Lymphoblastoid cells -0.032 3.8e-1 0.026 4.0e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.997 0 1.000 0.5 4 Click to see details
HNSC -0.331 0.02 -0.370 0.01 42 Click to see details
KICH 0.338 0.05 0.455 0.01 25 Click to see details
PRAD 0.192 0.09 0.080 0.29 50 Click to see details
KIRC -0.146 0.12 -0.155 0.1 68 Click to see details
COAD -0.401 0.16 -0.738 0.02 8 Click to see details
LUSC 0.157 0.17 0.129 0.22 38 Click to see details
ESCA -0.312 0.18 -0.273 0.21 11 Click to see details
CHOL 0.297 0.22 0.183 0.32 9 Click to see details
STAD 0.125 0.25 0.051 0.39 32 Click to see details
THCA -0.088 0.25 -0.193 0.07 59 Click to see details
BLCA 0.133 0.3 0.119 0.32 18 Click to see details
BRCA -0.053 0.32 -0.044 0.35 84 Click to see details
PCPG -0.482 0.34 -0.500 0.33 3 Click to see details
CESC 0.379 0.38 0.500 0.33 3 Click to see details
LIHC -0.025 0.43 -0.043 0.38 49 Click to see details
UCEC 0.041 0.43 0.074 0.38 19 Click to see details
KIRP 0.024 0.45 0.011 0.48 32 Click to see details
LUAD -0.038 0.45 -0.049 0.44 12 Click to see details
LUAD -0.038 0.45 -0.049 0.44 12 Click to see details
LUAD -0.038 0.45 -0.049 0.44 12 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*