miRTarBase - #MIRT550619 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MTHFR   
Synonyms -
Description methylenetetrahydrofolate reductase
Transcript NM_005957   
Expression
Putative miRNA Targets on MTHFR
3'UTR of MTHFR
(miRNA target sites are highlighted)
>MTHFR|NM_005957|3'UTR
   1 CCCTGCGTCCTGACGCCCTGCGTTGGAGCCACTCCTGTCCCGCCTTCCTCCTCCACAGTGCTGCTTCTCTTGGGAACTCC
  81 ACTCTCCTTCGTGTCTCTCCCACCCCGGCCTCCACTCCCCCACCTGACAATGGCAGCTAGACTGGAGTGAGGCTTCCAGG
 161 CTCTTCCTGGACCTGAGTCGGCCCCACATGGGAACCTAGTACTCTCTGCTCTAGCCAGGAGTCTGTGCTCTTTTGGTGGG
 241 GAGCACTTGCGTCCTGCAGAGGACCACAGTGGGTGGCACCTCCTGAGAAGGCGAGGAGAGTGGTTGTTGCCAACTAAGCC
 321 CTCGAACCAAGGCAGCCTCCAGAGCCAGCCTGGGACTCCCAGTGAACTTACACTTGGAGCCCGTGCAGTACAGGCAAAAC
 401 ACGCAAGGGCATCAGGCACTGGTGGCATCGTAGAAGAGATGTGGCAAAGTGCTGTACCCTTCCACCTCCTAGAGGTGGGC
 481 AGCTGGGCCCCACCTACTTGTGACTGAAGGGGCACACCACTGCCCTGCCTGCCCACTTAGCCGTCCATGGCACCAGCCCC
 561 CTGGATGGGCATTGGGCTGACACCTACCATGCTGCTTTTTGGCACAGTTGTCTATTCTGAGCCTTGAGAGAAAAAGTGCC
 641 CCTTAAGGGTTGAAGGCAGTCTGAACCCTTGTGCTTGGTGGGGCTCGTGGCCTTCCCCTTTTGCCTGGCTGTGGAGGCCT
 721 GATGCTGCCCCGTTCCCTGTCAGAGGCTAAGATGAGATTTGCCAGCACAGGGGCCCCAGATCTGCCTGGGCCTGTGCAGC
 801 AGCCCAGCTTCCTGGTGTATTTTTCAGGTAGGCCCTTGTCCTGCCAGCTGCCTTCCTCATCCCCTCGTCCTGTCCCAGAG
 881 GTTATCTGCCTGGCCTGGCTCCCCACGAGTCACCTGCAAGCCCCAGGGCCTGGGGGCAGTGACTGGCAGGTGCAGATGGG
 961 CTGTTTCGTGTAGTGGAAGAGCAGCCTGATGGCCAAGGGGGTGGACGCAATTGTGGGATGTCCTCTTTACTCCCTTCCTG
1041 GCCTCACTGGCTGGGGCAGAGGGGCAGCCGCTAGGAGAGACTGAAAGCAGCAGCTAGGACTGAGGAGTGGGTTTTATTGT
1121 CCTTCAGAGCTCTTCAAGCTGTCCCCTCTGTCATCACTCCCTGGATGTGTGGGGCATGGTTCCTTCCCTGGGAAGGCTAA
1201 GTTCAGTTCTGTTTTTTATTCTATGAGAACAAGTCACAGCTGCAGCTGGGCCCCATGCTCTGCCCCAAGCCCCCAACCCC
1281 GCGGTGCTCTGGCGGCTTCCTGTCCACTCTCGGGGCCCTTGGGGCCTGGCTTGCTCCAGGGTCTTGGGCTACTGGCAGCT
1361 CCTCTCCTTGGGCTCCTGGCTGCCAGGCGTTGGTGCCACTTCTTAAAGGCCTGGAACCAGGGAGGAGAGGAAATGCTATT
1441 GTTGTGGGCTTTCTCCGGGGTCTGTGCTGTGCCTGCTAGAGCAACCCCTGTACCCAGCTCCTTTTGTCCCCAGGGCCCCT
1521 CCCTCTGCCCCAAGCAGCCAGCCAGTCTTGCCTAGGCCAAATGCACAAGCTCAGAATAGATCTGATGGTGAGCTGGGAAG
1601 CTGTACTCAGAGCAGAGCAAATGAGGGAGGGGGCGCTCAGGACCCAGGCCCTCCATGGGCTAGTGTGAGTGGCAGCCATG
1681 CCTCATGCCACACCTTCTTCGCAAACTGATGGACCGGGTGGGCCTGGCCTGAGCTGGGGCCACAAATCAAAGCAAGGGCT
1761 CCAGCATCCAGCCTGTGTGTTCTGTAATGGAACTGACCCCCTCCCCTGAAAACGAAGGGGCCCCGGGGCTGGCAAGCAGG
1841 GAAAGCTCCACGGTGCGTGGCTGTGGCACAGACTTCTGGAAGGCTGGCTGAGTGGAATGCAGGGAAGAGGGCAGTACCTG
1921 GGAAAGGACCCACCCATCTTCCTGCTGCTGTAACTGCTGAGCCACTCGCAGTCGCAGGATCCGCTGCCACCACGTCTGCC
2001 AGGCCCATCTCAGGTGCCACTCCCTGAGCTTTGGGGACAGTTGGCAGAGAAGGCCTCTTGTGCTCACGCTCCCCCGCAGT
2081 CCCCAGCCCTTCTGCCTTTCTCCCCCGACACTGCTGCACCAGAGTGAAAGGGCTATGGCAAGGGGGTGTCATCTGAGGAG
2161 TATTAAGAATGCAGATTCCTGGGCCTGTCCCCCAAGGTTTTGGAGTCAGTAGGTCCAAGGGCCATACTTTTGAGAGGGGT
2241 TTGGGTTAAGTATGAGGTGAAATGGGAGATGGTCAGTGTGGAGAGGGGTGCACCCACTCACCAGGGTCCGCACCAGCTGC
2321 TCTGCCCCTTGGGCATCCACCCAGTGCTGCCATGCCACTGCCAGGCACCTGGCCTGCTGGGAACCCCGCAGCCCGTGAAG
2401 CAGTGCCTCGAGGCACCGGCGCTGCAGGTACTTCCTCCTGATGGCCAAGAGCATCGTGACCCTTCAGGGCCAGAAGGAGG
2481 GCAGAGCCATGGGCCTGGGCCTGCTTTTCCAGGATCCTGCAGGAACGAGCACTGGCCAGAGAGGGCCCAGCTGTAGCCAT
2561 GGCTCAGGCAAGCCCCTCAGCCCTTGCCCCCATCCCTCGGACCCACCAAACTGCACACACAGCTCCTCTTACCGTAGCCT
2641 CCGTTTATGGGCCTTGCTTTGGGCTTTGCAGGCTCTGGGCTCAGGGCTGGAGTGCGCTCTTGGTCCCTGGTCCCTCGTCC
2721 ACAGGGGCAGGCCTGGGACCCAGCTACTCTGTCCAGGCCACTGTGGCCAGAGCTGGAAGGCAGGGCAGAGGGAATGTTCC
2801 CTGCACCCTGGAAAGGGGAGTTGAGTCACAAGAGGTTAAGGTGGGTCCAGGAAGGCAGCTGCTCTTAGTGCCCGCCTAGG
2881 AGTTGAGTACAGTGAGGAGGGTGGAGGAAGGTGCTGAGCTTAGCCTTGTGCCCTGCCCCCATCTCCCCAGGCCTCCAGCC
2961 TCTCCCGGCTGCCTGCCGCCCAAAGAGAAATCACAGGGGCGGGGCAGGAATGCAAAGTGTTTTCTCAGAACAGCTGAAAC
3041 ATTCCGAAGAGGGAATGGATGGGGAGAATGGTCAATACACATAAGACCGTGTCCCAAGGAGCTGATTTCCAGGCCCCTGA
3121 GGACTGGAGACCGCTTCACCCCTGCACTTCAGACACCGTTTGTCCCCCGGGGCAAGGTCTCCTTACTCTGAGCCCAGGCC
3201 GTTCCCCTTGGCTTCCTCCGTCCACCCAGGCTGCACTGCAGTGATGGCGCGGGAGGCACCAGCTCTGTGGCCTGTGTCCA
3281 GCAGCTGCGGGTCTGAAGGAATAGCCAGAGAGGAGCACCTGAACCCCATGGGCTTGGACTTCCTGGGGCCCCGCTGGGAT
3361 TTCTTCGCTGCTCTAGCTGGCAGGACACATCCCGGCCTCTTCCACCCATTCCCCCATGTGGCTGAAGACATTCCAACAAT
3441 GGGGTGGGCCCATAATAGTTAGCCCTCAGTCAGTTCCCGGAGCACAGCCCTGGGAGGGGGCTATTTCTCTCCCCACTGAA
3521 AACATTTCAAAGCTGAGTTACTTGTCTGAGGCCTCATCCCTCGGAAGCCGTCTGACTCCAGAGTCTGAGCCCCCGGCTAG
3601 TACCCTATAGAGAGGGGGCTCTCCAAAGGGGCTGCTGGGGCATGTGTGCCTGTGGCAGAAAAGAGGAGACCCTGGAATTC
3681 AGCACCCTGGGTGCCATTCCCAGCGTTTAGTTTCTAGAGGCCTCAGTTTCTCCATCAGCTTATGGGATCCTTGTCTTTAC
3761 TGACAAGAATGGAATAGAAATGTAAAAGTACTCTGAAAAGCAATTGCCCTGTAACTTATCTAGAAAGAAAAGACCCTGAG
3841 ACTCCAGAATCTGCTGTTGCCATAGCCCCATATGTGTGAATTCTGCAACTAGCCAAGGCTAGTTCCTTTCAATTCCATTT
3921 AAAAAACAAAAACCAGCAGGTGTGGTGGCTCATGGCGTAATGGGCCTGCCCAATGCTTTGGGAGGCCAAGGCAGGTAGAT
4001 CGCTTGAGCCCAGGAGTTTGAGACAAGCCCTGGCAACATAGTGAGATCCCATTTCTACAAAAAAAAAAAAAAAAAAATTA
4081 GCCGGGTGTGGTGGCACACGCCTGTAGTCTCAGCTACTCAGGTGGCTGAGGTGGGAGGATCGTTTGAGCCCTGGAGGTTG
4161 AGGCTGCAGTGAGCTGTGATCGCACCACTGCACTCTGGCCTGGGCGACAGAGTGAGACACTGTCTGAGAACAAAAAACGA
4241 CTGAAAAAAAAAATCACCTTAGCTTTTTCTCTTAGAATCTTCTCTAAAACGTATTCTTTGTGGCATTCTGAAATAGGATT
4321 CATGATGATGCCTGTTGATCTTAGGGACACTACCTCACCTGCCAGTATCTTTGGGGCTGTGTCCTTCAAGGACATGTCCC
4401 CAGACTGCTGTGCAGTGTCATTTTTTGTGTTTGGTTTGGTGGTGGCTTCTTCCCCCTTGCTAGGCTATCAACCTCTTATC
4481 ACCACTTGTTGGTGTCAGAACTAACTGCTTCTGGTCTGGAGAGGGACTGACCGATGCCTTTGGGTAGAGAGAATTATGAA
