miRTarBase - #MIRT553812 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SZRD1   
Synonyms C1orf144
Description SUZ RNA binding domain containing 1
Transcript NM_001114600   
Putative miRNA Targets on SZRD1
3'UTR of SZRD1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             ||||| | | | ||||||  
Target 5' cagAAACC-TGAGGCTGCTGCcc 3'
2393 - 2414 138.00 -15.40
             | :||:  :| ||||||  
Target 5' aagATGCCGCCGT-TGCTGCcg 3'
14 - 34 126.00 -10.40
             | :|||  | |||||| | 
1959 - 1979 122.00 -11.72
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM8189221 9 COSMIC
COSM9817393 16 COSMIC
COSM9817394 19 COSMIC
COSM3477766 25 COSMIC
COSM8154035 25 COSMIC
COSM7610847 34 COSMIC
COSM9817395 35 COSMIC
COSM2185575 46 COSMIC
COSM9817396 50 COSMIC
COSM9817397 52 COSMIC
COSM7492740 54 COSMIC
COSM9817398 56 COSMIC
COSM7623734 61 COSMIC
COSM1583721 62 COSMIC
COSM6208661 63 COSMIC
COSM8187202 73 COSMIC
COSM9324423 89 COSMIC
COSM5497532 106 COSMIC
COSM9817399 106 COSMIC
COSM6835030 118 COSMIC
COSN30511148 133 COSMIC
COSN30587280 163 COSMIC
COSN24386406 202 COSMIC
COSN30534061 220 COSMIC
COSN30540201 288 COSMIC
COSN16324743 344 COSMIC
COSN31488696 378 COSMIC
COSN1091713 453 COSMIC
COSN20094393 476 COSMIC
COSN1411760 508 COSMIC
COSN7182921 697 COSMIC
COSN31592644 710 COSMIC
COSN20787540 714 COSMIC
COSN30164657 739 COSMIC
COSN23820527 810 COSMIC
COSN31608393 843 COSMIC
COSN28201376 850 COSMIC
COSN31585091 860 COSMIC
COSN4709465 1496 COSMIC
COSN16444886 1601 COSMIC
COSN23143971 1940 COSMIC
COSN31960182 2412 COSMIC
COSN20703275 2589 COSMIC
COSN1411772 2960 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1293207182 3 dbSNP
rs575455256 8 dbSNP
rs768772110 13 dbSNP
rs1392339513 15 dbSNP
rs774645035 18 dbSNP
rs1172161847 19 dbSNP
rs762049113 21 dbSNP
rs537052726 22 dbSNP
rs878964801 23 dbSNP
rs368945273 25 dbSNP
rs760565059 26 dbSNP
rs774140953 29 dbSNP
rs1185617460 32 dbSNP
rs766295502 34 dbSNP
rs754737995 35 dbSNP
rs1486319674 36 dbSNP
rs199920646 40 dbSNP
rs1272678372 41 dbSNP
rs752335131 43 dbSNP
rs1453264929 45 dbSNP
rs1040285834 46 dbSNP
rs757952206 52 dbSNP
rs777235424 53 dbSNP
rs746487796 56 dbSNP
rs748663479 57 dbSNP
rs780551817 61 dbSNP
rs749615766 62 dbSNP
rs769136148 66 dbSNP
rs577519030 69 dbSNP
rs1194197267 70 dbSNP
rs748355332 72 dbSNP
rs772388173 74 dbSNP
rs773191698 75 dbSNP
rs1049848731 79 dbSNP
rs1455592334 80 dbSNP
rs760753333 89 dbSNP
rs1476274105 94 dbSNP
rs766235313 96 dbSNP
rs776628887 101 dbSNP
rs759310066 104 dbSNP
rs764994823 105 dbSNP
rs539896944 106 dbSNP
rs1287174899 107 dbSNP
rs1326398515 109 dbSNP
rs1374747222 109 dbSNP
rs1021195740 111 dbSNP
rs762623816 116 dbSNP
rs761542612 117 dbSNP
rs1209675920 118 dbSNP
rs1314137130 123 dbSNP
rs1265697879 130 dbSNP
rs1003187704 131 dbSNP
rs1034697774 133 dbSNP
rs763687042 135 dbSNP
rs959078013 139 dbSNP
rs990572338 140 dbSNP
rs774243294 142 dbSNP
rs772628887 143 dbSNP
rs756719268 144 dbSNP
rs907377947 145 dbSNP
rs1457332912 158 dbSNP
rs138678090 163 dbSNP
rs1034573360 166 dbSNP
rs1390303221 172 dbSNP
