miRTarBase - #MIRT555143 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PTPRD   
Synonyms HPTP, HPTPD, HPTPDELTA, PTPD, RPTPDELTA
Description protein tyrosine phosphatase, receptor type D
Transcript NM_001040712   
Other Transcripts NM_001171025 , NM_002839 , NM_130391 , NM_130392 , NM_130393   
Expression
Putative miRNA Targets on PTPRD
3'UTR of PTPRD
(miRNA target sites are highlighted)
>PTPRD|NM_001040712|3'UTR
   1 AAACCCCTGACCCATTCTGGATTTTTACTACAGGCCCTTCAATATCCATGGAGTCTCTTCTGAGCCATACAGGGCACTTG
  81 AGAAGTCCTTCTTAACTTCTAGCTAACAACTACTTAGTGGGACTATTACACACAAAACAAATTAAAAACAAATTATTCCA
 161 GGTGGACCAAGAATTCACAGTTTAATAATCTAACCTGAAAAATAATGAAGAGAATCCTGACTGATGAGGCATCTGAAGGA
 241 TTTTATTTACAGATACCTCAAGGATTCAAAATCAAGGGAAGAAGAAATCACAGCAAAGAACCACCATCTTATTCAGGATT
 321 GCTTGAAAGGTGCAAGGAGAAATTGCCAGAATGCTGCAGTTCAGCACAAGATATGTGCTGGTGTGGCTTCTCACAATGAA
 401 ACGGACTCTGCTTTGACATCGCCCCTTCCCACCATACTGCTCATAATAACATTTTAGGGGGAAAGGGGAGGGAATGTTTA
 481 AAAAGAAAGTCCTTGATTTAGTTTTTTAGTATTGTAAAGATACTGCTGACCTGTGCTTCATTTCTAACTGTGTAAACTTT
 561 TTTTTAACAAAATGTATCATTCGATAAAGTGAATTTTAAAAAAGTTACATAACTCTTCATTTTTTTATTTCCAAATCGTA
 641 GGTTTTTTTAAGCTGTAGAACTGTTATCTGTAATATCTTGCTGTAGAAATATCAAATCATTTGAAAATTTGCACATTTTT
 721 GTGCAAAACTCAATCTACAGTATCAGTCTCGTCAGATATATTAATTTTACACTTCAGTTTTGATTGGTGAGAAAGTACCC
 801 ATTCTCTTCAAATAATCAAAGATAATTATTATTTTGTTTTGTTTTTGGAATCAACAGGGAGGCGCAAAGTATAAAGTTGC
 881 TGCTAACATATATACATATATATCCATATTTTATAAGGGTGTCTATGTATATATAGACAGTGTGTCCACACAAAAAATAG
 961 ATACAGTTATCAGTCAGTCAGTTCTTCCATGATTTAGTTTTTTTAAACGTAGAAAAGCTATTGTAAACATCTCTTTCCAT
1041 TTATTCTTAATTTTTTGACATATTGGTATTTCTTTAAAGGGAAATGAGGAATGCACATCAGTGATTGATTGTCAAACCTC
1121 ACCCCCTGATTTCCTACCTAATCTACCCCCACCTAACCAATCAATCACATCCACAAATTGTTTTGTTTGTTTGTTAGTCA
1201 GGCTTCCAACAAAGTTCAATATTTCTAACACTCTAGTGCAATAAAAATTATTATTAAATAGCTAAGAGGTGTGCATGTGG
1281 GAAAGGTCAGTGCATATCCCTTTAGGAGGGGAGAATGTTGTAATATATCAGCTATCGAGTTGTTTAAAAAAAGTGTATTC
1361 AATCGTATATTGTCTATAGTATGTGCTATGAAATTTGCATTTATGATATGTAACAGGGGCAAAGCCAAATTCATGTTACT
1441 CTGTTCAGTCAGAAACATTTTGTGGCATACAGCATTCCTGGGAAGTGCTGTACTTTGTTTCGTTTTGGTTTTAGTTTTGC
1521 ATTTAGAGTGCCTTATAATTGATGCCTATTTTAATAGCATTTCTTTTTAGCTTTTGGTTCGTATTTCCATTCACTGTTCG
1601 TATCTGTTACTTTCTATTAAAGCATTATCTGTTTACCACATGTACAAAAACTCTTTGAATAATATGCATTCCTAGTTTTC
1681 AGCCAAGTCGGGGATGTTAGTGATTGTACCAGCCCAAAGCACTTGGATAATCAGGGCCCTTCTTCCTTTTATAATCAATC
1761 ATCAACATCAGAAAAAGCTACTTGTTTTATTTATATTCCCTTCCAAATCCGCTCTGGAACATGCAGTAACTGCACCAAAC
1841 TTATTTTAGTAACAAATATCATTGGCAACTTTGGAATATATTTGATATTCCATTAGGATTTTTCTAAAAGGGGAAATAAA
1921 CTATATATATATATGTATCTTACCCCCAATTCTTCCAACAGAATTTCTATAGGAAGCCATGGATGATGGCATAAGTTTGC
2001 CACATATTACATGATTTTAAATAATCCTCAAAATACCCAAGGAACTCTTAAAGAGTTTTGGTATGAGTATACTACTTTGG
2081 TTTAATTTTAGCTTCATGGATGTTCTGCATGGAAGGATTTTTGTTTTCCACATTTTCCCATTGCTAGCAGAGTGAAATCC
2161 AAGAGACCAAACATTTGCAAGCATTGTATTTGAGCACTTTTGTAAAAAACAAAGAAAAAGAAAAAAAAGAAAATATATAT
2241 AATACTAAAAAAAAGTATCTAGAAGGCTACCTCAGAATGAGACTCTCTAACCTACATCAGAACCAGAGAAGAATGTGCAC
2321 TATGTGGGTCTGTTATCATTATTTTCTTTTAGTTTGTATCTTTTTGGAGATTTATCCAAGTGCCAGATTACTCAGTGCTA
2401 TAATTTTCTTTTAGTTAAACAAAGGGGGTCAGACAGACATTGCATCATCCAGACATGCCTTGTTGGACATGTAGAATCCG
2481 ATGGAGCACTGCACACCAGAATGATTGGCCAATGAGCAGCTTCTCTCCCTGAAACAATAACTGCCCATTTGGCAAAGGGA
2561 AAGATGACAATAATCAGAAGAAGAAAATGAATGGGATGCATACCATAGACGAACGAGGCGGAGACTATTGCGGGAATCTT
2641 ACTGTTCAGGAGCTGTTCCTAGAACTAACTCCCTTACTGTCATTGATGTGCATTCCACTCTGTGCTTTTCTGTACAACCA
2721 TTCAAGTTTTAATTTCCCAGGTGAACCATCTTTATCTGCCATTACCACAAGCTTTCAAGTTTCCAGTTATTTTCATCATC
2801 ATAACCAGTACGGTGCTATTATTTACCTATGTACGTGTAGTTATGTATAATTTTGTAATTAGTTACAATGGTAAAAAAAA
2881 TCAAAATATATAAAAAGTGATTTGTACAGAACTTTATTTTAGCTCTTTTTTAAAAATGATTTGCATGGTTAGAAAACGGC
2961 GAGGACAGCCAGGGGAGGGAAGGGCCTCTAGGGAACTTTGCACTTTCTATACCTTTGTACTATGCACTGCCCTATTGATT
3041 CTACACCCAATAATGATATTACTTGAACCCATCTGTAAGAAACTGCTTCGGAAATTCATTTGTGTGTATGTAAATAACAC
3121 AACATAGAAACAGGAAGGGAAAAAAGTCTGCAGTAATGCACGTATTTTTTTTCTTTCCTGTTTATTTTCGGTTTTGCTTT
3201 AAGTCCTTTTATTTTTAATTCCCTTTTTGTTTTTCTTTTTGGGTTTTGGTTCCTTTTGGGTTTATGGGTGCCCTGATACT
3281 CCAGCAGAGATCAGAAGGCTACAGATCCATTCTATCCATCCGTTATGTGGCTTTGCCATCCCAGCTTGGAGTGTCTTTAC
3361 AAAGATAATAACAGTTGTGTTCTTTGCTCTCGTTTTGGATGCATAGACTGAAAAATTAAAACAAATAACTTGTAAAATGG
3441 CTTGTTAAAAAATACAATTACCTCTAATTAGTAGTACGCGTAAATGTTTTACAGAATGAAAGGCGTGCTTTTTATTTTCT
3521 TACTTCGTTACATTGGTGGCGAAAGAAGTCTGTATGAAAATCAGTTCTTTGCTGACACAAGTTCCATTTGTTACAAATGA
3601 ATTCTAATAAAAATGTCAGTGTTATGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            |||| :|| | | ||||||| 
Target 5' cgCAAAGTATAAAGTTGCTGCTa 3'
863 - 885 164.00 -16.60
2
miRNA  3' guGUU-UGGU-AAUACACGACGAu 5'
            ||: || |  ||||||||| | 
Target 5' ttCAGCACAAGATATGTGCTGGTg 3'
360 - 383 132.00 -19.50
3
miRNA  3' gugUUUGGU-AAUACACGACgau 5'
             |||:|| || | |||||   
Target 5' tgaAAATCAGTTCTTTGCTGaca 3'
3555 - 3577 127.00 -8.82
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN32067142 1 COSMIC
COSN30627505 5 COSMIC
COSN31613316 14 COSMIC
COSN30452238 26 COSMIC
COSN31496214 33 COSMIC
COSN510275 37 COSMIC
COSN26991025 45 COSMIC