4561 AGAAATTTTGGTATTTTTCTACTTTATATTTTCTGAGGTTTCTGTAATAAGCATATTTCACTTTTCCAATAAGAAAAAAA
4641 AAAACTTGGCCTGGCGCGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAAGTCGAGGTGGGAGGATCACTTGAGTTCA
4721 GGAGTTCGAGACCAGCTTGGGCAATATGGTGAAACCCCGTCTCTACTAAAAATACAAAAATTAGCCAGGCGTGGTGGCGT
4801 GCACTTGTAGTCCCAGCTACTCAGGAAGCTGAGGCGGGAGAATCACTTGAACCCGGGAGGCAGAGGTTGCAGTGAGCTGA
4881 GATCACTCCTCTGCTTCAGCCTGGGCAATTGAGCCAGACTCTGTCTCAAAAATAAACAAAAAAACTTGAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA-AUACACGACGAu 5'
            | | |||| |   ||||||| 
Target 5' acCCACCCATCTTCCTGCTGCTg 3'
1928 - 1950 152.00 -14.20
2
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |||  | |||||||| 
Target 5' cctcctCCA-CA-GTGCTGCTt 3'
47 - 66 146.00 -13.80
3
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||||     ||||||| 
Target 5' cacctACCA-----TGCTGCTt 3'
581 - 597 144.00 -15.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
194070 7 ClinVar
292225 175 ClinVar
292224 370 ClinVar
292223 372 ClinVar
292222 373 ClinVar
292218 703 ClinVar
292212 1018 ClinVar
292205 1531 ClinVar
292197 2456 ClinVar
292196 2477 ClinVar
292189 2657 ClinVar
292167 4062 ClinVar
292164 4078 ClinVar
292165 4078 ClinVar
292166 4078 ClinVar
292157 4489 ClinVar
292153 4645 ClinVar
COSN31556100 3 COSMIC
COSN13459503 6 COSMIC
COSN30452438 7 COSMIC
COSN30180033 12 COSMIC
COSN30663974 22 COSMIC
COSN31564379 42 COSMIC
COSN30133750 51 COSMIC
COSN32069322 90 COSMIC
COSN30132192 91 COSMIC
COSN24746391 109 COSMIC
COSN28852733 225 COSMIC
COSN31578465 367 COSMIC
COSN17019827 610 COSMIC
COSN16542911 979 COSMIC
COSN30535066 1163 COSMIC
COSN28875858 1199 COSMIC
COSN7173834 1230 COSMIC
COSM6207477 1263 COSMIC
COSM7566435 1265 COSMIC
COSM6565508 1280 COSMIC
COSM6240593 1283 COSMIC
COSM4142235 1290 COSMIC
COSM6035354 1293 COSMIC
COSM9141076 1304 COSMIC
COSM8924608 1322 COSMIC
COSM5992579 1344 COSMIC
COSM5445477 1350 COSMIC
COSM3700469 1388 COSMIC
COSM6324087 1417 COSMIC
COSN26642588 1422 COSMIC
COSN28890763 1556 COSMIC
COSN31596822 1581 COSMIC
COSN31595359 1817 COSMIC
COSN32057533 1852 COSMIC
COSN30636749 1856 COSMIC
COSN30510710 1857 COSMIC
COSN1087814 1914 COSMIC
COSM6572924 1927 COSMIC
COSM5968755 1968 COSMIC
COSM7421926 1973 COSMIC
COSM7564700 1994 COSMIC
COSM5560284 2006 COSMIC
COSM7203843 2021 COSMIC
COSN30164846 2065 COSMIC
COSN30132170 2082 COSMIC
COSN24920875 2124 COSMIC
COSN30596982 2129 COSMIC
COSN30531085 2146 COSMIC
COSM5992166 2309 COSMIC
COSM4446590 2327 COSMIC
COSM5554594 2362 COSMIC
COSM6274236 2392 COSMIC
COSM5485429 2395 COSMIC
COSM9187907 2409 COSMIC
COSM4446588 2435 COSMIC
COSM8898972 2438 COSMIC
COSM2179109 2469 COSMIC
COSM4446586 2479 COSMIC
COSM7421924 2489 COSMIC
COSM4446584 2507 COSMIC
COSM4446582 2531 COSMIC
COSN31588323 2563 COSMIC
COSN6504575 2598 COSMIC
COSN26565594 2603 COSMIC
COSM7437373 2632 COSMIC
COSM8405340 2645 COSMIC
COSM2179097 2657 COSMIC
COSM4594343 2669 COSMIC
COSM5790058 2682 COSMIC
COSM7580262 2705 COSMIC
COSM4446580 2706 COSMIC
COSM4792563 2766 COSMIC
COSN28884307 2826 COSMIC
COSN30118299 2854 COSMIC
COSN30512613 2863 COSMIC
COSN17974490 2978 COSMIC
COSN20094322 2995 COSMIC
COSN20126891 3028 COSMIC
COSN23210000 3109 COSMIC
COSN26638912 3124 COSMIC
COSN31522735 3156 COSMIC
COSM6245980 3212 COSMIC
COSM4599050 3288 COSMIC
COSM6220060 3298 COSMIC
COSM7252383 3301 COSMIC
COSN31545863 3328 COSMIC
COSN30527146 3358 COSMIC
COSN20094317 3397 COSMIC
COSN7173831 3403 COSMIC
COSN7173830 3404 COSMIC
COSN22188809 3411 COSMIC
COSN23404512 3819 COSMIC
COSN32061400 4059 COSMIC
COSN20303852 4146 COSMIC
COSN17665554 4296 COSMIC
COSN4708268 4369 COSMIC
COSN21511193 4508 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs780382245 1 dbSNP
rs565879486 6 dbSNP
rs547574100 7 dbSNP
rs1384498611 9 dbSNP
rs1308658426 12 dbSNP
rs781229410 14 dbSNP
rs976575492 15 dbSNP
rs963892319 16 dbSNP
rs1432199351 20 dbSNP
rs376616918 21 dbSNP
rs374747214 22 dbSNP
rs896340337 23 dbSNP
rs1416402122 24 dbSNP
rs778011870 24 dbSNP
rs761106316 25 dbSNP
rs368049152 26 dbSNP
rs1233112958 28 dbSNP
rs752994506 29 dbSNP
rs1272021637 30 dbSNP
rs766092654 32 dbSNP
rs760378726 34 dbSNP
rs904227645 37 dbSNP
rs1183661623 38 dbSNP
rs1251934919 38 dbSNP
rs1180560519 40 dbSNP
rs45482794 41 dbSNP
rs377635370 42 dbSNP
rs1379035680 47 dbSNP
rs1309180549 48 dbSNP
rs761849115 50 dbSNP
rs1199462848 55 dbSNP
rs1222202438 57 dbSNP
rs760582696 60 dbSNP
rs904977673 64 dbSNP
rs1226836191 65 dbSNP
rs1259394862 74 dbSNP
rs532267156 75 dbSNP
rs1334384587 76 dbSNP
rs1009960273 80 dbSNP
rs375798255 81 dbSNP
rs895587193 89 dbSNP
rs1348686136 90 dbSNP
rs1038039360 91 dbSNP
rs565200419 91 dbSNP
rs1351994145 93 dbSNP
rs1163060650 103 dbSNP
rs1203674178 104 dbSNP
rs937500668 105 dbSNP
rs906099494 106 dbSNP
rs543427518 107 dbSNP
rs1485672010 108 dbSNP
rs886045192 109 dbSNP
rs909440721 113 dbSNP
rs942005282 115 dbSNP
rs1210705941 117 dbSNP
rs775426360 118 dbSNP
rs1465158968 119 dbSNP
rs1269066794 120 dbSNP
rs531577946 121 dbSNP
rs1306306134 127 dbSNP
rs1234559144 129 dbSNP
rs1220333371 134 dbSNP
rs964756566 142 dbSNP
rs374137463 145 dbSNP
rs933386285 147 dbSNP
rs979381501 148 dbSNP
rs1381943584 149 dbSNP
rs968090957 150 dbSNP
rs1388965366 152 dbSNP