rs866794924 179 dbSNP
rs529209106 180 dbSNP
rs894722116 181 dbSNP
rs549178827 182 dbSNP
rs1011889760 183 dbSNP
rs951850683 184 dbSNP
rs1212069602 186 dbSNP
rs1027333768 187 dbSNP
rs1162738518 192 dbSNP
rs562646915 207 dbSNP
rs531554534 213 dbSNP
rs116756877 215 dbSNP
rs184253953 216 dbSNP
rs1393792892 221 dbSNP
rs1416510890 227 dbSNP
rs944637330 232 dbSNP
rs1354445497 238 dbSNP
rs1392790359 243 dbSNP
rs976749266 243 dbSNP
rs1329911205 244 dbSNP
rs922611908 246 dbSNP
rs932697946 247 dbSNP
rs1231964656 257 dbSNP
rs1438190849 258 dbSNP
rs1295706421 268 dbSNP
rs1335534715 271 dbSNP
rs1226877821 278 dbSNP
rs1220716729 280 dbSNP
rs1270671676 282 dbSNP
rs1306807051 284 dbSNP
rs1049794564 288 dbSNP
rs1193158664 292 dbSNP
rs1253849193 292 dbSNP
rs188537893 292 dbSNP
rs893923454 292 dbSNP
rs1481706678 315 dbSNP
rs1196624665 321 dbSNP
rs1250921858 322 dbSNP
rs1429580904 325 dbSNP
rs1173473980 328 dbSNP
rs1401759045 329 dbSNP
rs1459411944 330 dbSNP
rs546710173 344 dbSNP
rs541490618 348 dbSNP
rs1438210565 353 dbSNP
rs1185679049 356 dbSNP
rs535719370 358 dbSNP
rs57997135 362 dbSNP
rs1215016977 368 dbSNP
rs773205128 378 dbSNP
rs867584191 383 dbSNP
rs1332656018 397 dbSNP
rs775321735 399 dbSNP
rs1004212260 403 dbSNP
rs1169067795 404 dbSNP
rs1056104427 420 dbSNP
rs553166874 421 dbSNP
rs1370869737 425 dbSNP
rs1241834355 426 dbSNP
rs1315663787 437 dbSNP
rs1463167285 444 dbSNP
rs1486400693 447 dbSNP
rs1196380465 450 dbSNP
rs894808794 451 dbSNP
rs1011952735 457 dbSNP
rs1027391879 460 dbSNP
rs1413914899 461 dbSNP
rs1315348573 463 dbSNP
rs1299856615 466 dbSNP
rs145874191 466 dbSNP
rs866088302 466 dbSNP
rs951910669 466 dbSNP
rs1232637953 476 dbSNP
rs1353454064 476 dbSNP
rs1356589932 476 dbSNP
rs1382168318 477 dbSNP
rs1293460406 479 dbSNP
rs1309367703 480 dbSNP
rs1358583078 481 dbSNP
rs1228381616 483 dbSNP
rs1222212861 485 dbSNP
rs113434810 489 dbSNP
rs1346859068 493 dbSNP
rs545212445 506 dbSNP
rs760753711 507 dbSNP
rs575392554 509 dbSNP
rs768547082 516 dbSNP
rs1447859959 524 dbSNP
rs766462307 533 dbSNP
rs1015181978 537 dbSNP
rs1185895848 554 dbSNP
rs1485602236 554 dbSNP
rs1259023398 565 dbSNP
rs181755487 566 dbSNP
rs1237482940 585 dbSNP
rs1473488722 596 dbSNP
rs557831586 597 dbSNP
rs1406758141 616 dbSNP
rs1419976678 617 dbSNP
rs1394172575 623 dbSNP
rs921888565 628 dbSNP
rs1414032349 630 dbSNP
rs1334750650 646 dbSNP
rs1342264791 652 dbSNP
rs1432487008 655 dbSNP
rs954034738 657 dbSNP
rs577706044 658 dbSNP
rs1376466233 664 dbSNP
rs1453625813 669 dbSNP
rs114436297 670 dbSNP
rs1364138974 691 dbSNP
rs1347614437 693 dbSNP
rs1382902039 698 dbSNP
rs74055656 699 dbSNP
rs542912730 701 dbSNP
rs1180142786 706 dbSNP
rs759042413 710 dbSNP
rs562782818 711 dbSNP
rs1312603740 717 dbSNP
rs1433865207 719 dbSNP
rs1214962318 727 dbSNP
rs1404241336 729 dbSNP
rs751361544 730 dbSNP
rs924108482 732 dbSNP
rs1328207588 736 dbSNP
rs1377760859 737 dbSNP
rs530777672 739 dbSNP
rs770704270 740 dbSNP
rs531529720 744 dbSNP
rs1258174661 745 dbSNP
rs1337975290 756 dbSNP
rs1195757666 777 dbSNP
rs551640580 782 dbSNP
rs1011898788 790 dbSNP
