miRTarBase - #MIRT549389 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AMOT   
Synonyms -
Description angiomotin
Transcript NM_001113490   
Other Transcripts NM_133265   
Expression
Putative miRNA Targets on AMOT
3'UTR of AMOT
(miRNA target sites are highlighted)
>AMOT|NM_001113490|3'UTR
   1 ACGGCCAAATCAAGAGCTGCAGATTATCAGCAAAAATGCTTTTAATCATTTTCCCCCTTTTATTGGTTCTTGTTTTGAGG
  81 GTGAGGACAAGGGTTGTGGGGAGGGGATGTTTTTTAACAGGACTTTTTATTGGAACAATGTACTACTTGAGTAATACCAT
 161 GTGAACACCAGTCTATTTTGGTATGCTTAGGGAGTACCTCTAAAGACAGATTAATCAGAATGTGCTCTAAAGCTTATTGT
 241 TTGAATTTATACGAATACTGGGACTGTTAACAGGTGGCTATACATCGACGTTTTCAATGTGCTTAAATTTGTTTAAATTT
 321 TCCATATTCTAGATCATTTTTTATTGAAGAGCACAGTATGTGTGGAAGACAGTGTATAACACGTAGTTTGGAAGTGGGAA
 401 GCTAGAGAGAATTGAGTGTGTGCTGTTTTGTATAGTTACTATCCTGTGCAGCAGCTGGAGAAAGCACTCACCTCAGGCTT
 481 ACAAAAGGGAATAGTTTCAGGAGCTATGTAAGCTGGAAAAAAGGTAGGGAGTTTTGGGGTGCAGAAGGGTACTGGAGCTA
 561 ATTTTTTCTTCCAGTTTCCCAGCTACCCTGCCCCAGGGAATTGTGTTTGTCTTCATTTCAGTGGTGCTTTGGAAATGGAT
 641 TCTTTTGGTTCCCTCCTGGAGGTTCATACATTCATATATATGCTCTGGAGTAATTTATGCATTTGGATAATTAATATATT
 721 GCTTTCAGATGCTGGGAGAGTACATTAACTGAGTGATGCGCAACTTCCTCTCTCTTAGGGAATTAGACCATCAGAGGCCT
 801 TGATGGAGAGTTGCATGGGGTGCTATATGCAGACTTCCATGGTTTGTGTGTAGCCATGAACACAGCTTGCTTGCATTTAG
 881 TAAGACCAATCAGCTTAGTGTTTATTTCTTCTACAGCACAGATTCACTGGCTGGGTCTCCAGTCTCAAATTGCCAATCAT
 961 TTGCAAAGTGAGGAAGGATCTTTGTTGACAGGTTGAATGCTTTGAATTTCTGGTGACTACTTTGAAATAACTTGTTTTGT
1041 TTGTCAAATTCTAAGCATATGTCTTAAAAGGCATTTTTGACTATCACCTCCAAGGGAATAGCTTGAGAAACCCAAAGTAC
1121 TATGCTGCAGTCGGGGGAGAGGTGGATTGCAGCAGTATCCTCAACTACCTCTTCTCACTGTCAGTGACACCATCTTGGAA
1201 TACCTTTGGGAAGCAGCAGGAAATGTGCATGTGGGTAGAGATCAAAGGAGGCAATGGCTCCAAGCCTTGCCATAGGGCTG
1281 CCTCCAAGGACACAGAAGGATGCCAGTTGCCACAGGTCCCTGCCCTGTGTCACCTGTCTGCCCTTCATTAAGGTGAGAAA
1361 TCTGCAGATAGCATCATTAAGATCAGTTTTAAGGGGTATAGGGAGGGTGAGGGAAGTGGGGGGTGTTAGGTAAGGGTTGG
1441 GGGTAGAGGTTTTGGGATGTCTTAGTTAGAAACCAGATTAATAGAAGAGTAGGCCTGATATATTACATCATGAGCCATAG
1521 TGGTGGGAAAGAACTTTAGCAATATAGCCCTACCTCCTCATTTTAGTGATGAGGAATCTGAGAACTGGAGAGGTTCAGTG
1601 ACTTTTTGAAAGTCATACAACACAGCTAACCATTATGCCAATCACCATGCTTATTTTGGGAAACTCTTTATCTTTTTTAA
1681 ATTCCATTTTATGAAAAGGCATCTTCATGGTCCAGGGAATATGTATCTTGTAAAATGTACCTGGTTGGAGTAGCTTGTCC
1761 AGTCTTGACAAACTACTGAATTTCTGTCTTGCCTCTCCTTCAGTGCCTTTTAAAAGGTTTTCCCTTTTCTGATCTGCATT
1841 TCAACATAGAGTCACATAAATGTCCCCCTGAGAAACCAATCCCACTTCTTTCTAGGAGATTGGGTATCTTAGATAATCTT
1921 TTGGGGTTCCTCTGTGAGTATAGGAATGGTATCCTTCCTAATTATCTTCCAAAGGAATTATTTTGTGTGTGTGCCTGTGT