COSN30168791 46 COSMIC
COSN21430113 53 COSMIC
COSN30474584 55 COSMIC
COSN30480594 57 COSMIC
COSN30102541 60 COSMIC
COSN26732175 62 COSMIC
COSN26726598 63 COSMIC
COSN510274 81 COSMIC
COSN30476499 88 COSMIC
COSN30452048 89 COSMIC
COSN30452068 90 COSMIC
COSN30152144 91 COSMIC
COSN31519614 112 COSMIC
COSN20121629 116 COSMIC
COSN30127321 134 COSMIC
COSN30452134 136 COSMIC
COSN510273 143 COSMIC
COSN30486495 158 COSMIC
COSN30148341 161 COSMIC
COSN30179252 168 COSMIC
COSN14399760 171 COSMIC
COSN30465144 173 COSMIC
COSN26572126 188 COSMIC
COSN2329749 255 COSMIC
COSN30176931 259 COSMIC
COSN31525058 279 COSMIC
COSN1381663 290 COSMIC
COSN30539686 336 COSMIC
COSN30163437 370 COSMIC
COSN30161777 390 COSMIC
COSN18905717 398 COSMIC
COSN31544762 425 COSMIC
COSN4890571 456 COSMIC
COSN20091891 458 COSMIC
COSN31580154 557 COSMIC
COSN31523557 576 COSMIC
COSN30543830 578 COSMIC
COSN31548280 582 COSMIC
COSN31481190 604 COSMIC
COSN26706409 615 COSMIC
COSN31485563 616 COSMIC
COSN23522109 620 COSMIC
COSN31520756 707 COSMIC
COSN31484413 748 COSMIC
COSN9524494 795 COSMIC
COSN17016568 863 COSMIC
COSN31537538 918 COSMIC
COSN31522387 951 COSMIC
COSN25892201 957 COSMIC
COSN16752193 976 COSMIC
COSN17872896 1054 COSMIC
COSN31482532 1093 COSMIC
COSN24303014 1110 COSMIC
COSN9318735 1126 COSMIC
COSN32063692 1153 COSMIC
COSN31570274 1176 COSMIC
COSN28831104 1275 COSMIC
COSN31548736 1336 COSMIC
COSN21448354 1501 COSMIC
COSN31588183 1605 COSMIC
COSN26087559 1610 COSMIC
COSN31488224 1623 COSMIC
COSN31517933 1809 COSMIC
COSN31610076 1901 COSMIC
COSN20106032 1922 COSMIC
COSN8583423 1994 COSMIC
COSN29274627 2073 COSMIC
COSN28202207 2153 COSMIC
COSN29639070 2246 COSMIC
COSN31517945 2259 COSMIC
COSN26363358 2479 COSMIC
COSN9318734 2508 COSMIC
COSN31490560 2632 COSMIC
COSN31516246 2665 COSMIC
COSN31556221 2693 COSMIC
COSN26586446 2718 COSMIC
COSN26636216 2746 COSMIC
COSN25346837 2769 COSMIC
COSN31569818 2811 COSMIC
COSN31523135 2872 COSMIC
COSN14949881 2886 COSMIC
COSN29854536 2904 COSMIC
COSN31515573 2909 COSMIC
COSN9318733 2959 COSMIC
COSN19379447 2983 COSMIC
COSN26603797 3062 COSMIC
COSN31524033 3092 COSMIC
COSN23480425 3187 COSMIC
COSN25950775 3220 COSMIC
COSN27362697 3322 COSMIC
COSN24270216 3355 COSMIC
COSN31480185 3364 COSMIC
COSN28726053 3372 COSMIC
COSN31593924 3375 COSMIC
COSN31585901 3382 COSMIC
COSN31548726 3504 COSMIC
COSN31519382 3526 COSMIC
COSN6396121 3582 COSMIC
COSN26394692 3611 COSMIC
COSN9318732 3625 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1178876431 4 dbSNP
rs1477339915 6 dbSNP
rs371954452 7 dbSNP
rs199614036 8 dbSNP
rs35081204 8 dbSNP
rs759482901 11 dbSNP
rs1283159237 12 dbSNP
rs200538526 16 dbSNP
rs1208743344 18 dbSNP
rs753831622 19 dbSNP
rs369863041 20 dbSNP
rs772638272 22 dbSNP
rs767134950 25 dbSNP
rs761512320 26 dbSNP
rs1216193863 29 dbSNP
rs375242845 30 dbSNP
rs1273728986 31 dbSNP
rs1453085163 32 dbSNP
rs1156870963 33 dbSNP
rs201687555 34 dbSNP
rs749698798 35 dbSNP
rs776085586 36 dbSNP
rs1408873968 40 dbSNP
rs769721404 42 dbSNP
rs990927572 47 dbSNP
rs960487289 52 dbSNP
rs1034736185 62 dbSNP
rs1453203617 66 dbSNP
rs1294304636 67 dbSNP
rs1393180383 70 dbSNP
rs757696509 71 dbSNP
rs1302936911 80 dbSNP
rs1301086009 82 dbSNP
rs1404522943 89 dbSNP
rs902370578 91 dbSNP
rs1385632023 96 dbSNP
rs1160218953 99 dbSNP
rs1049677443 102 dbSNP
rs1455462899 103 dbSNP
rs931185981 107 dbSNP
rs867897347 108 dbSNP
rs1265627944 112 dbSNP
rs751126261 113 dbSNP
rs181789653 116 dbSNP
rs190535252 117 dbSNP
rs900451395 125 dbSNP
rs1181466494 126 dbSNP
rs1480904632 129 dbSNP
rs527455972 133 dbSNP
rs1248376648 139 dbSNP
rs1197262900 146 dbSNP
rs942697900 151 dbSNP
rs1451366721 153 dbSNP
rs891175963 158 dbSNP
rs560120679 162 dbSNP
rs1263133612 164 dbSNP
rs930104621 168 dbSNP
rs373703281 171 dbSNP
rs918740893 174 dbSNP
rs928699466 180 dbSNP
rs974268956 180 dbSNP
rs1412120360 183 dbSNP
rs941614240 189 dbSNP
rs916858908 190 dbSNP
rs1373291432 191 dbSNP
rs1390268279 192 dbSNP
rs915871901 194 dbSNP
rs1323081382 197 dbSNP
rs990370092 202 dbSNP
rs957587187 203 dbSNP
rs1326790592 207 dbSNP
rs1342567583 207 dbSNP
rs1207068835 208 dbSNP
rs1249492857 209 dbSNP
rs1031817356 212 dbSNP
rs1182452571 212 dbSNP
rs990463305 216 dbSNP
rs960662640 217 dbSNP
rs1432819043 218 dbSNP
rs1442916665 222 dbSNP
rs1183204400 223 dbSNP
rs1034705010 224 dbSNP
rs1391063872 226 dbSNP
rs977790867 227 dbSNP
rs1168808908 228 dbSNP
rs977539111 238 dbSNP
rs542094692 239 dbSNP
rs1019781710 257 dbSNP
rs1158550879 259 dbSNP
rs1365495413 260 dbSNP
rs1007940756 261 dbSNP
rs1216047219 262 dbSNP
rs148195513 269 dbSNP
rs1011193657 271 dbSNP
rs763488571 273 dbSNP
rs1017946212 279 dbSNP
rs995441161 279 dbSNP
rs1460014450 283 dbSNP
rs1203147531 289 dbSNP
rs1006863507 290 dbSNP
rs898398261 291 dbSNP
rs1185080504 292 dbSNP
rs868442049 294 dbSNP
rs1419248516 298 dbSNP
rs891150390 306 dbSNP
rs558641074 311 dbSNP
rs1374009683 316 dbSNP
rs1051119591 318 dbSNP
rs994239913 323 dbSNP
rs939843036 329 dbSNP
rs897279038 330 dbSNP
rs1286814461 332 dbSNP