rs1048774862 792 dbSNP
rs899122334 797 dbSNP
rs186784426 799 dbSNP
rs1453473301 801 dbSNP
rs1199269632 812 dbSNP
rs1005047244 814 dbSNP
rs1195144361 816 dbSNP
rs1474351438 818 dbSNP
rs1167265544 822 dbSNP
rs1401026587 825 dbSNP
rs1426272887 827 dbSNP
rs1418906542 837 dbSNP
rs1324020878 840 dbSNP
rs1393976635 842 dbSNP
rs1157536813 843 dbSNP
rs1347532518 845 dbSNP
rs1325067267 851 dbSNP
rs192123789 859 dbSNP
rs1279388110 860 dbSNP
rs1320691636 862 dbSNP
rs1325250503 865 dbSNP
rs1270771429 866 dbSNP
rs140369470 867 dbSNP
rs1210075084 873 dbSNP
rs1443344386 882 dbSNP
rs1269116938 904 dbSNP
rs1445061183 905 dbSNP
rs997334627 912 dbSNP
rs1028849977 917 dbSNP
rs1478783532 918 dbSNP
rs1162828879 924 dbSNP
rs1417279710 927 dbSNP
rs953314842 928 dbSNP
rs1368024891 937 dbSNP
rs1223069497 953 dbSNP
rs1304606622 960 dbSNP
rs566718415 967 dbSNP
rs1299246139 971 dbSNP
rs915237840 972 dbSNP
rs1271942511 975 dbSNP
rs1466781864 981 dbSNP
rs1290839645 983 dbSNP
rs1215152548 991 dbSNP
rs1244967417 992 dbSNP
rs968123007 1013 dbSNP
rs978580811 1019 dbSNP
rs1215581220 1023 dbSNP
rs182361234 1024 dbSNP
rs1263666847 1030 dbSNP
rs1246980281 1034 dbSNP
rs1185733263 1035 dbSNP
rs1480506477 1041 dbSNP
rs1175776260 1047 dbSNP
rs143614398 1057 dbSNP
rs113926409 1058 dbSNP
rs1164885458 1073 dbSNP
rs1362255008 1074 dbSNP
rs1453370772 1075 dbSNP
rs569257945 1081 dbSNP
rs1056668662 1088 dbSNP
rs1463135995 1100 dbSNP
rs1326822954 1103 dbSNP
rs1312798859 1112 dbSNP
rs1380601746 1120 dbSNP
rs866041941 1123 dbSNP
rs916808040 1125 dbSNP
rs1314292998 1126 dbSNP
rs1333579262 1143 dbSNP
rs948297972 1152 dbSNP
rs1048725470 1155 dbSNP
rs15027 1156 dbSNP
rs1355593863 1162 dbSNP
rs1208550319 1167 dbSNP
rs1440310923 1168 dbSNP
rs1296191991 1173 dbSNP
rs538041413 1175 dbSNP
rs1183642619 1183 dbSNP
rs1237403325 1185 dbSNP
rs1375294334 1199 dbSNP
rs185216462 1208 dbSNP
rs1483650784 1212 dbSNP
rs1439265331 1220 dbSNP
rs1292646242 1221 dbSNP
rs755675746 1228 dbSNP
rs1234665007 1231 dbSNP
rs11685 1234 dbSNP
rs1175855536 1236 dbSNP
rs1360214616 1238 dbSNP
rs940407105 1244 dbSNP
rs1468054232 1250 dbSNP
rs1036509634 1255 dbSNP
rs1289976701 1267 dbSNP
rs577647590 1286 dbSNP
rs1202045321 1287 dbSNP
rs1234931487 1290 dbSNP
rs74055657 1293 dbSNP
rs1300380962 1295 dbSNP
rs1312662013 1296 dbSNP
rs1212183342 1298 dbSNP
rs61769431 1300 dbSNP
rs879600857 1303 dbSNP
rs1199413624 1306 dbSNP
rs1011452650 1311 dbSNP
rs1256108453 1319 dbSNP
rs1021583190 1326 dbSNP
rs1190931082 1329 dbSNP
rs1426334817 1333 dbSNP
rs749012277 1341 dbSNP
rs1400301162 1343 dbSNP
rs968446647 1354 dbSNP
rs1331502573 1368 dbSNP
rs573641924 1373 dbSNP
rs1418925935 1374 dbSNP
rs1408385909 1376 dbSNP
rs528196084 1377 dbSNP
rs1368059346 1386 dbSNP
rs780793593 1386 dbSNP
rs189640098 1390 dbSNP
rs1317268278 1393 dbSNP
rs1219290316 1407 dbSNP
rs1312195373 1409 dbSNP
rs1467271942 1411 dbSNP
rs1221127004 1419 dbSNP
rs1353412401 1424 dbSNP
rs1489669886 1430 dbSNP
rs1185204806 1433 dbSNP
rs1416555786 1440 dbSNP
rs1478457836 1441 dbSNP
rs1170732022 1445 dbSNP