rs1362722973 153 dbSNP
rs1176096216 154 dbSNP
rs1021270490 156 dbSNP
rs1423029578 167 dbSNP
rs776554158 175 dbSNP
rs1449913865 178 dbSNP
rs1249589643 179 dbSNP
rs560982435 180 dbSNP
rs1484985411 184 dbSNP
rs1034844116 187 dbSNP
rs1210962485 191 dbSNP
rs923362067 194 dbSNP
rs1002078502 201 dbSNP
rs1404681552 205 dbSNP
rs1173158120 208 dbSNP
rs1366386263 221 dbSNP
rs1300201095 225 dbSNP
rs755064808 228 dbSNP
rs1491504394 234 dbSNP
rs1491462478 235 dbSNP
rs1303039535 239 dbSNP
rs963881030 246 dbSNP
rs751777242 250 dbSNP
rs1371213170 251 dbSNP
rs1172938782 254 dbSNP
rs186889299 257 dbSNP
rs1192204626 259 dbSNP
rs141798303 262 dbSNP
rs1248904773 270 dbSNP
rs1186392694 272 dbSNP
rs1190725500 282 dbSNP
rs1427669413 285 dbSNP
rs978725220 290 dbSNP
rs1005601640 292 dbSNP
rs1277993978 293 dbSNP
rs1201586334 294 dbSNP
rs55763075 303 dbSNP
rs968777434 305 dbSNP
rs1278204294 306 dbSNP
rs745817977 310 dbSNP
rs886795958 311 dbSNP
rs1343437837 312 dbSNP
rs1227187157 313 dbSNP
rs1366356183 318 dbSNP
rs553904244 323 dbSNP
rs1048404948 324 dbSNP
rs545595795 338 dbSNP
rs578166623 340 dbSNP
rs1326192454 361 dbSNP
rs1313064844 367 dbSNP
rs886045191 370 dbSNP
rs1325095610 372 dbSNP
rs4846049 372 dbSNP
rs538188982 373 dbSNP
rs886045190 373 dbSNP
rs1009908325 374 dbSNP
rs1334261916 374 dbSNP
rs1372374839 375 dbSNP
rs367822165 382 dbSNP
rs1461344185 383 dbSNP
rs1394286499 386 dbSNP
rs1368825515 391 dbSNP
rs1165757491 401 dbSNP
rs375213851 402 dbSNP
rs1255521392 403 dbSNP
rs1187262001 410 dbSNP
rs1483407534 415 dbSNP
rs1430222518 420 dbSNP
rs1254659143 423 dbSNP
rs1194574590 424 dbSNP
rs1391748753 427 dbSNP
rs1170788865 429 dbSNP
rs1442992414 430 dbSNP
rs1246560745 434 dbSNP
rs569658202 442 dbSNP
rs1332161286 454 dbSNP
rs1292254673 458 dbSNP
rs1001699129 463 dbSNP
rs910620700 466 dbSNP
rs1351785591 472 dbSNP
rs1306174278 474 dbSNP
rs1237060003 477 dbSNP
rs1295022575 483 dbSNP
rs906053957 487 dbSNP
rs1038343427 489 dbSNP
rs1164457064 493 dbSNP
rs1472995279 500 dbSNP
rs563009978 505 dbSNP
rs1249101721 506 dbSNP
rs913912335 507 dbSNP
rs988582683 509 dbSNP
rs886045189 513 dbSNP
rs1212044342 525 dbSNP
rs1467398303 526 dbSNP
rs536307182 530 dbSNP
rs960654882 533 dbSNP
rs1228615357 539 dbSNP
rs45625835 543 dbSNP
rs771094619 543 dbSNP
rs1277207063 548 dbSNP
rs1238274590 558 dbSNP
rs1244167371 563 dbSNP
rs1331570337 568 dbSNP
rs547241913 570 dbSNP
rs1355216772 581 dbSNP
rs145253240 584 dbSNP
rs923352244 585 dbSNP
rs1284381355 588 dbSNP
rs1325564355 594 dbSNP
rs1457908277 597 dbSNP
rs1390950011 606 dbSNP
rs1156849480 612 dbSNP
rs1449612050 612 dbSNP
rs1016670099 613 dbSNP
rs1201629668 618 dbSNP
rs1333454385 619 dbSNP
rs571383705 621 dbSNP
rs1208979291 627 dbSNP
rs371856764 632 dbSNP
rs536599088 632 dbSNP
rs1281566425 637 dbSNP
rs1372238952 639 dbSNP
rs1161456008 647 dbSNP
rs1204079776 647 dbSNP
rs45451599 654 dbSNP
rs1025299869 659 dbSNP
rs763881419 666 dbSNP
rs760602763 667 dbSNP
rs1369986725 679 dbSNP
rs942511371 686 dbSNP
rs998298212 687 dbSNP
rs1328461807 698 dbSNP
rs1316459739 699 dbSNP
rs775036001 703 dbSNP
rs1362131761 708 dbSNP
rs1182165582 709 dbSNP
rs902083770 722 dbSNP
rs1040631483 723 dbSNP
rs1433339881 724 dbSNP
rs749461588 732 dbSNP
rs1451685774 735 dbSNP
rs771578626 736 dbSNP
rs1192012567 739 dbSNP
rs946816175 747 dbSNP
rs968624711 751 dbSNP
rs1451344141 754 dbSNP
rs1280048534 755 dbSNP
rs914014010 763 dbSNP
rs1229645638 766 dbSNP
rs1348002152 769 dbSNP
rs988141366 771 dbSNP
rs1230395287 778 dbSNP
rs530644920 786 dbSNP
rs1268708402 787 dbSNP
rs1430195413 789 dbSNP
rs1341156941 791 dbSNP
rs1228407100 794 dbSNP
rs1352257635 802 dbSNP
rs927838042 806 dbSNP
rs886045188 817 dbSNP
rs988467484 821 dbSNP
rs1412054094 823 dbSNP
rs1404162617 829 dbSNP
rs1350221319 831 dbSNP
rs1166969251 835 dbSNP
rs1472891643 838 dbSNP
rs1238727744 856 dbSNP
rs959731703 857 dbSNP
rs1185206940 861 dbSNP
rs1035418483 863 dbSNP
rs1252518816 866 dbSNP
rs60350681 866 dbSNP
rs1382996980 869 dbSNP
rs970222916 870 dbSNP
rs969172112 874 dbSNP
rs1158530331 880 dbSNP
rs1472937760 884 dbSNP
rs1414864068 886 dbSNP
rs1295318316 887 dbSNP
rs1016411318 898 dbSNP
rs373252979 902 dbSNP
rs1309240729 904 dbSNP
rs527742848 906 dbSNP
rs951158357 907 dbSNP
rs773932762 931 dbSNP
rs560655248 932 dbSNP
rs1048002438 933 dbSNP
rs533406308 934 dbSNP
rs901876194 936 dbSNP
rs1039082103 947 dbSNP
rs954592637 951 dbSNP
rs943439762 952 dbSNP
rs1444935849 955 dbSNP
rs1267021474 959 dbSNP
rs925362366 966 dbSNP
rs1162330693 967 dbSNP
rs1042861488 968 dbSNP
rs1330578735 979 dbSNP
rs578111853 986 dbSNP
rs1479589785 1001 dbSNP
rs947241838 1006 dbSNP
rs965026013 1007 dbSNP
rs1019118414 1008 dbSNP
rs1275350663 1012 dbSNP
rs886045187 1018 dbSNP
rs1231683529 1020 dbSNP
rs141481256 1021 dbSNP
rs1289007152 1029 dbSNP
rs1226003910 1034 dbSNP
rs1007775979 1037 dbSNP
rs889401579 1040 dbSNP
rs913149131 1043 dbSNP
rs1043899082 1057 dbSNP
rs1323481616 1059 dbSNP
rs988749375 1061 dbSNP
rs1276414128 1066 dbSNP
rs959679445 1067 dbSNP
rs928254214 1069 dbSNP
rs45574135 1070 dbSNP
rs1320080584 1077 dbSNP
rs969796956 1084 dbSNP
rs1044967025 1092 dbSNP
rs375682897 1092 dbSNP
rs570036952 1092 dbSNP
rs947943046 1093 dbSNP
rs909828139 1095 dbSNP
rs1016438462 1098 dbSNP
rs747575446 1100 dbSNP