rs1046234039 334 dbSNP
rs1038546552 335 dbSNP
rs1219631134 343 dbSNP
rs370270492 349 dbSNP
rs941529616 359 dbSNP
rs948797497 360 dbSNP
rs1321356494 362 dbSNP
rs990083213 370 dbSNP
rs55860333 372 dbSNP
rs1276139010 374 dbSNP
rs1213895218 375 dbSNP
rs752323680 381 dbSNP
rs941152507 387 dbSNP
rs1218291323 388 dbSNP
rs924851659 391 dbSNP
rs1427738872 396 dbSNP
rs1055800753 397 dbSNP
rs939009928 402 dbSNP
rs764891038 403 dbSNP
rs1364434921 409 dbSNP
rs186073112 410 dbSNP
rs1453561907 411 dbSNP
rs1436872584 415 dbSNP
rs759259124 416 dbSNP
rs1304744429 417 dbSNP
rs986970687 418 dbSNP
rs1404258662 419 dbSNP
rs142654193 420 dbSNP
rs1352909851 423 dbSNP
rs1222167848 431 dbSNP
rs1332214085 432 dbSNP
rs1322563288 433 dbSNP
rs953800598 434 dbSNP
rs1414148511 437 dbSNP
rs1490305386 442 dbSNP
rs1420430520 443 dbSNP
rs1170923292 445 dbSNP
rs116361362 447 dbSNP
rs1470857617 455 dbSNP
rs566868083 458 dbSNP
rs1064271 461 dbSNP
rs1064270 462 dbSNP
rs1446908333 462 dbSNP
rs1405604103 465 dbSNP
rs1015517768 469 dbSNP
rs1004093670 472 dbSNP
rs1423827762 480 dbSNP
rs964914183 480 dbSNP
rs554938674 485 dbSNP
rs1009211253 486 dbSNP
rs1279034240 491 dbSNP
rs1478111885 491 dbSNP
rs1248429890 492 dbSNP
rs1045540229 495 dbSNP
rs199882073 499 dbSNP
rs373357032 499 dbSNP
rs1359130221 504 dbSNP
rs1438071646 508 dbSNP
rs1275664831 513 dbSNP
rs1274650650 514 dbSNP
rs1436594677 516 dbSNP
rs1231814153 519 dbSNP
rs546720188 521 dbSNP
rs1444780817 523 dbSNP
rs1185031127 524 dbSNP
rs1383048395 525 dbSNP
rs894544217 535 dbSNP
rs1054412726 537 dbSNP
rs147710537 538 dbSNP
rs760679353 539 dbSNP
rs1328164445 546 dbSNP
rs1315720510 548 dbSNP
rs754993152 550 dbSNP
rs1376805215 553 dbSNP
rs543766599 554 dbSNP
rs1042371298 557 dbSNP
rs1229522519 558 dbSNP
rs954639526 559 dbSNP
rs1337938084 566 dbSNP
rs944950989 566 dbSNP
rs879030066 568 dbSNP
rs1355374055 571 dbSNP
rs1029661344 572 dbSNP
rs1310077361 572 dbSNP
rs1205038077 578 dbSNP
rs1240816420 581 dbSNP
rs1428284393 582 dbSNP
rs554904607 583 dbSNP
rs912067509 584 dbSNP
rs1474331115 589 dbSNP
rs994210382 590 dbSNP
rs774624497 592 dbSNP
rs1038871389 598 dbSNP
rs145536755 599 dbSNP
rs921007276 600 dbSNP
rs1213156754 602 dbSNP
rs1180824609 603 dbSNP
rs1325028213 604 dbSNP
rs1470172066 604 dbSNP
rs754006361 604 dbSNP
rs973774434 605 dbSNP
rs530103368 608 dbSNP
rs768592049 609 dbSNP
rs1224738517 610 dbSNP
rs181952363 612 dbSNP
rs1205329170 613 dbSNP
rs1263455716 615 dbSNP
rs1445027137 619 dbSNP
rs895324836 620 dbSNP
rs1292240585 624 dbSNP
rs1004550100 627 dbSNP
rs971315419 627 dbSNP
rs1174273778 628 dbSNP
rs1055325008 630 dbSNP
rs747419127 630 dbSNP
rs1024582987 631 dbSNP
rs1319903591 632 dbSNP
rs939595782 637 dbSNP
rs7863978 638 dbSNP
rs1324616461 642 dbSNP
rs894596901 645 dbSNP
rs1403619772 650 dbSNP
rs3215100 650 dbSNP
rs397840052 650 dbSNP
rs1322170253 651 dbSNP
rs1041994771 652 dbSNP
rs945050276 653 dbSNP
rs914963524 655 dbSNP
rs944977034 658 dbSNP
rs1269329892 661 dbSNP
rs1408235093 663 dbSNP
rs1197166942 665 dbSNP
rs989652935 666 dbSNP
rs1419711836 667 dbSNP
rs1184110336 668 dbSNP
rs1362206407 669 dbSNP
rs188017506 671 dbSNP
rs1350058845 672 dbSNP
rs1304156882 676 dbSNP
rs1367820745 685 dbSNP
rs1423173073 688 dbSNP
rs1459750698 690 dbSNP
rs1051068936 692 dbSNP
rs1308525103 692 dbSNP
rs571692356 693 dbSNP
rs1333548931 694 dbSNP
rs910364495 694 dbSNP
rs1292115980 696 dbSNP
rs1361295214 698 dbSNP
rs932136578 699 dbSNP
rs1290889674 700 dbSNP
rs1480918803 703 dbSNP
rs547095492 709 dbSNP
rs1248488447 715 dbSNP
rs1418624344 717 dbSNP
rs920723929 720 dbSNP
rs1163354241 721 dbSNP
rs534843727 721 dbSNP
rs954609004 730 dbSNP
rs1413553762 732 dbSNP
rs1463975555 732 dbSNP
rs908221681 733 dbSNP
rs962423959 733 dbSNP
rs1315268042 734 dbSNP
rs1156238592 736 dbSNP
rs1243430516 738 dbSNP
rs367665926 740 dbSNP
rs1206508818 743 dbSNP
rs1204409496 746 dbSNP
rs982447969 746 dbSNP
rs1460154178 748 dbSNP
rs1183291381 749 dbSNP
rs1472080043 750 dbSNP
rs184415849 751 dbSNP
rs1430715949 754 dbSNP
rs780162392 754 dbSNP
rs1024217646 758 dbSNP
rs1192744048 758 dbSNP
rs557750839 759 dbSNP
rs1246109578 760 dbSNP
rs958540399 762 dbSNP
rs1032780111 763 dbSNP
rs534343750 767 dbSNP
rs1270125824 770 dbSNP
rs150558277 777 dbSNP
rs202190517 777 dbSNP
rs73428138 777 dbSNP
rs541219046 782 dbSNP
rs1328808269 785 dbSNP
rs555178709 787 dbSNP
rs1388956846 794 dbSNP
rs1203248692 795 dbSNP
rs1365915964 795 dbSNP
rs180990247 798 dbSNP
rs562646864 799 dbSNP
rs1179277907 802 dbSNP
rs1042142591 804 dbSNP
rs1432119521 807 dbSNP
rs1016998237 808 dbSNP
rs1345439913 812 dbSNP
rs1318010031 816 dbSNP
rs1456217544 820 dbSNP
rs1339669085 824 dbSNP
rs890744326 825 dbSNP
rs1285169797 826 dbSNP
rs79847231 826 dbSNP
rs1050704065 827 dbSNP
rs1321463561 827 dbSNP
rs1285162127 828 dbSNP
rs1431036792 829 dbSNP
rs932185672 829 dbSNP
rs899342844 832 dbSNP
rs1260487153 834 dbSNP
rs1490628725 834 dbSNP
rs1202183299 835 dbSNP
rs75115513 835 dbSNP
rs1267415950 836 dbSNP
rs762266334 836 dbSNP
rs79554842 836 dbSNP