rs1425184739 1448 dbSNP
rs147971332 1449 dbSNP
rs3738605 1450 dbSNP
rs1338229453 1455 dbSNP
rs992296205 1459 dbSNP
rs774196081 1460 dbSNP
rs916756959 1462 dbSNP
rs528491964 1470 dbSNP
rs1339706005 1471 dbSNP
rs1274752497 1477 dbSNP
rs545164483 1482 dbSNP
rs564902073 1490 dbSNP
rs527495183 1494 dbSNP
rs1332770299 1501 dbSNP
rs16852669 1505 dbSNP
rs1290845511 1508 dbSNP
rs1323783940 1510 dbSNP
rs374127710 1511 dbSNP
rs771935438 1512 dbSNP
rs560638824 1516 dbSNP
rs1332191085 1517 dbSNP
rs115604668 1529 dbSNP
rs1488877644 1545 dbSNP
rs1036048396 1553 dbSNP
rs901561558 1554 dbSNP
rs933078877 1559 dbSNP
rs1162178617 1575 dbSNP
rs1414027875 1578 dbSNP
rs1050179257 1588 dbSNP
rs865908257 1591 dbSNP
rs888948203 1592 dbSNP
rs1011400139 1595 dbSNP
rs11550045 1596 dbSNP
rs1420158083 1598 dbSNP
rs760630727 1599 dbSNP
rs1338691435 1602 dbSNP
rs1358493788 1616 dbSNP
rs2297924 1617 dbSNP
rs1284896931 1619 dbSNP
rs1381562814 1633 dbSNP
rs7529767 1634 dbSNP
rs903122619 1635 dbSNP
rs1354876413 1636 dbSNP
rs1172718229 1638 dbSNP
rs1278783156 1649 dbSNP
rs373191746 1651 dbSNP
rs1373416303 1652 dbSNP
rs1416071545 1656 dbSNP
rs1473542239 1664 dbSNP
rs551514543 1670 dbSNP
rs999908155 1671 dbSNP
rs1334808681 1672 dbSNP
rs749562946 1685 dbSNP
rs1160289378 1694 dbSNP
rs1325338461 1694 dbSNP
rs1399942835 1696 dbSNP
rs1031011768 1703 dbSNP
rs1334866252 1705 dbSNP
rs1360985316 1708 dbSNP
rs1428123891 1713 dbSNP
rs1444754693 1720 dbSNP
rs1308801076 1735 dbSNP
rs150529926 1741 dbSNP
rs992245692 1745 dbSNP
rs570024751 1746 dbSNP
rs1344859600 1783 dbSNP
rs1233140330 1784 dbSNP
rs182114164 1785 dbSNP
rs551244572 1790 dbSNP
rs77888029 1794 dbSNP
rs763424350 1817 dbSNP
rs1284244278 1818 dbSNP
rs534417338 1830 dbSNP
rs1445344639 1849 dbSNP
rs74055658 1853 dbSNP
rs972106036 1857 dbSNP
rs1180234880 1858 dbSNP
rs1375743357 1863 dbSNP
rs922945123 1869 dbSNP
rs1173098268 1876 dbSNP
rs1427270556 1888 dbSNP
rs1464120737 1891 dbSNP
rs1330808697 1900 dbSNP
rs1401248288 1904 dbSNP
rs567406305 1905 dbSNP
rs1449304645 1906 dbSNP
rs143313040 1918 dbSNP
rs536236149 1921 dbSNP
rs1050128219 1923 dbSNP
rs187078591 1932 dbSNP
rs1316646687 1933 dbSNP
rs576127851 1939 dbSNP
rs544940004 1947 dbSNP
rs1256904776 1950 dbSNP
rs191230404 1954 dbSNP
rs138769551 1964 dbSNP
rs1450820027 1965 dbSNP
rs541267123 1967 dbSNP
rs112012836 1968 dbSNP
rs779666185 1974 dbSNP
rs753425605 1984 dbSNP
rs1169992405 1986 dbSNP
rs1424440240 1990 dbSNP
rs1467316270 1995 dbSNP
rs868020338 1997 dbSNP
rs998788405 1999 dbSNP
rs1052824584 2000 dbSNP
rs1387685326 2008 dbSNP
rs1325996540 2013 dbSNP
rs1388777623 2019 dbSNP
rs1439671115 2026 dbSNP
rs1339040986 2043 dbSNP
rs956581561 2052 dbSNP
rs896485193 2055 dbSNP
rs1010604885 2056 dbSNP
rs754588781 2058 dbSNP
rs549128631 2076 dbSNP
rs1318012836 2077 dbSNP
rs1229069388 2079 dbSNP
rs1333175177 2079 dbSNP
rs1263303189 2080 dbSNP
rs1355270710 2080 dbSNP
rs1234501906 2083 dbSNP
rs1210168730 2085 dbSNP
rs1023710871 2092 dbSNP
rs529382179 2097 dbSNP
rs1192854933 2116 dbSNP
rs1263899597 2124 dbSNP
rs183622353 2125 dbSNP