rs996629722 1100 dbSNP
rs186662631 1114 dbSNP
rs918311511 1116 dbSNP
rs554565392 1119 dbSNP
rs1284256639 1121 dbSNP
rs1193289710 1127 dbSNP
rs950990131 1132 dbSNP
rs1026506710 1141 dbSNP
rs1188771345 1145 dbSNP
rs1439747651 1148 dbSNP
rs536268618 1149 dbSNP
rs964983847 1150 dbSNP
rs997753147 1152 dbSNP
rs1290245926 1157 dbSNP
rs902116748 1166 dbSNP
rs1176711449 1169 dbSNP
rs1368858670 1172 dbSNP
rs1168194906 1173 dbSNP
rs1458641371 1176 dbSNP
rs1370440396 1177 dbSNP
rs1449816646 1179 dbSNP
rs1262760084 1182 dbSNP
rs1166599057 1191 dbSNP
rs1421837606 1192 dbSNP
rs1017888740 1193 dbSNP
rs1212251869 1197 dbSNP
rs113958691 1201 dbSNP
rs1256643744 1205 dbSNP
rs1182878328 1209 dbSNP
rs1483746144 1213 dbSNP
rs1006552325 1216 dbSNP
rs1249029919 1217 dbSNP
rs1203967607 1218 dbSNP
rs1038971079 1223 dbSNP
rs1266877819 1225 dbSNP
rs886045186 1234 dbSNP
rs774290705 1237 dbSNP
rs1380104907 1240 dbSNP
rs748948331 1242 dbSNP
rs1230843958 1246 dbSNP
rs1348675103 1247 dbSNP
rs1307444965 1248 dbSNP
rs572143295 1250 dbSNP
rs1416582776 1251 dbSNP
rs756296504 1256 dbSNP
rs553811159 1265 dbSNP
rs915014 1268 dbSNP
rs891661059 1270 dbSNP
rs775118437 1271 dbSNP
rs1456184029 1272 dbSNP
rs1416976507 1273 dbSNP
rs1159769329 1274 dbSNP
rs1430240064 1275 dbSNP
rs1473557663 1276 dbSNP
rs559850818 1277 dbSNP
rs1180419010 1278 dbSNP
rs1451682809 1279 dbSNP
rs770052934 1280 dbSNP
rs746048298 1281 dbSNP
rs1468316345 1282 dbSNP
rs369053847 1283 dbSNP
rs886045185 1285 dbSNP
rs1327650792 1286 dbSNP
rs1288274419 1288 dbSNP
rs1233984284 1289 dbSNP
rs868014 1290 dbSNP
rs1045085128 1291 dbSNP
rs747078351 1292 dbSNP
rs188657034 1293 dbSNP
rs375481053 1294 dbSNP
rs1048801080 1299 dbSNP
rs753152096 1300 dbSNP
rs918426637 1301 dbSNP
rs976591820 1302 dbSNP
rs1157944661 1307 dbSNP
rs1478063884 1309 dbSNP
rs1378927213 1311 dbSNP
rs965098573 1312 dbSNP
rs1453472244 1313 dbSNP
rs549710861 1317 dbSNP
rs1248292215 1319 dbSNP
rs928541992 1320 dbSNP
rs1463833804 1323 dbSNP
rs1284164587 1324 dbSNP
rs1201595765 1325 dbSNP
rs1347174127 1327 dbSNP
rs1254385959 1328 dbSNP
rs1233683830 1336 dbSNP
rs1366157701 1338 dbSNP
rs979760459 1339 dbSNP
rs1165906434 1341 dbSNP
rs1300106413 1354 dbSNP
rs1476267198 1356 dbSNP
rs1415684985 1358 dbSNP
rs191876689 1359 dbSNP
rs1362841867 1364 dbSNP
rs45445997 1367 dbSNP
rs781559834 1368 dbSNP
rs985079783 1369 dbSNP
rs755865052 1370 dbSNP
rs1480500800 1373 dbSNP
rs1273496434 1375 dbSNP
rs113875188 1378 dbSNP
rs112233669 1379 dbSNP
rs1403694056 1381 dbSNP
rs1170244907 1388 dbSNP
rs750033466 1389 dbSNP
rs1292078740 1393 dbSNP
rs1390341794 1398 dbSNP
rs1190172385 1405 dbSNP
rs767153383 1409 dbSNP
rs1337506151 1410 dbSNP
rs75810348 1412 dbSNP
rs984971478 1415 dbSNP
rs1188825299 1418 dbSNP
rs191460937 1420 dbSNP
rs138526324 1422 dbSNP
rs1463158507 1428 dbSNP
rs1210174344 1430 dbSNP
rs773814238 1431 dbSNP
rs1164255665 1435 dbSNP
rs527656604 1436 dbSNP
rs1470537825 1442 dbSNP
rs866872136 1445 dbSNP
rs1337170480 1446 dbSNP
rs560319585 1447 dbSNP
rs1253955777 1449 dbSNP
rs1448512574 1454 dbSNP
rs1342121819 1455 dbSNP
rs976240166 1456 dbSNP
rs781775342 1457 dbSNP
rs1031167500 1459 dbSNP
rs1018307405 1462 dbSNP
rs1258960012 1466 dbSNP
rs1238160448 1469 dbSNP
rs112141230 1471 dbSNP
rs533310380 1484 dbSNP
rs1023751734 1487 dbSNP
rs374660279 1488 dbSNP
rs903875351 1489 dbSNP
rs544830292 1490 dbSNP
rs1022363826 1493 dbSNP
rs1157350113 1506 dbSNP
rs1010034987 1510 dbSNP
rs1048276056 1512 dbSNP
rs929876311 1516 dbSNP
rs897112727 1521 dbSNP
rs574354244 1529 dbSNP
rs886045184 1531 dbSNP
rs1309027433 1538 dbSNP
rs1040841037 1540 dbSNP
rs892571588 1544 dbSNP
rs1052898949 1545 dbSNP
rs1204505004 1562 dbSNP
rs1348455587 1563 dbSNP
rs938504675 1571 dbSNP
rs1282346806 1582 dbSNP
rs1366378960 1590 dbSNP
rs755543299 1597 dbSNP
rs1346871173 1599 dbSNP
rs1274556905 1610 dbSNP
rs1431677684 1620 dbSNP
rs1328295800 1622 dbSNP
rs1316260658 1625 dbSNP
rs907112624 1631 dbSNP
rs1399438487 1632 dbSNP
rs562389867 1633 dbSNP
rs910942818 1634 dbSNP
rs948396727 1634 dbSNP
rs1394853386 1635 dbSNP
rs1168196722 1637 dbSNP
rs540959127 1640 dbSNP
rs879523777 1641 dbSNP
rs1370882146 1643 dbSNP
rs1191883138 1649 dbSNP
rs984487446 1656 dbSNP
rs1415323388 1677 dbSNP
rs947035266 1678 dbSNP
rs1208552738 1681 dbSNP
rs929036016 1681 dbSNP
rs372358914 1686 dbSNP
rs919010061 1698 dbSNP
rs976212337 1700 dbSNP
rs751667642 1701 dbSNP
rs1215424981 1704 dbSNP
rs780269159 1712 dbSNP
rs957175250 1715 dbSNP
rs966221316 1716 dbSNP
rs1315442845 1736 dbSNP
rs1413458905 1742 dbSNP
rs1017836334 1743 dbSNP
rs982261367 1761 dbSNP
rs1329925951 1764 dbSNP
rs72640221 1765 dbSNP
rs1393903129 1767 dbSNP
rs1169439796 1770 dbSNP
rs1475249392 1771 dbSNP
rs1489772400 1773 dbSNP
rs1263943917 1774 dbSNP
rs1244329069 1776 dbSNP
rs780200493 1789 dbSNP
rs553529153 1793 dbSNP
rs1322466017 1797 dbSNP
rs1314957688 1798 dbSNP
rs1022692379 1800 dbSNP
rs1012746896 1803 dbSNP
rs1350451115 1806 dbSNP
rs1289473569 1809 dbSNP
rs1206392920 1813 dbSNP
rs114646114 1814 dbSNP
rs1388983011 1821 dbSNP
rs188149872 1824 dbSNP
rs556288170 1825 dbSNP
rs758483138 1827 dbSNP
rs1458080305 1831 dbSNP
rs1002707021 1850 dbSNP
rs537668565 1851 dbSNP
rs114290429 1852 dbSNP
rs1013220827 1856 dbSNP