rs1186846880 840 dbSNP
rs895263143 844 dbSNP
rs1156564370 845 dbSNP
rs756686260 846 dbSNP
rs1425111396 850 dbSNP
rs1304836769 851 dbSNP
rs1343592000 857 dbSNP
rs941110005 859 dbSNP
rs908273607 862 dbSNP
rs545915446 863 dbSNP
rs1222253279 864 dbSNP
rs1308850620 869 dbSNP
rs1034258395 871 dbSNP
rs1003667294 873 dbSNP
rs1225211049 874 dbSNP
rs1290145919 874 dbSNP
rs1206951456 877 dbSNP
rs1464496331 878 dbSNP
rs982888556 878 dbSNP
rs949743864 887 dbSNP
rs906758129 889 dbSNP
rs1470906550 891 dbSNP
rs149110910 891 dbSNP
rs916860703 894 dbSNP
rs1042631011 899 dbSNP
rs1444967993 900 dbSNP
rs1051863 901 dbSNP
rs1310597430 903 dbSNP
rs1363570918 903 dbSNP
rs1404694426 909 dbSNP
rs531958900 913 dbSNP
rs564573569 915 dbSNP
rs1215476406 917 dbSNP
rs978552518 921 dbSNP
rs1368019237 927 dbSNP
rs1296034331 931 dbSNP
rs967903385 931 dbSNP
rs1053485344 933 dbSNP
rs539930655 934 dbSNP
rs867518969 935 dbSNP
rs1215645955 936 dbSNP
rs757808920 936 dbSNP
rs890471436 940 dbSNP
rs774971561 941 dbSNP
rs1461499327 944 dbSNP
rs1185108664 946 dbSNP
rs572896752 948 dbSNP
rs1028968610 949 dbSNP
rs1421610796 958 dbSNP
rs996447191 958 dbSNP
rs1408215288 960 dbSNP
rs748998085 960 dbSNP
rs899395030 961 dbSNP
rs987265326 961 dbSNP
rs1199079903 962 dbSNP
rs1335018047 962 dbSNP
rs200853921 963 dbSNP
rs1338020957 964 dbSNP
rs3215099 964 dbSNP
rs756018955 964 dbSNP
rs1216186626 966 dbSNP
rs148988521 968 dbSNP
rs1205135461 970 dbSNP
rs1323703080 970 dbSNP
rs539893036 971 dbSNP
rs1193641790 972 dbSNP
rs1243720601 973 dbSNP
rs1476793825 973 dbSNP
rs1169967329 982 dbSNP
rs147475250 983 dbSNP
rs3830409 983 dbSNP
rs756474061 983 dbSNP
rs767244464 983 dbSNP
rs201265869 984 dbSNP
rs1170944504 987 dbSNP
rs1451065150 992 dbSNP
rs1383061685 995 dbSNP
rs752028452 995 dbSNP
rs933149585 1004 dbSNP
rs542812176 1005 dbSNP
rs189841566 1008 dbSNP
rs145759921 1009 dbSNP
rs150496605 1017 dbSNP
rs574351383 1017 dbSNP
rs1253819097 1020 dbSNP
rs1256962129 1021 dbSNP
rs1202213288 1023 dbSNP
rs1343874150 1023 dbSNP
rs554876723 1028 dbSNP
rs1482414254 1030 dbSNP
rs10976945 1036 dbSNP
rs544469332 1038 dbSNP
rs1033775477 1040 dbSNP
rs1481435921 1042 dbSNP
rs1196849295 1049 dbSNP
rs1377222696 1049 dbSNP
rs1454488522 1054 dbSNP
rs1344738330 1056 dbSNP
rs553446771 1062 dbSNP
rs906728085 1065 dbSNP
rs535115207 1066 dbSNP
rs184947810 1072 dbSNP
rs1228317100 1076 dbSNP
rs1384130940 1080 dbSNP
rs1368011617 1084 dbSNP
rs1314275977 1085 dbSNP
rs1298546306 1088 dbSNP
rs967241711 1089 dbSNP
rs1393767211 1094 dbSNP
rs1021101428 1098 dbSNP
rs1239277026 1099 dbSNP
rs1020504763 1103 dbSNP
rs1351172039 1106 dbSNP
rs1215667450 1107 dbSNP
rs1292321025 1110 dbSNP
rs1490823512 1111 dbSNP
rs201867677 1112 dbSNP
rs369962121 1112 dbSNP
rs528489757 1112 dbSNP
rs551708359 1112 dbSNP
rs575455208 1117 dbSNP
rs996163965 1118 dbSNP
rs894091694 1122 dbSNP
rs558685980 1123 dbSNP
rs1164625756 1126 dbSNP
rs142934678 1128 dbSNP
rs1456839053 1128 dbSNP
rs539214595 1128 dbSNP
rs1389360730 1129 dbSNP
rs1368488913 1133 dbSNP
rs375094080 1138 dbSNP
rs1167660074 1141 dbSNP
rs888829639 1141 dbSNP
rs1374204589 1143 dbSNP
rs1239086353 1146 dbSNP
rs886616099 1146 dbSNP
rs1361409684 1147 dbSNP
rs1051524403 1152 dbSNP
rs1480970315 1153 dbSNP
rs1197638177 1157 dbSNP
rs1046977423 1161 dbSNP
rs1425258245 1164 dbSNP
rs1184513793 1166 dbSNP
rs1387437515 1168 dbSNP
rs1422488641 1168 dbSNP
rs28554480 1168 dbSNP
rs919075949 1169 dbSNP
rs553410955 1171 dbSNP
rs550443969 1176 dbSNP
rs971922991 1180 dbSNP
rs1172206966 1184 dbSNP
rs192004535 1185 dbSNP
rs1445572066 1187 dbSNP
rs1337024355 1188 dbSNP
rs748026689 1189 dbSNP
rs549255282 1196 dbSNP
rs945927090 1196 dbSNP
rs564535076 1199 dbSNP
rs913082556 1199 dbSNP
rs1256235123 1200 dbSNP
rs1190755910 1202 dbSNP
rs1317417956 1202 dbSNP
rs546229725 1207 dbSNP
rs187583325 1209 dbSNP
rs1272972023 1212 dbSNP
rs1262971819 1214 dbSNP
rs1204822188 1215 dbSNP
rs954844523 1216 dbSNP
rs922001057 1217 dbSNP
rs974779693 1219 dbSNP
rs1464691487 1225 dbSNP
rs963375683 1231 dbSNP
rs959412700 1236 dbSNP
rs1005154209 1238 dbSNP
rs1302036653 1242 dbSNP
rs536286218 1243 dbSNP
rs1401737435 1246 dbSNP
rs572193416 1247 dbSNP
rs1276285139 1249 dbSNP
rs1339869739 1251 dbSNP
rs1224237572 1254 dbSNP
rs781359870 1256 dbSNP
rs951015202 1256 dbSNP
rs529075185 1257 dbSNP
rs1014163684 1259 dbSNP
rs563507728 1261 dbSNP
rs1487075834 1264 dbSNP
rs1192096774 1265 dbSNP
rs926676110 1266 dbSNP
rs982143052 1268 dbSNP
rs1199532845 1269 dbSNP
rs1426735077 1270 dbSNP
rs1431094470 1272 dbSNP
rs1174968018 1277 dbSNP
rs1307209818 1279 dbSNP
rs1345544841 1285 dbSNP
rs560786082 1301 dbSNP
rs1296223725 1309 dbSNP
rs904212223 1313 dbSNP
rs1405570287 1314 dbSNP
rs1276675549 1317 dbSNP
rs1043089618 1320 dbSNP
rs1218835111 1322 dbSNP
rs1392872779 1322 dbSNP
rs946006551 1324 dbSNP
rs913124956 1325 dbSNP
rs1214942967 1329 dbSNP
rs753740509 1329 dbSNP
rs1161374167 1334 dbSNP
rs1051636679 1336 dbSNP
rs1476785602 1336 dbSNP
rs921724335 1337 dbSNP
rs1021070351 1339 dbSNP
rs974830452 1340 dbSNP