2001 GTGTGTAGAGACATAAAGGAGGGTGATGTGATTTTCAGCTAGTCCTTTCACATTTTCAATAATGAGGTAATCATGTTACA
2081 TACACATTAGTCCTCAGTTATAAAGTGAATCTCAGATAGAAATTAAAAGTGCAGTTGTGTTAAGACTCTTTCATACTACC
2161 CTTTAGTCATAAGGAGAAAAAAACACTCAAATAGTAGAAGCAGCAAGTAGCAAACTTCAGGAGAGCTACTTTCTATCCAA
2241 ATAATTTAAAAAACACTTTTCACCTACTCCTTTCATGGTTATAACACATTGGCAGACTTTTTGCTGGCTCTGGGAGCCAT
2321 GATTTTAATCACATTCTGCAAGGTGACAAATGTCATACATTCCACATTGTGTGGTAGCCATCTCTTTAGACTCATGTGTT
2401 TTGGGGAAAGGAAGAAGTTCTTGGCTGAGTACTATTTTGAACTTTCCAGAACCCTCTCACACCAGAGACAGTTCTTCTCT
2481 GTTCAGTTTCCAATCCCCGATAATTTGCTAAAATAACATTGTACATCCAAGAGAGGGAAGAAGAGTATGTCAGTATATTA
2561 TGCAGAAGATAGATACAGCCTTTTCAGAAGATCTCCACTAGTTTTTGTTCCAAAAATTCAAGTTTATGGGAGAAATCTCA
2641 ATTAGCCACCTTTTCACAGTTGTGTGGATATAACATTTGGGGGATCTTTCTGGACTCCTACCTATCTGTGCATTTTACCG
2721 GCACCTCAGGAAAGGAGGGTGACCAGGTTGTCTTAGCTTGTACTGCTTGGTGATCTCTGAGGACCTTCTAATTCAGTTGT
2801 ACCCCAGTGTTCCATGTATAGAAAAACTTCATTAGAACAAACTTTACTTGATATGAAACTCCTATTAACAGTCTTTTTTT
2881 GAAATAAAAAGTAGCTTGAGCTTTCTTTTAAAATCATGTATCTTGATTGTTGATTTAATGAAGGATTTCCTTTTAATGCT
2961 GCTTTTGAGCTTCAAGGTAATAGGACAGCAGGAACCTAAAATATCTGCCATCATCTGCCATAGGAAAGATACCCAGAGAC
3041 CCATCATGTTCTCTTTTTGTTGTTACACTGTTGGGTGGGTATAACAATTGGAAAATGAACAAACTGATTGATTGTGCAAA
3121 CTACTTTTTATGACAAGCCTAAACCCTCATAATGCGGCAGCTTAAAGTGTATACATATGCACTAACTTTGATCAATTATA
3201 TTCTCATATCTGTTAGCTACACAGTCTCCTATTATCTCAATTGCTTATGTGCATATGGAATATGTTACTTAAAACGTGTG
3281 CATTCTTACTGAAAATGTTTTCAAAGGAAGGTATCAGCTGTGGGCTAATTGCCACCAATTTCAGCCTGCCACGATTCTTG
3361 GAAATATGTCTTCCAAGTGCCATCCATCATCAGTAGGACAAGTGTCGGGAGTTTGTTTATTTTTTTCCAGTAGCAACGAT
3441 GGGTTACATGGAGCCATGAAACCTCCTTCTGGCCTCCCTTGTGATTAATGGCATGTGTTTGTAAAATGGATAGCTGGGGT
3521 TGGCAGATGGCTAGAGAAGAATCGCCTTTGGTTTAAAATGTATGTGGTCCCCTAATGATTGTGACCCCATTCTGTAATCA
3601 ACTGAGCTAGTTCCAATAAAGTTAAGCAGGTTTAAATCCACTTTGTGCCTATCTTTTCACTGACAATAAAGTTAGCTATT
3681 TTAAAATGCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || ||   ||||||| 
Target 5' ggatttCCTTTTAATGCTGCTt 3'
2943 - 2964 148.00 -10.50
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             || : | |:|||||||:| 
Target 5' gagAATTGAGTGTGTGCTGTTt 3'
407 - 428 147.00 -14.20
3
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            |||| :| ||  ||||||  
Target 5' ccCAAAGTACTA--TGCTGCag 3'
1111 - 1130 140.00 -8.30
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs747101663 2 dbSNP
rs751054633 10 dbSNP
rs778396438 10 dbSNP
rs758948283 13 dbSNP
rs748613153 39 dbSNP
rs146349101 47 dbSNP
rs1189780339 51 dbSNP