rs887720880 1857 dbSNP
rs2077360 1858 dbSNP
rs1353050015 1859 dbSNP
rs886045183 1860 dbSNP
rs929008236 1864 dbSNP
rs1461622344 1873 dbSNP
rs889620156 1874 dbSNP
rs1162212420 1881 dbSNP
rs1404195226 1882 dbSNP
rs1431297397 1883 dbSNP
rs1178810966 1884 dbSNP
rs919003386 1890 dbSNP
rs1370706360 1892 dbSNP
rs1040123339 1894 dbSNP
rs1232078051 1900 dbSNP
rs1178311029 1901 dbSNP
rs1170059304 1902 dbSNP
rs533874353 1904 dbSNP
rs1418373515 1907 dbSNP
rs1164154431 1911 dbSNP
rs1327423953 1917 dbSNP
rs1473983280 1918 dbSNP
rs1285414592 1919 dbSNP
rs1236175569 1920 dbSNP
rs1187946911 1921 dbSNP
rs1321135225 1923 dbSNP
rs1483422304 1923 dbSNP
rs947116100 1925 dbSNP
rs1254124682 1931 dbSNP
rs775380089 1932 dbSNP
rs1405342386 1936 dbSNP
rs866589477 1948 dbSNP
rs1437412753 1950 dbSNP
rs752100185 1951 dbSNP
rs1290900701 1952 dbSNP
rs1228615756 1955 dbSNP
rs566853939 1956 dbSNP
rs1358274015 1957 dbSNP
rs1291356629 1962 dbSNP
rs551486571 1967 dbSNP
rs910680005 1968 dbSNP
rs986332098 1971 dbSNP
rs759766598 1973 dbSNP
rs988863619 1974 dbSNP
rs1323828407 1975 dbSNP
rs1161277151 1976 dbSNP
rs1398858412 1978 dbSNP
rs1379497353 1979 dbSNP
rs1407427278 1982 dbSNP
rs533425321 1983 dbSNP
rs915502191 1985 dbSNP
rs988133856 1987 dbSNP
rs1164801007 1989 dbSNP
rs886045182 1993 dbSNP
rs562859148 1994 dbSNP
rs956732405 1996 dbSNP
rs1180056472 2004 dbSNP
rs1469703877 2006 dbSNP
rs1488233746 2009 dbSNP
rs1242758216 2011 dbSNP
rs1247494978 2012 dbSNP
rs1035087113 2014 dbSNP
rs1176625917 2015 dbSNP
rs1453082525 2017 dbSNP
rs1003659962 2019 dbSNP
rs969513926 2020 dbSNP
rs1271087445 2022 dbSNP
rs1023196280 2024 dbSNP
rs1212858225 2026 dbSNP
rs1424841125 2036 dbSNP
rs1012755813 2040 dbSNP
rs771138234 2045 dbSNP
rs143100671 2053 dbSNP
rs1049005828 2054 dbSNP
rs1221520887 2055 dbSNP
rs1372059918 2057 dbSNP
rs773140384 2058 dbSNP
rs1438224230 2060 dbSNP
rs1392711616 2065 dbSNP
rs149055513 2067 dbSNP
rs1458124450 2068 dbSNP
rs1391386259 2070 dbSNP
rs748561255 2075 dbSNP
rs779427716 2076 dbSNP
rs1393028868 2081 dbSNP
rs1027101657 2096 dbSNP
rs1434642955 2106 dbSNP
rs758721001 2107 dbSNP
rs897523338 2107 dbSNP
rs1040027411 2113 dbSNP
rs1487317643 2121 dbSNP
rs1212221599 2125 dbSNP
rs944433478 2131 dbSNP
rs562305112 2138 dbSNP
rs1254607249 2146 dbSNP
rs1019451523 2150 dbSNP
rs1307746263 2155 dbSNP
rs757500259 2159 dbSNP
rs1008107972 2160 dbSNP
rs1339191803 2170 dbSNP
rs946942030 2170 dbSNP
rs1464552131 2175 dbSNP
rs1268834968 2181 dbSNP
rs540922358 2187 dbSNP
rs866423719 2189 dbSNP
rs889733530 2193 dbSNP
rs1373446795 2196 dbSNP
rs1050023096 2201 dbSNP
rs528831502 2209 dbSNP
rs560051837 2220 dbSNP
rs1343495577 2222 dbSNP
rs886045181 2222 dbSNP
rs892864199 2227 dbSNP
rs1052885355 2231 dbSNP
rs1255880172 2233 dbSNP
rs934294707 2233 dbSNP
rs767307823 2237 dbSNP
rs988418357 2238 dbSNP
rs928286729 2241 dbSNP
rs1476456044 2242 dbSNP
rs1254640207 2243 dbSNP
rs956680646 2249 dbSNP
rs1481130221 2250 dbSNP
rs1252705456 2251 dbSNP
rs1426009937 2257 dbSNP
rs1193112418 2260 dbSNP
rs927922037 2269 dbSNP
rs755339389 2270 dbSNP
rs1252639379 2271 dbSNP
rs1192700788 2272 dbSNP
rs749661442 2275 dbSNP
rs1269931811 2278 dbSNP
rs1224314008 2279 dbSNP
rs1213639078 2280 dbSNP
rs1311852262 2282 dbSNP
rs1046648365 2286 dbSNP
rs544692675 2287 dbSNP
rs1300177113 2288 dbSNP
rs768245863 2290 dbSNP
rs982127338 2291 dbSNP
rs1368284981 2295 dbSNP
rs781062180 2296 dbSNP
rs577635601 2301 dbSNP
rs751130740 2305 dbSNP
rs969839016 2308 dbSNP
rs555815683 2309 dbSNP
rs1023729715 2310 dbSNP
rs1178272337 2311 dbSNP
rs368230034 2313 dbSNP
rs1420122956 2314 dbSNP
rs951935644 2316 dbSNP
rs1253083387 2321 dbSNP
rs1394640865 2324 dbSNP
rs1169531942 2325 dbSNP
rs1449845822 2328 dbSNP
rs1027515586 2333 dbSNP
rs1249708816 2336 dbSNP
rs1176444757 2338 dbSNP
rs1184689015 2340 dbSNP
rs1273376300 2341 dbSNP
rs1485475867 2342 dbSNP
rs1215039756 2344 dbSNP
rs763465988 2346 dbSNP
rs952924708 2348 dbSNP
rs758358400 2352 dbSNP
rs993346072 2355 dbSNP
rs1337013014 2357 dbSNP
rs897762184 2358 dbSNP
rs543936102 2364 dbSNP
rs1445721047 2372 dbSNP
rs919982559 2374 dbSNP
rs1326759984 2378 dbSNP
rs752517980 2381 dbSNP
rs765145709 2384 dbSNP
rs374047798 2387 dbSNP
rs561769924 2388 dbSNP
rs1008221306 2394 dbSNP
rs946857648 2395 dbSNP
rs1412996728 2401 dbSNP
rs1374999629 2405 dbSNP
rs894010474 2406 dbSNP
rs953945921 2407 dbSNP
rs756848662 2409 dbSNP
rs776374746 2410 dbSNP
rs1168011343 2415 dbSNP
rs1011793802 2417 dbSNP
rs773668262 2418 dbSNP
rs1190055104 2420 dbSNP
rs1348244931 2421 dbSNP
rs1484385637 2422 dbSNP
rs1366344414 2425 dbSNP
rs1256251584 2431 dbSNP
rs1205280814 2438 dbSNP
rs1235677246 2441 dbSNP
rs1420861758 2442 dbSNP
rs555188130 2444 dbSNP
rs868543358 2445 dbSNP
rs1322935423 2448 dbSNP
rs1227072884 2451 dbSNP
rs1322756460 2452 dbSNP
rs760756415 2455 dbSNP
rs770536637 2456 dbSNP
rs1296821335 2457 dbSNP
rs1354882280 2461 dbSNP
rs1308666880 2463 dbSNP
rs1411778537 2465 dbSNP
rs998611792 2475 dbSNP
rs886045180 2477 dbSNP
rs534045485 2478 dbSNP
rs1175178859 2481 dbSNP
rs1297835928 2481 dbSNP
rs928204979 2482 dbSNP
rs748705522 2490 dbSNP
rs1476820456 2493 dbSNP
rs1350292196 2494 dbSNP
rs1166977246 2495 dbSNP
rs566663800 2497 dbSNP
rs906992952 2500 dbSNP
rs1182181357 2502 dbSNP
rs948115020 2503 dbSNP