rs1473707164 1345 dbSNP
rs1009730643 1346 dbSNP
rs963427049 1346 dbSNP
rs1348177101 1350 dbSNP
rs958493272 1353 dbSNP
rs983845489 1353 dbSNP
rs1181959062 1364 dbSNP
rs1238324310 1365 dbSNP
rs1308990339 1365 dbSNP
rs1360669997 1367 dbSNP
rs542726146 1368 dbSNP
rs1288377234 1369 dbSNP
rs1449337642 1370 dbSNP
rs1007609970 1376 dbSNP
rs1220193459 1379 dbSNP
rs184765202 1383 dbSNP
rs951031600 1385 dbSNP
rs1025645718 1389 dbSNP
rs1051453922 1399 dbSNP
rs1237305843 1408 dbSNP
rs12340202 1409 dbSNP
rs1164873458 1410 dbSNP
rs1411571771 1410 dbSNP
rs1171236322 1411 dbSNP
rs897615164 1411 dbSNP
rs1268251184 1414 dbSNP
rs1444804599 1416 dbSNP
rs1229651301 1417 dbSNP
rs1450675877 1419 dbSNP
rs1036156239 1420 dbSNP
rs1287293214 1424 dbSNP
rs941880093 1425 dbSNP
rs1356279751 1428 dbSNP
rs192464460 1433 dbSNP
rs545709626 1434 dbSNP
rs1321259630 1435 dbSNP
rs1386168297 1438 dbSNP
rs1319436685 1439 dbSNP
rs1385517480 1451 dbSNP
rs1196340343 1456 dbSNP
rs1257053724 1460 dbSNP
rs543656029 1462 dbSNP
rs1458860151 1463 dbSNP
rs1410117864 1469 dbSNP
rs1189365793 1471 dbSNP
rs904261267 1476 dbSNP
rs1158691187 1480 dbSNP
rs1021318370 1486 dbSNP
rs1478446111 1488 dbSNP
rs773318273 1488 dbSNP
rs1055732884 1489 dbSNP
rs937279004 1492 dbSNP
rs780225287 1497 dbSNP
rs1220458665 1498 dbSNP
rs578262303 1501 dbSNP
rs933190318 1502 dbSNP
rs982112058 1508 dbSNP
rs1432069949 1513 dbSNP
rs1280703524 1517 dbSNP
rs1216286367 1521 dbSNP
rs1256950026 1524 dbSNP
rs900348940 1538 dbSNP
rs1201878174 1543 dbSNP
rs1266870256 1551 dbSNP
rs970783985 1555 dbSNP
rs1200678776 1556 dbSNP
rs1217191443 1556 dbSNP
rs1346631365 1557 dbSNP
rs1476844553 1560 dbSNP
rs772334766 1563 dbSNP
rs1479126021 1564 dbSNP
rs1038868747 1566 dbSNP
rs1171076828 1570 dbSNP
rs1401915556 1573 dbSNP
rs1401672633 1577 dbSNP
rs1272879235 1580 dbSNP
rs115552424 1581 dbSNP
rs1397522912 1585 dbSNP
rs988682281 1586 dbSNP
rs1331223975 1589 dbSNP
rs909280419 1590 dbSNP
rs1343985354 1594 dbSNP
rs11542527 1596 dbSNP
rs1240608972 1598 dbSNP
rs538088218 1599 dbSNP
rs1487261253 1600 dbSNP
rs1215892065 1602 dbSNP
rs1299725768 1604 dbSNP
rs1198787480 1606 dbSNP
rs1453447330 1607 dbSNP
rs149809695 1612 dbSNP
rs569080079 1614 dbSNP
rs983512341 1615 dbSNP
rs1378914249 1616 dbSNP
rs1386561852 1618 dbSNP
rs929302938 1623 dbSNP
rs879786156 1631 dbSNP
rs1388045715 1636 dbSNP
rs1317649175 1641 dbSNP
rs917893741 1642 dbSNP
rs374064392 1644 dbSNP
rs1007785351 1645 dbSNP
rs1311181888 1649 dbSNP
rs1477889319 1650 dbSNP
rs1239308325 1651 dbSNP
rs1265982525 1651 dbSNP
rs1391402964 1652 dbSNP
rs762956367 1656 dbSNP
rs1236710482 1657 dbSNP
rs1266865180 1657 dbSNP
rs1458370744 1657 dbSNP
rs953768946 1665 dbSNP
rs979556105 1668 dbSNP
rs1029966405 1669 dbSNP
rs1458943062 1674 dbSNP
rs188881553 1681 dbSNP
rs1393184811 1682 dbSNP
rs897572676 1683 dbSNP
rs552440513 1684 dbSNP
rs1374316516 1689 dbSNP
rs117795823 1690 dbSNP
rs1313255109 1692 dbSNP
rs887595184 1693 dbSNP
rs1242585114 1696 dbSNP
rs1264932133 1698 dbSNP
rs1318740731 1699 dbSNP
rs537583955 1702 dbSNP
rs1256436505 1704 dbSNP
rs769979426 1705 dbSNP
rs997451769 1707 dbSNP
rs1056048285 1719 dbSNP
rs1258771177 1720 dbSNP
rs568702396 1734 dbSNP
rs1187511886 1735 dbSNP
rs907131129 1739 dbSNP
rs1416498258 1740 dbSNP
rs1465709053 1743 dbSNP
rs1172320790 1751 dbSNP
rs556784350 1754 dbSNP
rs1276029211 1755 dbSNP
rs372538225 1762 dbSNP
rs1461241809 1763 dbSNP
rs1038920716 1764 dbSNP
rs139671444 1765 dbSNP
rs1048287723 1768 dbSNP
rs560016721 1769 dbSNP
rs1317507375 1772 dbSNP
rs377108589 1777 dbSNP
rs1482510688 1780 dbSNP
rs1200334180 1788 dbSNP
rs1264567492 1789 dbSNP
rs1477823520 1791 dbSNP
rs1199729789 1793 dbSNP
rs146061470 1794 dbSNP
rs1294868983 1795 dbSNP
rs926868150 1796 dbSNP
rs979607074 1806 dbSNP
rs1360658620 1809 dbSNP
rs182834110 1810 dbSNP
rs143455816 1811 dbSNP
rs567284459 1817 dbSNP
rs560519523 1820 dbSNP
rs1448823223 1822 dbSNP
rs1220014203 1826 dbSNP
rs1303709049 1828 dbSNP
rs1310765658 1830 dbSNP
rs1342534158 1832 dbSNP
rs1030434508 1834 dbSNP
rs530666418 1835 dbSNP
rs1489547257 1836 dbSNP
rs1215163875 1837 dbSNP
rs1260365218 1840 dbSNP
rs747323988 1845 dbSNP
rs997177911 1846 dbSNP
rs1191376308 1847 dbSNP
rs986710334 1849 dbSNP
rs192479195 1855 dbSNP
rs1017535707 1856 dbSNP
rs953610265 1857 dbSNP
rs1371559740 1858 dbSNP
rs545572640 1861 dbSNP
rs1030624178 1864 dbSNP
rs1380755109 1873 dbSNP
rs1170827032 1878 dbSNP
rs1296319026 1879 dbSNP
rs1344636822 1884 dbSNP
rs188098119 1885 dbSNP
rs1428403917 1890 dbSNP
rs559763506 1892 dbSNP
rs1181976989 1893 dbSNP
rs1310439931 1894 dbSNP
rs1356336864 1895 dbSNP
rs1473490544 1896 dbSNP
rs544514184 1897 dbSNP
rs541733078 1898 dbSNP
rs573934376 1911 dbSNP
rs183010438 1913 dbSNP
rs543549504 1916 dbSNP
rs1487301414 1917 dbSNP
rs1238539164 1918 dbSNP
rs1253748793 1919 dbSNP
rs1202703892 1920 dbSNP
rs1034147945 1921 dbSNP
rs1491147139 1921 dbSNP
rs1491405229 1922 dbSNP
rs896554222 1922 dbSNP
rs1001813380 1924 dbSNP
rs750916622 1924 dbSNP
rs1332352108 1926 dbSNP
rs796896290 1931 dbSNP