rs193083957 53 dbSNP
rs755961240 56 dbSNP
rs1264300769 77 dbSNP
rs1429549327 80 dbSNP
rs142375328 81 dbSNP
rs1421085126 92 dbSNP
rs953310149 100 dbSNP
rs1165053117 103 dbSNP
rs1301092747 110 dbSNP
rs200904208 116 dbSNP
rs1385401724 133 dbSNP
rs1027446850 138 dbSNP
rs1277787056 139 dbSNP
rs1389954437 142 dbSNP
rs2286064 146 dbSNP
rs1293995234 159 dbSNP
rs745557438 165 dbSNP
rs753427733 168 dbSNP
rs1219997635 180 dbSNP
rs961968016 189 dbSNP
rs1486384971 197 dbSNP
rs780868899 205 dbSNP
rs1260539883 207 dbSNP
rs1475997181 220 dbSNP
rs1014358283 223 dbSNP
rs1425182691 224 dbSNP
rs1416533885 227 dbSNP
rs879135565 252 dbSNP
rs150175550 253 dbSNP
rs140812417 258 dbSNP
rs1345769868 259 dbSNP
rs1452729023 262 dbSNP
rs1296132421 268 dbSNP
rs923782292 277 dbSNP
rs1416859147 279 dbSNP
rs1313788387 286 dbSNP
rs749987259 289 dbSNP
rs1378513181 290 dbSNP
rs1180715587 297 dbSNP
rs1486168563 301 dbSNP
rs1226729575 308 dbSNP
rs1043543059 311 dbSNP
rs1249774787 324 dbSNP
rs12689074 329 dbSNP
rs201959607 332 dbSNP
rs1486411579 333 dbSNP
rs1211157100 362 dbSNP
rs1206713444 374 dbSNP
rs1256443304 380 dbSNP
rs947460358 382 dbSNP
rs767038577 383 dbSNP
rs761681885 391 dbSNP
rs150989995 395 dbSNP
rs1001311478 396 dbSNP
rs1156537012 398 dbSNP
rs905321205 400 dbSNP
rs1043926968 401 dbSNP
rs1222589554 406 dbSNP
rs946944799 415 dbSNP
rs953403331 418 dbSNP
rs1299991768 419 dbSNP
rs1374616069 420 dbSNP
rs1446703767 438 dbSNP
rs1052417539 441 dbSNP
rs944675059 452 dbSNP
rs1227770787 455 dbSNP
rs1277445538 458 dbSNP
rs923262306 465 dbSNP
rs777203020 471 dbSNP
rs986580459 498 dbSNP
rs2286065 499 dbSNP
rs1433511498 500 dbSNP
rs1176699246 504 dbSNP
rs1254860200 506 dbSNP
rs1388452072 507 dbSNP
rs762867952 508 dbSNP
rs188082902 512 dbSNP
rs1454533978 531 dbSNP
rs1294418389 533 dbSNP
rs866986237 534 dbSNP
rs1325223054 557 dbSNP
rs1459134702 569 dbSNP
rs771227301 573 dbSNP
rs932092543 580 dbSNP
rs1298319116 588 dbSNP
rs764466779 589 dbSNP
rs1355172015 593 dbSNP
rs1465226881 596 dbSNP
rs1329865671 626 dbSNP
rs1015512206 627 dbSNP
rs1006357248 639 dbSNP
rs1442031915 642 dbSNP
rs973247875 655 dbSNP
rs1364984398 667 dbSNP
rs952305841 676 dbSNP
rs1186664527 677 dbSNP
rs1448721872 683 dbSNP
rs1023422264 684 dbSNP
rs34096563 689 dbSNP
rs1383235199 690 dbSNP
rs1316715393 691 dbSNP
rs1267803687 695 dbSNP
rs1211360572 700 dbSNP
rs1196264218 707 dbSNP
rs1274920008 729 dbSNP
rs961914613 732 dbSNP
rs1011983731 750 dbSNP
rs146707718 759 dbSNP
rs1476302683 760 dbSNP