rs1244991062 2504 dbSNP
rs1247960473 2507 dbSNP
rs1194936727 2509 dbSNP
rs558100195 2510 dbSNP
rs1485908930 2513 dbSNP
rs1267659628 2521 dbSNP
rs1202436770 2522 dbSNP
rs1343169999 2523 dbSNP
rs886045179 2526 dbSNP
rs762678203 2527 dbSNP
rs952919098 2532 dbSNP
rs1289530000 2533 dbSNP
rs1230243107 2536 dbSNP
rs1334119562 2537 dbSNP
rs1306558447 2543 dbSNP
rs1027419162 2545 dbSNP
rs1296826436 2546 dbSNP
rs780544847 2550 dbSNP
rs748870451 2551 dbSNP
rs539472116 2553 dbSNP
rs1393561836 2554 dbSNP
rs1159890104 2562 dbSNP
rs1454887623 2564 dbSNP
rs1361604916 2568 dbSNP
rs1315193370 2572 dbSNP
rs1180622402 2573 dbSNP
rs746603471 2584 dbSNP
rs1401072589 2592 dbSNP
rs1254533237 2593 dbSNP
rs916791836 2593 dbSNP
rs41275468 2594 dbSNP
rs1192917766 2596 dbSNP
rs11559040 2598 dbSNP
rs748486375 2599 dbSNP
rs1168535596 2603 dbSNP
rs185639600 2605 dbSNP
rs778861331 2606 dbSNP
rs1348599290 2608 dbSNP
rs973347052 2611 dbSNP
rs1234093773 2612 dbSNP
rs888812627 2615 dbSNP
rs1301536792 2616 dbSNP
rs754883533 2618 dbSNP
rs1370059181 2622 dbSNP
rs1029148830 2627 dbSNP
rs1321102822 2633 dbSNP
rs1383903827 2634 dbSNP
rs1382731496 2637 dbSNP
rs1157444821 2639 dbSNP
rs1423262555 2640 dbSNP
rs1466111457 2642 dbSNP
rs1396449150 2643 dbSNP
rs1446284193 2650 dbSNP
rs564466007 2653 dbSNP
rs1454105228 2654 dbSNP
rs1249080051 2656 dbSNP
rs371188005 2657 dbSNP
rs990084167 2661 dbSNP
rs1445735349 2664 dbSNP
rs1273714236 2667 dbSNP
rs1169374875 2668 dbSNP
rs1537514 2669 dbSNP
rs528746603 2671 dbSNP
rs935494859 2672 dbSNP
rs1415888606 2673 dbSNP
rs906777088 2674 dbSNP
rs750555459 2676 dbSNP
rs1361589617 2681 dbSNP
rs555402822 2682 dbSNP
rs34733339 2683 dbSNP
rs775229538 2683 dbSNP
rs1233225772 2684 dbSNP
rs1233893119 2685 dbSNP
rs758532960 2690 dbSNP
rs761866671 2693 dbSNP
rs998713484 2694 dbSNP
rs546502055 2695 dbSNP
rs916557063 2696 dbSNP
rs1229384819 2697 dbSNP
rs1324552013 2699 dbSNP
rs1317575018 2702 dbSNP
rs1396095501 2706 dbSNP
rs1376818698 2712 dbSNP
rs1335476888 2715 dbSNP
rs984547160 2716 dbSNP
rs931355611 2717 dbSNP
rs1390437162 2723 dbSNP
rs35066719 2728 dbSNP
rs1169942613 2729 dbSNP
rs750623408 2732 dbSNP
rs1024076688 2733 dbSNP
rs918677317 2737 dbSNP
rs1449405739 2739 dbSNP
rs1372990037 2741 dbSNP
rs971861508 2742 dbSNP
rs1374221374 2743 dbSNP
rs1012566280 2746 dbSNP
rs1441005901 2748 dbSNP
rs1188928167 2750 dbSNP
rs138288803 2751 dbSNP
rs1255551955 2754 dbSNP
rs779065486 2755 dbSNP
rs1210288730 2757 dbSNP
rs1483483584 2761 dbSNP
rs763508209 2768 dbSNP
rs1404669491 2770 dbSNP
rs1216051782 2773 dbSNP
rs1408576089 2774 dbSNP
rs1055751313 2775 dbSNP
rs1337272003 2776 dbSNP
rs1269517074 2785 dbSNP
rs961890332 2788 dbSNP
rs1233869144 2794 dbSNP
rs1356794432 2796 dbSNP
rs116013353 2801 dbSNP
rs193231767 2804 dbSNP
rs116698217 2805 dbSNP
rs1330541909 2806 dbSNP
rs758990799 2807 dbSNP
rs886045178 2809 dbSNP
rs1396274742 2814 dbSNP
rs1028636419 2817 dbSNP
rs555102130 2818 dbSNP
rs1368070021 2820 dbSNP
rs1476446473 2828 dbSNP
rs1416380695 2834 dbSNP
rs1537515 2835 dbSNP
rs777353108 2842 dbSNP
rs1472969630 2845 dbSNP
rs1234802551 2857 dbSNP
rs940221778 2859 dbSNP
rs751569155 2866 dbSNP
rs1182054178 2867 dbSNP
rs1030790945 2873 dbSNP
rs573066823 2874 dbSNP
rs1537516 2876 dbSNP
rs986862970 2877 dbSNP
rs906727494 2878 dbSNP
rs1047013802 2887 dbSNP
rs1291321738 2897 dbSNP
rs1435065985 2899 dbSNP
rs534035001 2900 dbSNP
rs932603125 2901 dbSNP
rs1299890900 2904 dbSNP
rs1417704733 2906 dbSNP
rs1450687760 2906 dbSNP
rs1379437783 2909 dbSNP
rs1158321807 2912 dbSNP
rs921281125 2923 dbSNP
rs1189565639 2925 dbSNP
rs1477704301 2927 dbSNP
rs1012476944 2934 dbSNP
rs1219423532 2935 dbSNP
rs895387070 2936 dbSNP
rs539755675 2937 dbSNP
rs1487542568 2939 dbSNP
rs1285721256 2943 dbSNP
rs1211998866 2945 dbSNP
rs1313612871 2946 dbSNP
rs1298665760 2957 dbSNP
rs3820192 2965 dbSNP
rs957293378 2966 dbSNP
rs1280082168 2968 dbSNP
rs1398043249 2972 dbSNP
rs1032037057 2975 dbSNP
rs114673809 2977 dbSNP
rs3737966 2978 dbSNP
rs1361124377 2981 dbSNP
rs1174138244 2982 dbSNP
rs568579504 2983 dbSNP
rs773181165 2991 dbSNP
rs28484963 2995 dbSNP
rs35562212 2997 dbSNP
rs1196524683 2999 dbSNP
rs911702434 3000 dbSNP
rs372869912 3001 dbSNP
rs376106666 3006 dbSNP
rs1435445058 3012 dbSNP
rs1253948395 3017 dbSNP
rs1484403929 3017 dbSNP
rs1208973629 3024 dbSNP
rs1330766937 3026 dbSNP
rs528653413 3028 dbSNP
rs921853564 3036 dbSNP
rs989154150 3041 dbSNP
rs894250745 3045 dbSNP
rs569629260 3046 dbSNP
rs1159154886 3052 dbSNP
rs1030741986 3059 dbSNP
rs1293764623 3061 dbSNP
rs994933775 3063 dbSNP
rs898734167 3065 dbSNP
rs999246324 3068 dbSNP
rs1465706664 3070 dbSNP
rs1401255689 3071 dbSNP
rs1458245690 3073 dbSNP
rs1037258372 3077 dbSNP
rs970484051 3078 dbSNP
rs1025102107 3079 dbSNP
rs867995790 3081 dbSNP
rs1012834933 3082 dbSNP
rs538074274 3088 dbSNP
rs1246972255 3089 dbSNP
rs747851112 3090 dbSNP
rs531284429 3092 dbSNP
rs1239566307 3094 dbSNP
rs1196218947 3106 dbSNP
rs1051093122 3107 dbSNP
rs1049158823 3109 dbSNP
rs551190329 3112 dbSNP
rs1311785803 3113 dbSNP
rs1463210812 3114 dbSNP
rs995447775 3120 dbSNP
rs769059135 3121 dbSNP
rs1377950194 3132 dbSNP
rs1246865834 3133 dbSNP
rs1208743511 3134 dbSNP
rs1202776108 3137 dbSNP
rs1459868650 3141 dbSNP