rs201493871 1933 dbSNP
rs1279429761 1935 dbSNP
rs4008232 1935 dbSNP
rs564224943 1935 dbSNP
rs5896234 1935 dbSNP
rs779560100 1937 dbSNP
rs1358549895 1942 dbSNP
rs1291364146 1943 dbSNP
rs758868484 1946 dbSNP
rs1392561811 1947 dbSNP
rs949368328 1949 dbSNP
rs1258343121 1952 dbSNP
rs1458869711 1959 dbSNP
rs1179410913 1961 dbSNP
rs892441490 1969 dbSNP
rs1052875795 1970 dbSNP
rs1282430347 1982 dbSNP
rs565235453 1987 dbSNP
rs1411689013 1989 dbSNP
rs557837150 1991 dbSNP
rs1464318660 1995 dbSNP
rs1328602015 1999 dbSNP
rs914073990 2000 dbSNP
rs988308037 2002 dbSNP
rs1282969712 2004 dbSNP
rs956018297 2011 dbSNP
rs778469709 2015 dbSNP
rs1278368884 2017 dbSNP
rs925359377 2025 dbSNP
rs1310289491 2026 dbSNP
rs923014762 2029 dbSNP
rs986310882 2031 dbSNP
rs1408352175 2034 dbSNP
rs975790961 2041 dbSNP
rs1255357301 2044 dbSNP
rs1474889432 2046 dbSNP
rs1194463964 2048 dbSNP
rs932169074 2050 dbSNP
rs1407520226 2053 dbSNP
rs1476946823 2063 dbSNP
rs754729325 2067 dbSNP
rs1416552400 2068 dbSNP
rs1332697381 2071 dbSNP
rs538408644 2072 dbSNP
rs1163532278 2073 dbSNP
rs755578831 2076 dbSNP
rs1401204043 2079 dbSNP
rs1472727784 2080 dbSNP
rs1253500108 2088 dbSNP
rs1017254249 2090 dbSNP
rs962302985 2091 dbSNP
rs1014557872 2102 dbSNP
rs984866759 2104 dbSNP
rs190388550 2115 dbSNP
rs185929527 2123 dbSNP
rs951826904 2129 dbSNP
rs1026596347 2133 dbSNP
rs1449752702 2137 dbSNP
rs753512462 2137 dbSNP
rs1287837870 2138 dbSNP
rs1192698837 2139 dbSNP
rs993335066 2148 dbSNP
rs1034547528 2151 dbSNP
rs1232725739 2152 dbSNP
rs1330126203 2156 dbSNP
rs1056475159 2165 dbSNP
rs1227003705 2167 dbSNP
rs1002208652 2168 dbSNP
rs1361841483 2172 dbSNP
rs1380057601 2173 dbSNP
rs1317113192 2177 dbSNP
rs1331313819 2177 dbSNP
rs1438255199 2183 dbSNP
rs766093756 2184 dbSNP
rs907068656 2186 dbSNP
rs1346943737 2187 dbSNP
rs1240728990 2190 dbSNP
rs905215940 2191 dbSNP
rs1373070848 2195 dbSNP
rs755998199 2196 dbSNP
rs1294417150 2210 dbSNP
rs1065682 2214 dbSNP
rs1043684168 2215 dbSNP
rs1192026467 2217 dbSNP
rs1453535024 2217 dbSNP
rs946981800 2218 dbSNP
rs1440720846 2219 dbSNP
rs1024110483 2220 dbSNP
rs1450924350 2226 dbSNP
rs1053072470 2229 dbSNP
rs1390880817 2229 dbSNP
rs914144526 2229 dbSNP
rs879549328 2230 dbSNP
rs1457284710 2234 dbSNP
rs1369928238 2236 dbSNP
rs891720260 2236 dbSNP
rs922732268 2237 dbSNP
rs1333896914 2239 dbSNP
rs975844974 2240 dbSNP
rs1463710485 2245 dbSNP
rs1156494775 2246 dbSNP
rs1212000236 2247 dbSNP
rs1272821477 2252 dbSNP
rs1200927764 2255 dbSNP
rs1458443294 2255 dbSNP
rs571993450 2255 dbSNP
rs1491537336 2256 dbSNP
rs1188910712 2258 dbSNP
rs1368490776 2259 dbSNP
rs1418095390 2263 dbSNP
rs1052405926 2266 dbSNP
rs534954200 2267 dbSNP
rs1162268246 2269 dbSNP
rs183006249 2271 dbSNP
rs1001310467 2274 dbSNP
rs190812935 2282 dbSNP
rs530526616 2287 dbSNP
rs932074207 2291 dbSNP
rs1394113588 2298 dbSNP
rs750175183 2300 dbSNP
rs114870484 2306 dbSNP
rs1313369569 2307 dbSNP
rs972351200 2313 dbSNP
rs545302702 2321 dbSNP
rs1318850773 2322 dbSNP
rs1213215315 2325 dbSNP
rs551517914 2327 dbSNP
rs908159590 2330 dbSNP
rs761807121 2332 dbSNP
rs1201488819 2333 dbSNP
rs533539103 2336 dbSNP
rs745800654 2342 dbSNP
rs1316517185 2345 dbSNP
rs559930509 2351 dbSNP
rs1302440249 2355 dbSNP
rs367644107 2356 dbSNP
rs905268233 2357 dbSNP
rs1022281514 2358 dbSNP
rs951829925 2359 dbSNP
rs927044286 2361 dbSNP
rs1371075549 2364 dbSNP
rs1461318328 2366 dbSNP
rs1052710910 2382 dbSNP
rs1377214019 2386 dbSNP
rs934209461 2397 dbSNP
rs901362638 2398 dbSNP
rs1039878794 2400 dbSNP
rs979797117 2401 dbSNP
rs1307215751 2408 dbSNP
rs781128637 2408 dbSNP
rs910298511 2411 dbSNP
rs1491399594 2412 dbSNP
rs35927591 2412 dbSNP
rs757062411 2413 dbSNP
rs1452629945 2417 dbSNP
rs984901026 2420 dbSNP
rs930326525 2425 dbSNP
rs1178011855 2428 dbSNP
rs1412538996 2432 dbSNP
rs1024056668 2434 dbSNP
rs972017239 2437 dbSNP
rs1176503117 2438 dbSNP
rs751369688 2442 dbSNP
rs541350225 2446 dbSNP
rs553386246 2449 dbSNP
rs955978197 2456 dbSNP
rs1167542381 2458 dbSNP
rs1172962890 2462 dbSNP
rs1189153103 2464 dbSNP
rs1432984911 2469 dbSNP
rs1287277000 2472 dbSNP
rs1034838111 2476 dbSNP
rs562247477 2481 dbSNP
rs1306047242 2492 dbSNP
rs1451181607 2492 dbSNP
rs1346224638 2493 dbSNP
rs1475852355 2495 dbSNP
rs543368796 2496 dbSNP
rs576040794 2498 dbSNP
rs1234136859 2500 dbSNP
rs557800319 2505 dbSNP
rs1287398848 2508 dbSNP
rs903831419 2512 dbSNP
rs980559267 2519 dbSNP
rs775491250 2523 dbSNP
rs1485687504 2525 dbSNP
rs1485336866 2529 dbSNP
rs1191451868 2531 dbSNP
rs1050432148 2537 dbSNP
rs996231020 2544 dbSNP
rs1192860049 2548 dbSNP
rs375347893 2556 dbSNP
rs1011375090 2558 dbSNP
rs1402440308 2560 dbSNP
rs1157011059 2563 dbSNP
rs765419165 2568 dbSNP
rs187416784 2570 dbSNP
rs1328197697 2575 dbSNP
rs754066760 2576 dbSNP
rs1040562231 2580 dbSNP
rs1310559274 2586 dbSNP
rs1279971453 2592 dbSNP
rs940874514 2597 dbSNP
rs1222628791 2598 dbSNP
rs908105706 2600 dbSNP
rs150190644 2604 dbSNP
rs539561017 2604 dbSNP
rs577748383 2605 dbSNP
rs1274667980 2606 dbSNP
rs1381143533 2608 dbSNP