rs1221080475 764 dbSNP
rs1424653037 765 dbSNP
rs879130957 770 dbSNP
rs1343035392 776 dbSNP
rs1168645419 788 dbSNP
rs753195559 805 dbSNP
rs35403786 807 dbSNP
rs765645277 815 dbSNP
rs999462110 825 dbSNP
rs371541873 830 dbSNP
rs1388851366 832 dbSNP
rs771261303 832 dbSNP
rs759920502 839 dbSNP
rs1339470556 844 dbSNP
rs1216207304 856 dbSNP
rs904308064 887 dbSNP
rs1335329826 900 dbSNP
rs1209150337 918 dbSNP
rs1022470520 925 dbSNP
rs1043957610 927 dbSNP
rs1011102575 930 dbSNP
rs1264106193 940 dbSNP
rs1488101762 953 dbSNP
rs58423409 957 dbSNP
rs1292639934 962 dbSNP
rs1429990396 974 dbSNP
rs754046013 978 dbSNP
rs143163733 982 dbSNP
rs957048004 999 dbSNP
rs1166109254 1013 dbSNP
rs772288812 1021 dbSNP
rs1378091887 1034 dbSNP
rs1200874408 1039 dbSNP
rs1319426298 1040 dbSNP
rs911028526 1051 dbSNP
rs139828538 1052 dbSNP
rs1314389660 1056 dbSNP
rs1355533805 1068 dbSNP
rs1431277323 1083 dbSNP
rs766655161 1085 dbSNP
rs1243481226 1090 dbSNP
rs583430 1103 dbSNP
rs755283633 1122 dbSNP
rs976018020 1132 dbSNP
rs150067152 1133 dbSNP
rs1259925327 1136 dbSNP
rs908154250 1152 dbSNP
rs985446526 1156 dbSNP
rs1186961002 1169 dbSNP
rs1236191239 1176 dbSNP
rs1471444771 1179 dbSNP
rs879202630 1187 dbSNP
rs1159567566 1188 dbSNP
rs1380062100 1200 dbSNP
rs779539332 1215 dbSNP
rs1024208513 1220 dbSNP
rs1342117038 1234 dbSNP
rs773430721 1244 dbSNP
rs1394893905 1250 dbSNP
rs1331660020 1257 dbSNP
rs375032444 1262 dbSNP
rs1236047380 1265 dbSNP
rs1308534454 1276 dbSNP
rs960419122 1290 dbSNP
rs1310876339 1295 dbSNP
rs1236286346 1306 dbSNP
rs1034687720 1321 dbSNP
rs139333565 1322 dbSNP
rs1199876737 1328 dbSNP
rs1276605721 1329 dbSNP
rs1439690628 1336 dbSNP
rs1179808519 1346 dbSNP
rs750057763 1380 dbSNP
rs1438195476 1385 dbSNP
rs902168601 1395 dbSNP
rs766948764 1397 dbSNP
rs1043672883 1405 dbSNP
rs2286066 1409 dbSNP
rs1170511031 1418 dbSNP
rs751485899 1421 dbSNP
rs889640235 1435 dbSNP
rs1330571611 1447 dbSNP
rs1037482238 1462 dbSNP
rs1442780558 1468 dbSNP
rs1301725120 1475 dbSNP
rs1331841231 1476 dbSNP
rs1408730251 1495 dbSNP
rs1049527278 1497 dbSNP
rs1174303669 1501 dbSNP
rs932072383 1510 dbSNP
rs901904026 1515 dbSNP
rs767524691 1523 dbSNP
rs1199401952 1534 dbSNP
rs907734721 1541 dbSNP
rs1456846422 1549 dbSNP
rs1215866981 1598 dbSNP
rs1268507251 1599 dbSNP
rs1040430404 1617 dbSNP
rs940742668 1624 dbSNP
rs907846843 1641 dbSNP
rs1433040897 1646 dbSNP
rs2269959 1647 dbSNP
rs1376861827 1670 dbSNP
rs930859366 1674 dbSNP
rs775318826 1679 dbSNP