rs539477910 3143 dbSNP
rs1054449562 3154 dbSNP
rs1272087701 3156 dbSNP
rs1214127199 3157 dbSNP
rs886045177 3158 dbSNP
rs1271210784 3162 dbSNP
rs944104218 3164 dbSNP
rs1267407832 3166 dbSNP
rs1161351503 3167 dbSNP
rs747705929 3168 dbSNP
rs369313497 3169 dbSNP
rs1280893268 3171 dbSNP
rs1439630169 3172 dbSNP
rs931842678 3176 dbSNP
rs754937889 3177 dbSNP
rs1326952207 3184 dbSNP
rs886045176 3189 dbSNP
rs1463351945 3193 dbSNP
rs769131343 3194 dbSNP
rs753706728 3195 dbSNP
rs1457831701 3197 dbSNP
rs1410311443 3199 dbSNP
rs1175679525 3200 dbSNP
rs755921837 3201 dbSNP
rs991360809 3204 dbSNP
rs1362829132 3205 dbSNP
rs1247513298 3206 dbSNP
rs1193964807 3218 dbSNP
rs566155977 3219 dbSNP
rs150449128 3220 dbSNP
rs1213029369 3222 dbSNP
rs1316960664 3225 dbSNP
rs776116281 3226 dbSNP
rs1430888696 3228 dbSNP
rs1285684202 3231 dbSNP
rs1221610889 3235 dbSNP
rs1349427500 3237 dbSNP
rs1266668022 3243 dbSNP
rs1217231804 3246 dbSNP
rs751714928 3248 dbSNP
rs547557995 3249 dbSNP
rs764231951 3250 dbSNP
rs977754404 3251 dbSNP
rs1235518781 3255 dbSNP
rs1329410145 3259 dbSNP
rs1283269529 3261 dbSNP
rs1432176314 3263 dbSNP
rs1347488619 3265 dbSNP
rs970469280 3267 dbSNP
rs760997163 3268 dbSNP
rs1400203956 3269 dbSNP
rs1401118424 3270 dbSNP
rs990998939 3270 dbSNP
rs1426113534 3273 dbSNP
rs755383372 3275 dbSNP
rs1455396442 3276 dbSNP
rs1250960105 3279 dbSNP
rs1192796130 3282 dbSNP
rs886045175 3284 dbSNP
rs561469824 3287 dbSNP
rs3737967 3288 dbSNP
rs1212967399 3289 dbSNP
rs770326136 3290 dbSNP
rs1376553849 3293 dbSNP
rs2184226 3301 dbSNP
rs1004426887 3304 dbSNP
rs1346147175 3305 dbSNP
rs757399730 3307 dbSNP
rs995688493 3309 dbSNP
rs1303073154 3311 dbSNP
rs1215557489 3312 dbSNP
rs897432055 3313 dbSNP
rs1260871359 3319 dbSNP
rs1287688808 3320 dbSNP
rs1015511592 3325 dbSNP
rs1192682752 3327 dbSNP
rs564348925 3327 dbSNP
rs1376180515 3328 dbSNP
rs1314979449 3329 dbSNP
rs1008190529 3340 dbSNP
rs891203661 3341 dbSNP
rs1343019578 3344 dbSNP
rs1051200948 3346 dbSNP
rs1282222586 3349 dbSNP
rs1050307974 3352 dbSNP
rs188514323 3353 dbSNP
rs1225821670 3356 dbSNP
rs1340338717 3358 dbSNP
rs935979530 3360 dbSNP
rs924614599 3366 dbSNP
rs371980324 3367 dbSNP
rs1301673407 3368 dbSNP
rs1170794929 3372 dbSNP
rs1053635991 3373 dbSNP
rs1447927180 3374 dbSNP
rs917195359 3376 dbSNP
rs936533159 3377 dbSNP
rs923862218 3390 dbSNP
rs557355095 3393 dbSNP
rs1189925324 3394 dbSNP
rs201412599 3397 dbSNP
rs72505075 3399 dbSNP
rs113394969 3400 dbSNP
rs183631107 3402 dbSNP
rs34762557 3402 dbSNP
rs190086595 3403 dbSNP
rs35134728 3403 dbSNP
rs70983598 3403 dbSNP
rs1168807946 3408 dbSNP
rs1320089903 3413 dbSNP
rs191871636 3417 dbSNP
rs1256778563 3427 dbSNP
rs878979686 3429 dbSNP
rs1429850913 3436 dbSNP
rs1357547134 3437 dbSNP
rs553174802 3448 dbSNP
rs973564643 3449 dbSNP
rs961653444 3451 dbSNP
rs780835644 3452 dbSNP
rs1180718888 3453 dbSNP
rs1328156006 3454 dbSNP
rs760710074 3463 dbSNP
rs1259473165 3467 dbSNP
rs1202785456 3471 dbSNP
rs1014533659 3478 dbSNP
rs200822442 3479 dbSNP
rs959166883 3481 dbSNP
rs1179481382 3489 dbSNP
rs1008554908 3490 dbSNP
rs1274236652 3495 dbSNP
rs955601687 3496 dbSNP
rs1027088307 3498 dbSNP
rs1205480669 3499 dbSNP
rs187031844 3503 dbSNP
rs1208431977 3511 dbSNP
rs564460886 3513 dbSNP
rs1309395917 3515 dbSNP
rs974216496 3517 dbSNP
rs1029885178 3523 dbSNP
rs961576511 3533 dbSNP
rs1356684502 3537 dbSNP
rs1015833587 3538 dbSNP
rs754850267 3551 dbSNP
rs1008180724 3556 dbSNP
rs1408430959 3559 dbSNP
rs751419483 3561 dbSNP
rs1351553539 3563 dbSNP
rs1370334991 3564 dbSNP
rs182398073 3570 dbSNP
rs1216976791 3576 dbSNP
rs1423836692 3576 dbSNP
rs1463215024 3581 dbSNP
rs1441813972 3584 dbSNP
rs1406007672 3586 dbSNP
rs1347689841 3589 dbSNP
rs1176702903 3592 dbSNP
rs1000680496 3594 dbSNP
rs1033066254 3594 dbSNP
rs758433593 3595 dbSNP
rs1490302746 3604 dbSNP
rs572471521 3614 dbSNP
rs767411205 3621 dbSNP
rs1219194316 3639 dbSNP
rs147946793 3643 dbSNP
rs1053583397 3647 dbSNP
rs1461461313 3650 dbSNP
rs895706618 3658 dbSNP
rs936523336 3666 dbSNP
rs1056135626 3668 dbSNP
rs1404230023 3685 dbSNP
rs902426009 3686 dbSNP
rs1299834811 3689 dbSNP
rs1472178912 3691 dbSNP
rs1042349655 3694 dbSNP
rs1252256055 3701 dbSNP
rs920429091 3704 dbSNP
rs1427324623 3705 dbSNP
rs537306768 3707 dbSNP
rs973292836 3724 dbSNP
rs1178664209 3726 dbSNP
rs949066488 3733 dbSNP
rs1196313727 3737 dbSNP
rs144624195 3739 dbSNP
rs1241219340 3740 dbSNP
rs1263862174 3746 dbSNP
rs990520761 3761 dbSNP
rs1313482498 3764 dbSNP
rs937720864 3770 dbSNP
rs1275938330 3775 dbSNP
rs1222327002 3776 dbSNP
rs1220991326 3784 dbSNP
rs1346614625 3790 dbSNP
rs1279946772 3791 dbSNP
rs1397982387 3809 dbSNP
rs1360991921 3811 dbSNP
rs749896521 3819 dbSNP
rs974204749 3831 dbSNP
rs987069756 3835 dbSNP
rs1227081488 3843 dbSNP
rs961563543 3861 dbSNP
rs954397595 3865 dbSNP
rs1469303356 3866 dbSNP
rs1425058470 3870 dbSNP
rs550133360 3871 dbSNP
rs1029877485 3875 dbSNP
rs976080950 3880 dbSNP
rs372468963 3889 dbSNP
rs908781340 3898 dbSNP
rs561382029 3899 dbSNP
rs1308170526 3905 dbSNP
rs1182767443 3911 dbSNP
rs1393463666 3912 dbSNP
rs565962962 3927 dbSNP
rs1240823198 3934 dbSNP
rs866057115 3940 dbSNP
rs372228149 3944 dbSNP
rs1457816420 3956 dbSNP
rs1000393582 3957 dbSNP
rs373669592 3958 dbSNP
rs886045174 3963 dbSNP