rs1039931319 2610 dbSNP
rs553175757 2611 dbSNP
rs74775961 2614 dbSNP
rs577138491 2615 dbSNP
rs536725090 2619 dbSNP
rs555384283 2620 dbSNP
rs1424503017 2625 dbSNP
rs1167278204 2627 dbSNP
rs1439592933 2629 dbSNP
rs771231076 2631 dbSNP
rs146041308 2632 dbSNP
rs180864765 2633 dbSNP
rs1279521888 2634 dbSNP
rs1371903924 2636 dbSNP
rs956092410 2639 dbSNP
rs1332218066 2641 dbSNP
rs1232344430 2642 dbSNP
rs1257206401 2643 dbSNP
rs1273421931 2647 dbSNP
rs141731832 2659 dbSNP
rs1202304101 2660 dbSNP
rs927876814 2662 dbSNP
rs148044036 2666 dbSNP
rs1257302539 2667 dbSNP
rs1415857613 2671 dbSNP
rs953996541 2672 dbSNP
rs1171716887 2677 dbSNP
rs1422046306 2679 dbSNP
rs1345003720 2683 dbSNP
rs915031635 2683 dbSNP
rs556960190 2686 dbSNP
rs569218783 2688 dbSNP
rs1226146211 2689 dbSNP
rs996219632 2696 dbSNP
rs1314149192 2703 dbSNP
rs901920634 2704 dbSNP
rs1270437898 2705 dbSNP
rs372256278 2705 dbSNP
rs1354387332 2727 dbSNP
rs1212598228 2731 dbSNP
rs1308451360 2733 dbSNP
rs1411402045 2738 dbSNP
rs1368692477 2740 dbSNP
rs7027735 2741 dbSNP
rs1005033267 2746 dbSNP
rs1212983626 2752 dbSNP
rs1255462597 2753 dbSNP
rs1485397851 2754 dbSNP
rs77595418 2759 dbSNP
rs1474583876 2761 dbSNP
rs1167698132 2768 dbSNP
rs1018538161 2770 dbSNP
rs888632888 2776 dbSNP
rs1369137280 2800 dbSNP
rs1166937056 2811 dbSNP
rs1474374674 2812 dbSNP
rs1327814292 2815 dbSNP
rs1049015320 2818 dbSNP
rs1456607868 2826 dbSNP
rs1269345154 2827 dbSNP
rs1371522394 2829 dbSNP
rs1049241623 2834 dbSNP
rs186326052 2835 dbSNP
rs1347169937 2844 dbSNP
rs778330157 2845 dbSNP
rs754569656 2847 dbSNP
rs1286514585 2851 dbSNP
rs1445467387 2855 dbSNP
rs1192810120 2865 dbSNP
rs1253972351 2866 dbSNP
rs1455881914 2866 dbSNP
rs1417393156 2872 dbSNP
rs1192230588 2873 dbSNP
rs1183431818 2880 dbSNP
rs1036063216 2881 dbSNP
rs1454813855 2881 dbSNP
rs781230510 2881 dbSNP
rs1386547228 2882 dbSNP
rs3739579 2886 dbSNP
rs1317227269 2889 dbSNP
rs1044034491 2891 dbSNP
rs1248781029 2894 dbSNP
rs1394894786 2897 dbSNP
rs927600075 2901 dbSNP
rs1044975267 2912 dbSNP
rs949752644 2915 dbSNP
rs1239734131 2916 dbSNP
rs1195748671 2920 dbSNP
rs947951527 2922 dbSNP
rs915104811 2923 dbSNP
rs1266732164 2924 dbSNP
rs1274041136 2925 dbSNP
rs1230891309 2927 dbSNP
rs531573828 2931 dbSNP
rs1212193910 2940 dbSNP
rs956848808 2945 dbSNP
rs1420171661 2946 dbSNP
rs1184662580 2948 dbSNP
rs924020347 2956 dbSNP
rs988499692 2957 dbSNP
rs773647938 2958 dbSNP
rs144472790 2960 dbSNP
rs925745311 2961 dbSNP
rs1007165349 2963 dbSNP
rs1393523997 2964 dbSNP
rs1391849882 2968 dbSNP
rs953056838 2973 dbSNP
rs1333991009 2974 dbSNP
rs978621916 2975 dbSNP
rs994735607 2996 dbSNP
rs1231727729 2998 dbSNP
rs545885349 3009 dbSNP
rs1272920198 3017 dbSNP
rs1481176704 3023 dbSNP
rs62536166 3024 dbSNP
rs1198032294 3026 dbSNP
rs897612348 3029 dbSNP
rs1437819488 3030 dbSNP
rs1180822376 3033 dbSNP
rs1036079530 3035 dbSNP
rs1003218150 3037 dbSNP
rs779869887 3044 dbSNP
rs1162380651 3045 dbSNP
rs954096963 3046 dbSNP
rs1367639346 3048 dbSNP
rs1462312146 3049 dbSNP
rs1169517185 3055 dbSNP
rs1387299945 3058 dbSNP
rs1392737206 3060 dbSNP
rs1295416926 3064 dbSNP
rs1028278744 3074 dbSNP
rs1413108713 3075 dbSNP
rs1459931299 3079 dbSNP
rs906227266 3084 dbSNP
rs755762399 3089 dbSNP
rs1044694685 3090 dbSNP
rs56407701 3091 dbSNP
rs1339270487 3099 dbSNP
rs1018974399 3106 dbSNP
rs893708053 3109 dbSNP
rs1053667576 3118 dbSNP
rs1473663129 3119 dbSNP
rs1362446814 3127 dbSNP
rs935166504 3129 dbSNP
rs1005346548 3133 dbSNP
rs1255069833 3134 dbSNP
rs1428803362 3135 dbSNP
rs1195051201 3137 dbSNP
rs1371165229 3139 dbSNP
rs886532507 3144 dbSNP
rs1429000840 3146 dbSNP
rs1434291877 3147 dbSNP
rs923762146 3147 dbSNP
rs1432946490 3148 dbSNP
rs575749245 3148 dbSNP
rs1028196637 3149 dbSNP
rs1302422392 3153 dbSNP
rs1362915921 3158 dbSNP
rs767332180 3159 dbSNP
rs944078847 3161 dbSNP
rs911248224 3162 dbSNP
rs1235616078 3169 dbSNP
rs560389000 3172 dbSNP
rs953024462 3173 dbSNP
rs1027646661 3176 dbSNP
rs968814818 3177 dbSNP
rs1485971392 3184 dbSNP
rs541182685 3190 dbSNP
rs1044654073 3198 dbSNP
rs1335879758 3200 dbSNP
rs1448675779 3207 dbSNP
rs961857976 3213 dbSNP
rs1268130461 3229 dbSNP
rs12337640 3232 dbSNP
rs1348034776 3233 dbSNP
rs1345914249 3234 dbSNP
rs1278767714 3235 dbSNP
rs1233681052 3236 dbSNP
rs138627709 3239 dbSNP
rs1442122269 3241 dbSNP
rs1306169211 3243 dbSNP
rs1052797081 3244 dbSNP
rs751545634 3253 dbSNP
rs1299959015 3256 dbSNP
rs1439996882 3257 dbSNP
rs1023292482 3258 dbSNP
rs934367384 3260 dbSNP
rs143317338 3266 dbSNP
rs1464225861 3271 dbSNP
rs1012325717 3279 dbSNP
rs1254703359 3281 dbSNP
rs1467068636 3288 dbSNP
rs1190573333 3294 dbSNP
rs978994758 3301 dbSNP
rs1459051243 3303 dbSNP
rs1420964089 3305 dbSNP
rs1383031989 3312 dbSNP
rs932530944 3314 dbSNP
rs921164006 3317 dbSNP
rs935232425 3320 dbSNP
rs902363859 3321 dbSNP
rs373535498 3322 dbSNP
rs796080761 3327 dbSNP
rs911300769 3328 dbSNP
rs1224979527 3334 dbSNP
rs181319938 3341 dbSNP
rs1454174028 3348 dbSNP
rs1018922485 3349 dbSNP
rs985498130 3351 dbSNP
rs1449688047 3364 dbSNP
