miRTarBase - #MIRT547702 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KPNA1   
Synonyms IPOA5, NPI-1, RCH2, SRP1
Description karyopherin subunit alpha 1
Transcript NM_002264   
Putative miRNA Targets on KPNA1
3'UTR of KPNA1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
miRNA  3' guguUUGGUAAU-------A-CACGACGAu 5'
              |||::|||       | |||||||| 
1938 - 1967 154.00 -12.40
miRNA  3' guguuuGGUAA-UACACGACGAu 5'
                :::|| ||||||||:| 
Target 5' atttttTTGTTGATGTGCTGTTc 3'
1491 - 1513 144.00 -12.00
                :|||| | ||:|||| 
Target 5' agtggtTCATT-TCTGTTGCTg 3'
792 - 812 139.00 -11.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN16132176 19 COSMIC
COSN31570588 48 COSMIC
COSN1083317 54 COSMIC
COSN30180242 56 COSMIC
COSN18717700 80 COSMIC
COSN30108456 85 COSMIC
COSN1083318 118 COSMIC
COSN30124581 136 COSMIC
COSN20074813 146 COSMIC
COSN30542525 221 COSMIC
COSN31596088 273 COSMIC
COSN31551056 302 COSMIC
COSN1083319 423 COSMIC
COSN9234415 428 COSMIC
COSN7815033 453 COSMIC
COSN28636719 689 COSMIC
COSN28759156 691 COSMIC
COSN31570150 751 COSMIC
COSN14922987 955 COSMIC
COSN30109946 1034 COSMIC
COSN7815032 1379 COSMIC
COSN5519271 1396 COSMIC
COSN31489173 1422 COSMIC
COSN31534513 1794 COSMIC
COSN31546587 1812 COSMIC
COSN31575888 1855 COSMIC
COSN25748340 1880 COSMIC
COSN1911415 1882 COSMIC
COSN6747987 1970 COSMIC
COSN7619982 2035 COSMIC
COSN26558205 2041 COSMIC
COSN16990968 2098 COSMIC
COSN20090884 2264 COSMIC
COSN30174285 2292 COSMIC
COSN31576018 2412 COSMIC
COSN30174926 2460 COSMIC
COSN32064420 2531 COSMIC
COSN28686908 3281 COSMIC
COSN31547394 3293 COSMIC
COSN23327191 3358 COSMIC
COSN28739212 3385 COSMIC
COSN30538721 3597 COSMIC
COSN22772906 4001 COSMIC
COSN20098959 4619 COSMIC
COSN25208613 4654 COSMIC
COSN16420354 4829 COSMIC
COSN4912544 4864 COSMIC
rs3762637 508 GWAS
rs16833132 3168 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs758401352 5 dbSNP
rs1384106328 11 dbSNP
rs752861909 15 dbSNP
rs765354666 18 dbSNP
rs759822428 19 dbSNP
rs368341068 20 dbSNP
rs4677950 22 dbSNP
rs1388393540 23 dbSNP
rs774261626 24 dbSNP
rs1303941356 25 dbSNP
rs768710154 25 dbSNP
rs1439877650 26 dbSNP
rs1386974190 31 dbSNP
rs762342906 35 dbSNP
rs368205703 36 dbSNP
rs769282869 37 dbSNP
rs773782135 45 dbSNP
rs745549838 46 dbSNP
rs926394854 48 dbSNP
rs980426413 49 dbSNP
rs1361012656 51 dbSNP
rs967746673 53 dbSNP
rs1021973965 59 dbSNP
rs1475439404 67 dbSNP
rs1367434027 71 dbSNP
rs1452756044 72 dbSNP
rs1009790038 73 dbSNP
rs765364685 82 dbSNP
rs1004576222 85 dbSNP
rs1360126807 93 dbSNP
rs557103643 96 dbSNP
rs144038415 97 dbSNP
rs1446085596 104 dbSNP
rs62271977 106 dbSNP
rs1306213144 112 dbSNP
rs149498825 115 dbSNP
rs1313208748 116 dbSNP
rs1019091675 117 dbSNP
rs139115078 118 dbSNP
rs1486636456 119 dbSNP
rs1029973640 124 dbSNP
rs187728601 127 dbSNP
rs183787207 135 dbSNP
rs1009501844 136 dbSNP
rs1197763674 137 dbSNP
rs776922157 137 dbSNP
rs1425746229 140 dbSNP
rs1156651167 146 dbSNP
rs1418351390 146 dbSNP
rs889190688 154 dbSNP
rs1459022994 169 dbSNP
rs1050502748 171 dbSNP
rs1281243452 172 dbSNP
rs1043664293 173 dbSNP
rs1295847775 181 dbSNP
rs994792834 191 dbSNP
rs899131318 192 dbSNP
rs1036327556 200 dbSNP
rs1319036458 201 dbSNP
rs1011783603 211 dbSNP
rs374775950 215 dbSNP
rs548999741 217 dbSNP
rs1385283004 226 dbSNP
rs938728385 229 dbSNP
rs555541809 230 dbSNP
rs760549737 231 dbSNP
rs1056287600 233 dbSNP
rs928679167 233 dbSNP