rs116366680 1699 dbSNP
rs959994131 1700 dbSNP
rs1462960498 1701 dbSNP
rs926944646 1714 dbSNP
rs763044039 1719 dbSNP
rs960451955 1722 dbSNP
rs775548712 1723 dbSNP
rs1342632334 1726 dbSNP
rs1021414357 1736 dbSNP
rs1180253816 1762 dbSNP
rs1219282568 1767 dbSNP
rs2269960 1776 dbSNP
rs1256944429 1781 dbSNP
rs745710827 1784 dbSNP
rs1022351126 1790 dbSNP
rs1235679103 1798 dbSNP
rs1266591778 1800 dbSNP
rs1488348199 1802 dbSNP
rs1010007511 1810 dbSNP
rs1263357524 1816 dbSNP
rs1010842008 1830 dbSNP
rs889662300 1852 dbSNP
rs1028122317 1856 dbSNP
rs1262932818 1861 dbSNP
rs998011441 1862 dbSNP
rs1475940628 1865 dbSNP
rs901012305 1869 dbSNP
rs1165356866 1880 dbSNP
rs773569511 1884 dbSNP
rs1456152106 1900 dbSNP
rs1331626855 1902 dbSNP
rs1362617656 1903 dbSNP
rs764123035 1911 dbSNP
rs1286123530 1920 dbSNP
rs1400851366 1921 dbSNP
rs1031176107 1923 dbSNP
rs940756228 1938 dbSNP
rs772270373 1946 dbSNP
rs780804976 1969 dbSNP
rs1227383179 1970 dbSNP
rs1009554541 1972 dbSNP
rs1340623925 1975 dbSNP
rs1335541580 1976 dbSNP
rs1321680919 1985 dbSNP
rs369142467 1993 dbSNP
rs1288622958 1994 dbSNP
rs1401350086 1994 dbSNP
rs886453765 1995 dbSNP
rs1215438420 1997 dbSNP
rs1458657373 2001 dbSNP
rs1469382948 2007 dbSNP
rs1157294830 2009 dbSNP
rs1486353383 2009 dbSNP
rs770634572 2015 dbSNP
rs1050837759 2023 dbSNP
rs1421988985 2028 dbSNP
rs1049506332 2042 dbSNP
rs1380663964 2047 dbSNP
rs774976132 2048 dbSNP
rs996159725 2059 dbSNP
rs1422611229 2075 dbSNP
rs1243109697 2080 dbSNP
rs1450253050 2083 dbSNP
rs182106161 2085 dbSNP
rs916799747 2087 dbSNP
rs1394787244 2089 dbSNP
rs746592749 2102 dbSNP
rs1209881131 2107 dbSNP
rs899183494 2125 dbSNP
rs1378069073 2129 dbSNP
rs991061459 2146 dbSNP
rs1239941543 2152 dbSNP
rs189878838 2159 dbSNP
rs928105355 2160 dbSNP
rs185564284 2161 dbSNP
rs1210123937 2166 dbSNP
rs1254913515 2175 dbSNP
rs756441607 2177 dbSNP
rs940784278 2184 dbSNP
rs1482019970 2190 dbSNP
rs183091832 2196 dbSNP
rs907680701 2206 dbSNP
rs1438803295 2210 dbSNP
rs377187260 2213 dbSNP
rs966838828 2216 dbSNP
rs1176580439 2221 dbSNP
rs1021964970 2235 dbSNP
rs780881608 2239 dbSNP
rs1416396387 2246 dbSNP
rs1057000128 2248 dbSNP
rs1358649557 2275 dbSNP
rs989519166 2277 dbSNP
rs927257781 2288 dbSNP
rs1285497231 2303 dbSNP
rs1378318402 2308 dbSNP
rs1446455650 2317 dbSNP
rs1241944827 2334 dbSNP
rs980163844 2349 dbSNP
rs968344930 2360 dbSNP
rs1381349117 2361 dbSNP
rs41310719 2382 dbSNP
rs988524814 2385 dbSNP
rs1200011980 2396 dbSNP
rs1258594931 2403 dbSNP