rs1220657513 3366 dbSNP
rs931309213 3368 dbSNP
rs762124216 3369 dbSNP
rs919909681 3370 dbSNP
rs983472748 3372 dbSNP
rs1251220371 3375 dbSNP
rs1248127227 3376 dbSNP
rs1475643548 3376 dbSNP
rs1167395632 3377 dbSNP
rs188801828 3381 dbSNP
rs973414276 3382 dbSNP
rs774752221 3383 dbSNP
rs1171661888 3391 dbSNP
rs539065498 3392 dbSNP
rs184441642 3393 dbSNP
rs1305618058 3396 dbSNP
rs1349361433 3397 dbSNP
rs776621896 3399 dbSNP
rs1283107915 3400 dbSNP
rs547188452 3404 dbSNP
rs1353926465 3408 dbSNP
rs981568715 3415 dbSNP
rs995399590 3418 dbSNP
rs1309147672 3426 dbSNP
rs1273944701 3429 dbSNP
rs753515131 3429 dbSNP
rs970179091 3434 dbSNP
rs1023346155 3441 dbSNP
rs1255684322 3446 dbSNP
rs1472625936 3453 dbSNP
rs1233505480 3457 dbSNP
rs1422155527 3461 dbSNP
rs1365789531 3471 dbSNP
rs1369325592 3477 dbSNP
rs1298474299 3478 dbSNP
rs1023105294 3479 dbSNP
rs1338328776 3480 dbSNP
rs145783673 3480 dbSNP
rs1031980416 3490 dbSNP
rs1363846111 3499 dbSNP
rs999871962 3502 dbSNP
rs896076132 3503 dbSNP
rs902417442 3504 dbSNP
rs1324964141 3513 dbSNP
rs1040933122 3519 dbSNP
rs1216801772 3522 dbSNP
rs1008061376 3526 dbSNP
rs1396752163 3526 dbSNP
rs1448049245 3526 dbSNP
rs760935332 3527 dbSNP
rs1396194594 3531 dbSNP
rs998567326 3531 dbSNP
rs1456014994 3532 dbSNP
rs546399449 3533 dbSNP
rs772453868 3540 dbSNP
rs369727137 3541 dbSNP
rs1346677529 3542 dbSNP
rs932407948 3545 dbSNP
rs550043658 3561 dbSNP
rs1371636425 3567 dbSNP
rs1040905652 3572 dbSNP
rs1474141094 3577 dbSNP
rs1396202643 3590 dbSNP
rs1240947031 3599 dbSNP
rs1273101701 3601 dbSNP
rs1344437959 3604 dbSNP
rs1224477901 3614 dbSNP
rs943895765 3614 dbSNP
rs919945092 3615 dbSNP
rs1208487802 3619 dbSNP
rs908493235 3624 dbSNP
rs1254061183 3625 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacacGACGAu 5'
                          ||||| 
Target 5' ----------------CUGCUa 3'
1 - 6
2
miRNA  3' guguuugguaauacacGACGAU---------------------- 5'
                          ||||||                      
Target 5' ----------------CUGCUAACAUAUAUACAUAUAUAUCCAU 3'
1 - 28
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000381196.4 | 3UTR | CUGCUAACAUAUAUACAUAUAUAUCCAUAUUUUAUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.64 8.9e-4 -0.677 3.7e-4 21 Click to see details
GSE42095 Differentiated embryonic stem cells -0.537 4.1e-3 -0.453 1.5e-2 23 Click to see details
GSE19783 ER- ER- breast cancer -0.227 2.2e-2 -0.234 1.9e-2 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.404 2.3e-2 -0.468 9.2e-3 25 Click to see details
GSE21032 Prostate cancer 0.204 3.2e-2 0.220 2.3e-2 83 Click to see details
GSE19536 Breast cancer -0.179 3.7e-2 -0.155 6.2e-2 100 Click to see details
GSE27834 Pluripotent stem cells 0.366 8.2e-2 0.421 5.2e-2 16 Click to see details
GSE28544 Breast cancer -0.266 1.0e-1 -0.007 4.9e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.222 1.4e-1 0.273 9.3e-2 25 Click to see details
GSE21849 B cell lymphoma -0.195 1.6e-1 0.379 2.1e-2 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.148 2.7e-1 -0.051 4.2e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer 0.143 2.7e-1 0.209 1.9e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.095 3.0e-1 0.005 4.9e-1 32 Click to see details
GSE17498 Multiple myeloma -0.083 3.1e-1 -0.317 2.3e-2 40 Click to see details
GSE21687 Ependynoma primary tumors 0.055 3.3e-1 -0.024 4.3e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.083 3.5e-1 0.002 5.0e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.104 3.7e-1 0.005 4.9e-1 13 Click to see details
GSE14794 Lymphoblastoid cells 0.033 3.8e-1 0.031 3.9e-1 90 Click to see details
GSE17306 Multiple myeloma 0.034 4.1e-1 -0.015 4.6e-1 49 Click to see details
GSE19350 CNS germ cell tumors 0.021 4.7e-1 0.049 4.4e-1 12 Click to see details
GSE19350 CNS germ cell tumors 0.021 4.7e-1 0.049 4.4e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.271 0.01 0.184 0.07 68 Click to see details
PAAD -0.952 0.02 -0.800 0.1 4 Click to see details
LIHC 0.252 0.04 0.244 0.05 49 Click to see details
PCPG -0.964 0.09 -1.000 0.5 3 Click to see details
BRCA -0.116 0.15 -0.119 0.14 84 Click to see details
PRAD 0.15 0.15 0.117 0.21 50 Click to see details
COAD -0.389 0.17 -0.190 0.33 8 Click to see details
CESC -0.844 0.18 -1.000 0.5 3 Click to see details
CHOL -0.25 0.26 -0.033 0.47 9 Click to see details
BLCA -0.154 0.27 -0.086 0.37 18 Click to see details
KICH 0.126 0.27 0.235 0.13 25 Click to see details
KIRP -0.11 0.27 -0.101 0.29 32 Click to see details
STAD 0.058 0.38 -0.023 0.45 32 Click to see details
ESCA 0.096 0.39 0.082 0.41 11 Click to see details
LUSC -0.036 0.42 -0.047 0.39 38 Click to see details
LUAD 0.065 0.42 0.084 0.4 12 Click to see details
UCEC 0.048 0.42 0.037 0.44 19 Click to see details
HNSC 0.031 0.42 0.071 0.33 42 Click to see details
THCA -0.021 0.44 -0.024 0.43 59 Click to see details
THCA -0.021 0.44 -0.024 0.43 59 Click to see details
THCA -0.021 0.44 -0.024 0.43 59 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B