rs1268806975 2126 dbSNP
rs1468132808 2135 dbSNP
rs1212043913 2141 dbSNP
rs1255201738 2145 dbSNP
rs1458633739 2158 dbSNP
rs1165316776 2159 dbSNP
rs1452410995 2162 dbSNP
rs3088128 2167 dbSNP
rs1419564388 2168 dbSNP
rs1016442150 2193 dbSNP
rs531749497 2194 dbSNP
rs972342878 2195 dbSNP
rs748552025 2209 dbSNP
rs1309990201 2213 dbSNP
rs923561526 2222 dbSNP
rs1412031166 2224 dbSNP
rs551748836 2230 dbSNP
rs377215880 2233 dbSNP
rs1351227174 2234 dbSNP
rs1215699654 2236 dbSNP
rs1460515380 2238 dbSNP
rs985782387 2242 dbSNP
rs1255588592 2243 dbSNP
rs1424557577 2249 dbSNP
rs1185661845 2260 dbSNP
rs772275360 2261 dbSNP
rs1323469824 2262 dbSNP
rs910276294 2269 dbSNP
rs1362976336 2272 dbSNP
rs947168022 2273 dbSNP
rs1300505352 2275 dbSNP
rs1400874208 2278 dbSNP
rs1392345680 2281 dbSNP
rs1043244707 2286 dbSNP
rs1021913826 2287 dbSNP
rs934528141 2294 dbSNP
rs1309750904 2296 dbSNP
rs1318604396 2298 dbSNP
rs1057062960 2299 dbSNP
rs527869105 2305 dbSNP
rs895763838 2307 dbSNP
rs1483619201 2312 dbSNP
rs1205718874 2317 dbSNP
rs1334250040 2333 dbSNP
rs1013570303 2334 dbSNP
rs1457518397 2335 dbSNP
rs188610814 2337 dbSNP
rs1267318537 2339 dbSNP
rs1179594848 2347 dbSNP
rs1410635186 2360 dbSNP
rs1045104175 2368 dbSNP
rs777656021 2369 dbSNP
rs562591182 2375 dbSNP
rs1469846489 2377 dbSNP
rs1006308255 2387 dbSNP
rs1397622991 2388 dbSNP
rs567345085 2390 dbSNP
rs1249522726 2402 dbSNP
rs1331723589 2403 dbSNP
rs1375262504 2406 dbSNP
rs1435917559 2411 dbSNP
rs1300491120 2413 dbSNP
rs1312756448 2431 dbSNP
rs536323544 2432 dbSNP
rs1256275965 2437 dbSNP
rs1317458033 2441 dbSNP
rs1016802743 2446 dbSNP
rs962230348 2450 dbSNP
rs370022004 2457 dbSNP
rs1191028935 2462 dbSNP
rs1268630276 2474 dbSNP
rs1481722508 2481 dbSNP
rs866999662 2482 dbSNP
rs1177905329 2486 dbSNP
rs1420858773 2490 dbSNP
rs1464720165 2492 dbSNP
rs193132058 2498 dbSNP
rs1434006597 2499 dbSNP
rs1030523705 2501 dbSNP
rs1474840155 2508 dbSNP
rs1406707685 2514 dbSNP
rs954974646 2517 dbSNP
rs1339927877 2518 dbSNP
rs1369718926 2519 dbSNP
rs1458060064 2529 dbSNP
rs1167003566 2530 dbSNP
rs1275351010 2542 dbSNP
rs1320182854 2543 dbSNP
rs985730060 2545 dbSNP
rs1412141242 2546 dbSNP
rs1490967620 2549 dbSNP
rs1192133798 2550 dbSNP
rs1263186105 2551 dbSNP
rs1477203105 2555 dbSNP
rs1309023870 2556 dbSNP
rs1355319589 2563 dbSNP
rs1403282170 2570 dbSNP
rs1163752690 2571 dbSNP
rs910223736 2580 dbSNP
rs534696478 2589 dbSNP
rs1296251889 2638 dbSNP
rs1339812558 2639 dbSNP
rs1431531280 2641 dbSNP
rs1314898026 2647 dbSNP
rs3856281 2649 dbSNP
rs1272030421 2655 dbSNP
rs968964774 2663 dbSNP
rs538631218 2667 dbSNP
rs553474414 2668 dbSNP
rs924390572 2671 dbSNP
rs934496883 2672 dbSNP
rs992683205 2674 dbSNP
rs1249888599 2679 dbSNP
rs1285904323 2695 dbSNP
rs1488928222 2701 dbSNP
rs1215838177 2702 dbSNP
rs1243371093 2711 dbSNP
rs558570992 2716 dbSNP
rs1471565592 2720 dbSNP
rs1339796874 2724 dbSNP
rs1385539211 2725 dbSNP
rs917143017 2726 dbSNP
rs948626911 2741 dbSNP
rs1359777361 2750 dbSNP
rs1401240029 2756 dbSNP
rs1320302776 2759 dbSNP
rs1485275814 2767 dbSNP
rs533340330 2776 dbSNP