rs1028236816 2439 dbSNP
rs998042462 2441 dbSNP
rs901040154 2445 dbSNP
rs1015351066 2451 dbSNP
rs1248228570 2452 dbSNP
rs1031582428 2462 dbSNP
rs1004984195 2464 dbSNP
rs1319632693 2467 dbSNP
rs138308883 2474 dbSNP
rs1009089047 2479 dbSNP
rs1172945787 2490 dbSNP
rs1165183465 2497 dbSNP
rs1049066603 2499 dbSNP
rs753248969 2516 dbSNP
rs1471865240 2518 dbSNP
rs763546169 2519 dbSNP
rs895144156 2521 dbSNP
rs955113638 2521 dbSNP
rs1384627106 2524 dbSNP
rs1029215521 2544 dbSNP
rs1292535437 2546 dbSNP
rs1189781029 2547 dbSNP
rs1055407988 2555 dbSNP
rs1365092229 2574 dbSNP
rs369130967 2576 dbSNP
rs1219868052 2583 dbSNP
rs779360256 2594 dbSNP
rs996405315 2607 dbSNP
rs549116776 2610 dbSNP
rs35606486 2612 dbSNP
rs1291992814 2616 dbSNP
rs1451946190 2619 dbSNP
rs1246636516 2622 dbSNP
rs1016228322 2626 dbSNP
rs1246301983 2628 dbSNP
rs1489922310 2641 dbSNP
rs1195858820 2645 dbSNP
rs1424405794 2656 dbSNP
rs1477573581 2657 dbSNP
rs758309366 2667 dbSNP
rs1042912242 2679 dbSNP
rs35667754 2691 dbSNP
rs945154455 2697 dbSNP
rs1416621411 2708 dbSNP
rs886565340 2708 dbSNP
rs1164530457 2710 dbSNP
rs1347699597 2717 dbSNP
rs915011511 2718 dbSNP
rs752587391 2719 dbSNP
rs1291617289 2720 dbSNP
rs1057350851 2729 dbSNP
rs989245066 2741 dbSNP
rs1207645308 2747 dbSNP
rs1358120021 2749 dbSNP
rs953739255 2750 dbSNP
rs1357001941 2751 dbSNP
rs765013865 2752 dbSNP
rs755398190 2766 dbSNP
rs976649097 2771 dbSNP
rs1219063613 2788 dbSNP
rs1362922165 2788 dbSNP
rs947294686 2794 dbSNP
rs965241646 2800 dbSNP
rs1191162545 2801 dbSNP
rs1269423676 2803 dbSNP
rs754251717 2814 dbSNP
rs1239659996 2815 dbSNP
rs1436973617 2837 dbSNP
rs1015428266 2840 dbSNP
rs1332559459 2841 dbSNP
rs1004417644 2842 dbSNP
rs988514948 2865 dbSNP
rs1325791721 2881 dbSNP
rs143172417 2889 dbSNP
rs1365110058 2892 dbSNP
rs750656990 2894 dbSNP
rs191533590 2895 dbSNP
rs766595376 2898 dbSNP
rs1447181720 2910 dbSNP
rs986965906 2949 dbSNP
rs1378792659 2960 dbSNP
rs761024403 2964 dbSNP
rs1286964365 2990 dbSNP
rs1388821647 2994 dbSNP
rs1167802917 3000 dbSNP
rs761953089 3018 dbSNP
rs1353268856 3019 dbSNP
rs1248758831 3023 dbSNP
rs1280815374 3032 dbSNP
rs1443144398 3033 dbSNP
rs774530470 3035 dbSNP
rs1196307456 3040 dbSNP
rs954875173 3045 dbSNP
rs1029580175 3051 dbSNP
rs1179690380 3052 dbSNP
rs974933666 3053 dbSNP
rs1206647059 3063 dbSNP
rs895162117 3075 dbSNP
rs1339401226 3078 dbSNP
rs1055107599 3079 dbSNP
rs1016218476 3085 dbSNP
rs1413447860 3106 dbSNP
rs1004863931 3107 dbSNP
rs768639162 3116 dbSNP