rs1020393173 3967 dbSNP
rs189783792 3973 dbSNP
rs142369131 3974 dbSNP
rs1334882363 3979 dbSNP
rs2184227 3995 dbSNP
rs545991628 4001 dbSNP
rs1431208464 4002 dbSNP
rs1042256525 4010 dbSNP
rs1165949859 4013 dbSNP
rs1436895708 4025 dbSNP
rs899118838 4025 dbSNP
rs1383074294 4027 dbSNP
rs1193240003 4039 dbSNP
rs1469011481 4040 dbSNP
rs886045173 4041 dbSNP
rs1037919263 4043 dbSNP
rs1193530622 4044 dbSNP
rs1206832028 4047 dbSNP
rs1265896454 4049 dbSNP
rs1223499023 4050 dbSNP
rs1329116184 4051 dbSNP
rs1261780516 4055 dbSNP
rs1241681849 4056 dbSNP
rs1310772199 4057 dbSNP
rs1343033377 4058 dbSNP
rs1245480686 4059 dbSNP
rs1377877251 4059 dbSNP
rs886045172 4062 dbSNP
rs78722668 4063 dbSNP
rs1389690294 4071 dbSNP
rs1372646659 4072 dbSNP
rs896407305 4073 dbSNP
rs1433660063 4075 dbSNP
rs1385609100 4076 dbSNP
rs1294631009 4077 dbSNP
rs1491285283 4077 dbSNP
rs1055165654 4078 dbSNP
rs1162575553 4078 dbSNP
rs1179063105 4078 dbSNP
rs1268053034 4078 dbSNP
rs1364077657 4078 dbSNP
rs1439949918 4078 dbSNP
rs1491532424 4078 dbSNP
rs55780505 4078 dbSNP
rs755027235 4078 dbSNP
rs774051202 4078 dbSNP
rs781205127 4078 dbSNP
rs1335235844 4079 dbSNP
rs1302643430 4081 dbSNP
rs1407260884 4083 dbSNP
rs575577732 4084 dbSNP
rs919677776 4085 dbSNP
rs1173971745 4087 dbSNP
rs1038110415 4088 dbSNP
rs923707579 4089 dbSNP
rs563550540 4093 dbSNP
rs1454876260 4096 dbSNP
rs1397079424 4099 dbSNP
rs542177264 4100 dbSNP
rs1377669663 4107 dbSNP
rs1177556969 4109 dbSNP
rs1446474271 4110 dbSNP
rs908688875 4116 dbSNP
rs932956142 4120 dbSNP
rs764347204 4142 dbSNP
rs921590221 4143 dbSNP
rs1489147492 4144 dbSNP
rs1264201217 4149 dbSNP
rs1207400753 4157 dbSNP
rs1350093066 4160 dbSNP
rs774295533 4168 dbSNP
rs775738162 4178 dbSNP
rs1225372173 4181 dbSNP
rs975814376 4182 dbSNP
rs957381558 4189 dbSNP
rs1235392701 4192 dbSNP
rs1283129306 4200 dbSNP
rs541259931 4205 dbSNP
rs1033297009 4206 dbSNP
rs1315835769 4208 dbSNP
rs1227084491 4217 dbSNP
rs1381335287 4217 dbSNP
rs1326504031 4227 dbSNP
rs1467716768 4233 dbSNP
rs1428599159 4234 dbSNP
rs1033080590 4237 dbSNP
rs1320277859 4238 dbSNP
rs1371096210 4238 dbSNP
rs1394235851 4239 dbSNP
rs1401331108 4241 dbSNP
rs1313297959 4242 dbSNP
rs1436304911 4243 dbSNP
rs184978486 4244 dbSNP
rs112469003 4254 dbSNP
rs573867846 4254 dbSNP
rs1263125446 4257 dbSNP
rs1166908027 4263 dbSNP
rs886045171 4267 dbSNP
rs746375674 4270 dbSNP
rs57739320 4275 dbSNP
rs1014353928 4283 dbSNP
rs4845884 4290 dbSNP
rs1338292143 4291 dbSNP
rs748502645 4295 dbSNP
rs553378191 4296 dbSNP
rs1404697330 4299 dbSNP
rs1195343976 4300 dbSNP
rs1422585936 4301 dbSNP
rs534760603 4302 dbSNP
rs1173959669 4313 dbSNP
rs1257381003 4322 dbSNP
rs1013428487 4334 dbSNP
rs896385823 4338 dbSNP
rs1272121253 4351 dbSNP
rs142884651 4353 dbSNP
rs933024907 4357 dbSNP
rs766283470 4373 dbSNP
rs1472964627 4376 dbSNP
rs1001565583 4378 dbSNP
rs899064087 4381 dbSNP
rs1442907832 4385 dbSNP
rs1055091409 4390 dbSNP
rs1241939306 4400 dbSNP
rs1242644799 4403 dbSNP
rs1434178623 4407 dbSNP
rs377428401 4414 dbSNP
rs1293812926 4417 dbSNP
rs886045170 4421 dbSNP
rs1271420196 4426 dbSNP
rs1004634933 4438 dbSNP
rs886281851 4446 dbSNP
rs1348387418 4452 dbSNP
rs1381531288 4459 dbSNP
rs1309376565 4463 dbSNP
rs1443667537 4464 dbSNP
rs1057624 4467 dbSNP
rs1328094021 4473 dbSNP
rs537270036 4478 dbSNP
rs1038015410 4479 dbSNP
rs1169753414 4482 dbSNP
rs4846048 4485 dbSNP
rs1384783869 4488 dbSNP
rs886045169 4489 dbSNP
rs372788905 4494 dbSNP
rs369609825 4505 dbSNP
rs886045168 4506 dbSNP
rs926172858 4507 dbSNP
rs934212275 4512 dbSNP
rs921496812 4513 dbSNP
rs1476425048 4517 dbSNP
rs1250083433 4529 dbSNP
rs1181457365 4530 dbSNP
rs975718749 4532 dbSNP
rs936250261 4533 dbSNP
rs1370520585 4535 dbSNP
rs1278937825 4538 dbSNP
rs15854 4539 dbSNP
rs1437068813 4545 dbSNP
rs1347270471 4547 dbSNP
rs886045167 4549 dbSNP
rs913392767 4550 dbSNP
rs1404036437 4551 dbSNP
rs1207606869 4566 dbSNP
rs1402576605 4571 dbSNP
rs925919532 4587 dbSNP
rs993035298 4593 dbSNP
rs977422717 4611 dbSNP
rs1481061326 4625 dbSNP
rs1271604774 4626 dbSNP
rs1235042947 4630 dbSNP
rs1326914577 4633 dbSNP
rs1490286544 4642 dbSNP
rs55740775 4645 dbSNP
rs967421796 4646 dbSNP
rs1287491971 4655 dbSNP
rs1024427444 4656 dbSNP
rs1034466941 4657 dbSNP
rs1001911383 4658 dbSNP
rs992398886 4659 dbSNP
rs960597241 4660 dbSNP
rs963414475 4662 dbSNP
rs1433197862 4663 dbSNP
rs1336601484 4670 dbSNP
rs185982649 4679 dbSNP
rs1385199444 4684 dbSNP
rs1393813551 4692 dbSNP
rs1165674944 4694 dbSNP
rs1463480372 4695 dbSNP
rs1317735836 4696 dbSNP
rs1002049914 4699 dbSNP
rs1410348561 4700 dbSNP
rs1470304851 4700 dbSNP
rs1432165632 4701 dbSNP
rs1158378560 4704 dbSNP
rs898437401 4705 dbSNP
rs1174885243 4707 dbSNP
rs1480341002 4709 dbSNP
rs1470706352 4712 dbSNP
rs1420630102 4714 dbSNP
rs1234298204 4717 dbSNP
rs1196295816 4720 dbSNP
rs575958057 4724 dbSNP
rs1004749486 4725 dbSNP
rs1484697420 4726 dbSNP
rs1016519896 4727 dbSNP
rs1214938630 4728 dbSNP
rs1003866779 4743 dbSNP
rs1462261325 4750 dbSNP
rs1051531543 4757 dbSNP
rs557701148 4758 dbSNP
rs1318464137 4759 dbSNP
rs1297492155 4765 dbSNP
rs886853985 4766 dbSNP
rs546580031 4772 dbSNP
rs1269820824 4778 dbSNP
rs997390032 4790 dbSNP
rs12023469 4791 dbSNP
rs886045166 4798 dbSNP
rs1469767148 4799 dbSNP
rs1038802056