rs1337623271 2778 dbSNP
rs980309065 2801 dbSNP
rs905189642 2806 dbSNP
rs942062436 2807 dbSNP
rs551619138 2813 dbSNP
rs572345201 2817 dbSNP
rs2102641 2819 dbSNP
rs200382784 2826 dbSNP
rs534503854 2828 dbSNP
rs34095186 2831 dbSNP
rs1277198181 2832 dbSNP
rs1440179780 2842 dbSNP
rs1208873606 2865 dbSNP
rs993604190 2876 dbSNP
rs1192020662 2892 dbSNP
rs1394338509 2895 dbSNP
rs890671281 2896 dbSNP
rs1379468839 2900 dbSNP
rs1007766214 2901 dbSNP
rs879251323 2904 dbSNP
rs1431269254 2905 dbSNP
rs578144350 2915 dbSNP
rs770899882 2918 dbSNP
rs1408526470 2919 dbSNP
rs1433371705 2927 dbSNP
rs1331035249 2934 dbSNP
rs978862286 2938 dbSNP
rs538841622 2939 dbSNP
rs1273557897 2950 dbSNP
rs955997075 2952 dbSNP
rs557153177 2953 dbSNP
rs1222329532 2955 dbSNP
rs1263241857 2957 dbSNP
rs867588238 2963 dbSNP
rs1367542514 2980 dbSNP
rs1237262317 2982 dbSNP
rs1438171168 2987 dbSNP
rs1229435584 2989 dbSNP
rs1244880299 2990 dbSNP
rs1477676330 2992 dbSNP
rs1298008984 3004 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guguuugguaauacaCGACGAu 5'
Target 5' --------aaaacugGCUGCUa 3'
1 - 14
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 26099.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guguuugguaauacaCGACGAu 5'
Target 5' caaggaagaaaacugGCUGCUa 3'
1 - 22
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000401089.3 | 3UTR | AAAACUGGCUGCUAUCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000401089.3 | 3UTR | CAAGGAAGAAAACUGGCUGCUAUCUUUAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000285 CCND2 cyclin D2 4 7
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 3 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472263 NFIC nuclear factor I C 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505116 YTHDC1 YTH domain containing 1 2 6
MIRT505349 TMEM245 transmembrane protein 245 2 6
MIRT505398 TMEM100 transmembrane protein 100 2 2
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505549 SNX16 sorting nexin 16 2 6
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505930 RCAN3 RCAN family member 3 2 4
MIRT506112 PPIG peptidylprolyl isomerase G 2 6
MIRT506138 PLRG1 pleiotropic regulator 1 2 4
MIRT506166 PLAG1 PLAG1 zinc finger 2 9
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506487 MYO5A myosin VA 2 7
MIRT506854 KIF23 kinesin family member 23 2 7
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507820 CDK1 cyclin dependent kinase 1 2 6
MIRT507853 CCNE2 cyclin E2 2 6
MIRT507877 CBX6 chromobox 6 2 2
MIRT508041 AXIN2 axin 2 2 6
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509368 DMPK DM1 protein kinase 2 11
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511847 GPATCH8 G-patch domain containing 8 2 5
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT514042 ATG14 autophagy related 14 2 2
MIRT518095 TRIM35 tripartite motif containing 35 2 2
MIRT518533 FLCN folliculin 2 6
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521055 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521207 SBNO1 strawberry notch homolog 1 2 6