rs1272853446 3127 dbSNP
rs1308280433 3145 dbSNP
rs1403398815 3147 dbSNP
rs906749469 3155 dbSNP
rs905660756 3156 dbSNP
rs750661293 3157 dbSNP
rs1199967118 3169 dbSNP
rs763451545 3176 dbSNP
rs1459483726 3177 dbSNP
rs1199600072 3184 dbSNP
rs945577748 3186 dbSNP
rs1237940852 3187 dbSNP
rs1200506756 3190 dbSNP
rs893080288 3190 dbSNP
rs1377890160 3206 dbSNP
rs1477379122 3218 dbSNP
rs1173644361 3219 dbSNP
rs915395881 3233 dbSNP
rs186677421 3249 dbSNP
rs1330676861 3264 dbSNP
rs932373075 3275 dbSNP
rs1325723006 3276 dbSNP
rs770181006 3279 dbSNP
rs934313653 3291 dbSNP
rs912231630 3311 dbSNP
rs986529986 3318 dbSNP
rs1461494571 3324 dbSNP
rs1427774185 3325 dbSNP
rs1219778831 3331 dbSNP
rs920946172 3348 dbSNP
rs1479848233 3353 dbSNP
rs976346406 3367 dbSNP
rs965271388 3369 dbSNP
rs932402006 3379 dbSNP
rs908488831 3384 dbSNP
rs1196917011 3388 dbSNP
rs528964890 3392 dbSNP
rs952675265 3394 dbSNP
rs780795717 3398 dbSNP
rs1481796345 3411 dbSNP
rs1016500273 3414 dbSNP
rs113037861 3419 dbSNP
rs866301080 3419 dbSNP
rs1391648850 3437 dbSNP
rs1210818414 3438 dbSNP
rs1301595144 3438 dbSNP
rs1444053755 3444 dbSNP
rs1342417213 3448 dbSNP
rs1400738812 3452 dbSNP
rs34762992 3452 dbSNP
rs1295426867 3463 dbSNP
rs973503062 3465 dbSNP
rs983683002 3468 dbSNP
rs950724964 3481 dbSNP
rs746688670 3482 dbSNP
rs1356175550 3483 dbSNP
rs1222640812 3491 dbSNP
rs1329552571 3492 dbSNP
rs959405212 3517 dbSNP
rs1033689764 3518 dbSNP
rs1192341691 3535 dbSNP
rs1259495737 3543 dbSNP
rs878931531 3547 dbSNP
rs1425498061 3567 dbSNP
rs1036107823 3576 dbSNP
rs1422558788 3578 dbSNP
rs1161874511 3590 dbSNP
rs182133752 3596 dbSNP
rs1362712423 3601 dbSNP
rs1002950009 3606 dbSNP
rs1003579796 3616 dbSNP
rs1230399307 3618 dbSNP
rs906531498 3640 dbSNP
rs1360030663 3641 dbSNP
rs1195618227 3649 dbSNP
rs1021650845 3651 dbSNP
rs1382476965 3664 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || ||   ||||||| 
Target 5' --auuuCCUUUUAAUGCUGCUu 3'
1 - 20
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000304758.1 | 3UTR | AUUUCCUUUUAAUGCUGCUUUUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000304758.1 | 3UTR | AUUUCCUUUUAAUGCUGCUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.528 4.8e-3 -0.430 2.0e-2 23 Click to see details
GSE21032 Prostate cancer 0.275 5.9e-3 0.285 4.5e-3 83 Click to see details
GSE17498 Multiple myeloma 0.254 5.7e-2 0.212 9.5e-2 40 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.308 6.7e-2 0.195 1.8e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.174 8.5e-2 0.207 5.0e-2 64 Click to see details