MIRT521818 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522778 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537815 EFNB2 ephrin B2 2 4
MIRT539902 RPL14 ribosomal protein L14 2 4
MIRT540847 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541217 HOXA10 homeobox A10 2 2
MIRT541432 CBX4 chromobox 4 2 3
MIRT542810 PHC3 polyhomeotic homolog 3 2 3
MIRT542837 PDCD1 programmed cell death 1 2 7
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543310 ZNF585B zinc finger protein 585B 2 2
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543529 PRSS21 protease, serine 21 2 2
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543839 GSG1 germ cell associated 1 2 2
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544916 CLSPN claspin 2 2
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545351 CCDC83 coiled-coil domain containing 83 2 2
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546118 USP48 ubiquitin specific peptidase 48 2 4
MIRT546611 SALL1 spalt like transcription factor 1 2 4
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546640 RTN4 reticulon 4 2 2
MIRT547069 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547406 MKX mohawk homeobox 2 2
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547661 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547702 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT548001 HCFC2 host cell factor C2 2 4
MIRT548018 GRB2 growth factor receptor bound protein 2 2 4
MIRT548219 FKBP1A FK506 binding protein 1A 2 2
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548727 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548946 CDK17 cyclin dependent kinase 17 2 3
MIRT549076 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549123 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549389 AMOT angiomotin 2 2
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550619 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550827 FAM229B family with sequence similarity 229 member B 2 2
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551621 ZNF267 zinc finger protein 267 2 2
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552348 ZNF704 zinc finger protein 704 2 2
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553442 TPM3 tropomyosin 3 2 2
MIRT553565 TMEM161B transmembrane protein 161B 2 2
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553777 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554702 RNF149 ring finger protein 149 2 2
MIRT554965 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555035 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555278 PRDM4 PR/SET domain 4 2 2
MIRT555431 PPAP2B phospholipid phosphatase 3 2 2
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557484 GPR27 G protein-coupled receptor 27 2 4
MIRT558041 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558664 CNKSR3 CNKSR family member 3 2 2
MIRT559006 CA8 carbonic anhydrase 8 2 2
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560855 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561153 KRT33B keratin 33B 2 2