GSE19783 ER- ER- breast cancer 0.155 8.6e-2 0.147 9.8e-2 79 Click to see details
GSE38226 Liver fibrosis -0.294 9.8e-2 -0.149 2.6e-1 21 Click to see details
GSE19536 Breast cancer 0.13 9.9e-2 0.121 1.2e-1 100 Click to see details
GSE21849 B cell lymphoma -0.195 1.6e-1 0.379 2.1e-2 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.234 1.6e-1 0.271 1.2e-1 20 Click to see details
GSE28544 Breast cancer -0.188 1.9e-1 -0.506 5.8e-3 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.159 2.3e-1 0.138 2.6e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.197 2.7e-1 0.007 4.9e-1 12 Click to see details
GSE27834 Pluripotent stem cells -0.144 3.0e-1 -0.129 3.2e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.108 3.3e-1 -0.050 4.2e-1 20 Click to see details
GSE17306 Multiple myeloma -0.056 3.5e-1 -0.005 4.9e-1 49 Click to see details
GSE28260 Renal cortex and medulla 0.107 3.6e-1 0.104 3.7e-1 13 Click to see details
GSE14794 Lymphoblastoid cells 0.023 4.1e-1 0.088 2.0e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.044 4.2e-1 -0.173 2.0e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.023 4.5e-1 0.104 2.9e-1 32 Click to see details
GSE32688 Pancreatic cancer -0.023 4.5e-1 0.104 2.9e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.24 0.06 -0.280 0.04 42 Click to see details
LIHC -0.194 0.09 -0.131 0.18 49 Click to see details
PRAD -0.157 0.14 -0.156 0.14 50 Click to see details
ESCA -0.323 0.17 0.091 0.4 11 Click to see details
STAD -0.174 0.17 -0.220 0.11 32 Click to see details
KIRP -0.153 0.2 -0.173 0.17 32 Click to see details
KIRC 0.102 0.2 0.150 0.11 68 Click to see details
CHOL -0.313 0.21 -0.133 0.37 9 Click to see details
BLCA -0.204 0.21 -0.216 0.19 18 Click to see details
THCA -0.101 0.22 -0.161 0.11 59 Click to see details
CESC 0.683 0.26 0.500 0.33 3 Click to see details
PAAD -0.38 0.31 -0.400 0.3 4 Click to see details
KICH 0.091 0.33 0.047 0.41 25 Click to see details
PCPG -0.332 0.39 -0.500 0.33 3 Click to see details
BRCA 0.029 0.4 0.074 0.25 84 Click to see details
LUSC 0.043 0.4 0.243 0.07 38 Click to see details
COAD 0.088 0.42 0.476 0.12 8 Click to see details
UCEC -0.018 0.47 0.049 0.42 19 Click to see details
LUAD -0.011 0.49 -0.014 0.48 12 Click to see details
LUAD -0.011 0.49 -0.014 0.48 12 Click to see details
LUAD -0.011 0.49 -0.014 0.48 12 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*