MIRT561404 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562031 LANCL1 LanC like 1 2 2
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562881 KIAA1456 KIAA1456 2 2
MIRT563090 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563507 DLGAP3 DLG associated protein 3 2 2
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564336 CCNT1 cyclin T1 2 2
MIRT564482 ZNF391 zinc finger protein 391 2 2
MIRT564556 CCDC80 coiled-coil domain containing 80 2 2
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564954 XKR7 XK related 7 2 2
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566122 RASEF RAS and EF-hand domain containing 2 2
MIRT566654 NCKAP1 NCK associated protein 1 2 2
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567017 KLHL15 kelch like family member 15 2 2
MIRT567450 GNG12 G protein subunit gamma 12 2 2
MIRT567482 FZD9 frizzled class receptor 9 2 2
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568143 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568477 ARMC12 armadillo repeat containing 12 2 2
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568621 ACVR2A activin A receptor type 2A 2 2
MIRT570464 TLK1 tousled like kinase 1 2 3
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571431 RIF1 replication timing regulatory factor 1 2 2
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571824 PHF19 PHD finger protein 19 5 2
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 2 3
MIRT574062 PROSC pyridoxal phosphate binding protein 2 2
MIRT574207 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574595 N4BP1 NEDD4 binding protein 1 2 3
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575928 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576100 Pdcd1 programmed cell death 1 2 5
MIRT576593 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614697 TRAK1 trafficking kinesin protein 1 2 2
MIRT616471 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640542 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645514 BSPRY B-box and SPRY domain containing 2 2
MIRT646599 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648788 KLHL40 kelch like family member 40 2 2
MIRT655815 NOTCH2 notch 2 2 3
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659260 CUL3 cullin 3 5 2
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682280 RS1 retinoschisin 1 2 2
MIRT682518 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691713 FLOT2 flotillin 2 2 3
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701510 NEGR1 neuronal growth regulator 1 2 2
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713423 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716436 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717465 ADORA3 adenosine A3 receptor 2 2
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725130 SYNRG synergin gamma 2 2
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
MIRT735131 GSDMB gasdermin B 2 0
MIRT736201 DRD1 dopamine receptor D1 3 0
Error report submission
Your e-Mail*