rs529182443 234 dbSNP
rs939216335 235 dbSNP
rs1417382167 243 dbSNP
rs1460007333 258 dbSNP
rs191415413 261 dbSNP
rs549970044 265 dbSNP
rs980478739 268 dbSNP
rs948695050 276 dbSNP
rs1352741065 279 dbSNP
rs967800669 280 dbSNP
rs746671441 290 dbSNP
rs750297843 296 dbSNP
rs533171268 310 dbSNP
rs1331434999 318 dbSNP
rs987826646 320 dbSNP
rs565334125 321 dbSNP
rs1161148480 322 dbSNP
rs1202380450 322 dbSNP
rs775374901 328 dbSNP
rs771969618 329 dbSNP
rs1186955141 332 dbSNP
rs907696865 336 dbSNP
rs1385467741 338 dbSNP
rs1177665884 339 dbSNP
rs1437564164 340 dbSNP
rs745868904 341 dbSNP
rs983225576 346 dbSNP
rs1414665170 351 dbSNP
rs1409404353 353 dbSNP
rs1169017315 358 dbSNP
rs1372941831 361 dbSNP
rs17201246 362 dbSNP
rs1312667134 365 dbSNP
rs775634824 371 dbSNP
rs1029118520 375 dbSNP
rs1449811801 378 dbSNP
rs1284372419 379 dbSNP
rs1360719552 392 dbSNP
rs994847439 399 dbSNP
rs899268705 400 dbSNP
rs761763846 401 dbSNP
rs573328371 405 dbSNP
rs974439833 409 dbSNP
rs964731441 411 dbSNP
rs1210004359 413 dbSNP
rs559464390 415 dbSNP
rs1289173476 417 dbSNP
rs1014853941 418 dbSNP
rs1258134241 420 dbSNP
rs3834790 425 dbSNP
rs542633344 425 dbSNP
rs1173515157 426 dbSNP
rs1292738573 428 dbSNP
rs1374045780 432 dbSNP
rs1416496036 435 dbSNP
rs891990654 438 dbSNP
rs1344236340 443 dbSNP
rs573961161 458 dbSNP
rs1428115921 462 dbSNP
rs887023566 464 dbSNP
rs1299198175 465 dbSNP
rs1365208752 474 dbSNP
rs1371568728 483 dbSNP
rs1056824558 484 dbSNP
rs1031860517 488 dbSNP
rs1003011777 491 dbSNP
rs939286838 495 dbSNP
rs1446649028 497 dbSNP
rs1206987259 501 dbSNP
rs904993960 505 dbSNP
rs3762637 508 dbSNP
rs1450106981 515 dbSNP
rs537198465 519 dbSNP
rs1193609596 528 dbSNP
rs1393770833 531 dbSNP
rs946428315 533 dbSNP
rs915020042 540 dbSNP
rs1301906710 542 dbSNP
rs115319351 544 dbSNP
rs748680040 545 dbSNP
rs1398603219 557 dbSNP
rs150744217 565 dbSNP
rs1388760292 571 dbSNP
rs79273148 571 dbSNP
rs1398622189 572 dbSNP
rs1332744672 576 dbSNP
rs565798394 577 dbSNP
rs1158948538 578 dbSNP
rs548676421 588 dbSNP
rs187329016 592 dbSNP
rs1278744764 594 dbSNP
rs540784967 602 dbSNP
rs907770476 613 dbSNP
rs533162042 614 dbSNP
rs878867667 616 dbSNP
rs983254754 619 dbSNP
rs963417544 633 dbSNP
rs1201556495 637 dbSNP
rs1453850288 644 dbSNP
rs1014997613 647 dbSNP
rs1200121890 656 dbSNP
rs550105645 657 dbSNP
rs933113296 659 dbSNP
rs895766510 668 dbSNP
rs533314000 673 dbSNP
rs142712801 681 dbSNP
rs755677909 688 dbSNP
rs1003844148 694 dbSNP
rs747816031 695 dbSNP
rs1392175675 703 dbSNP
rs964439713 710 dbSNP
rs1044904397 713 dbSNP
rs1333809929 725 dbSNP
rs1286682053 726 dbSNP
rs946559246 730 dbSNP
rs893550557 734 dbSNP
rs3749210 735 dbSNP
rs528548197 736 dbSNP
rs1232843317 737 dbSNP
rs935097053 738 dbSNP
rs1281903025 742 dbSNP
rs145738937 750 dbSNP
rs956289543 751 dbSNP
rs1482302584 752 dbSNP
rs1031894755 767 dbSNP
rs1003045774 768 dbSNP
rs1252915313 768 dbSNP
rs987166847 769 dbSNP
rs1428149949 770 dbSNP
rs932212682 772 dbSNP
rs1346587009 773 dbSNP
rs564327383 782 dbSNP
rs1184907797 793 dbSNP
rs1369719977 796 dbSNP
rs1457945723 804 dbSNP
rs777679316 806 dbSNP
rs1159471345 817 dbSNP
rs376738350 825 dbSNP
rs544516098 840 dbSNP
rs542569565 841 dbSNP
rs963553377 848 dbSNP
rs1310790944 851 dbSNP
rs1342391969 856 dbSNP
rs908038654 861 dbSNP
rs1251308971 864 dbSNP
rs1480741170 865 dbSNP
rs983909227 866 dbSNP
rs1207830621 873 dbSNP
rs551192795 873 dbSNP
rs1185989644 877 dbSNP
rs1484972412 879 dbSNP
rs10045 880 dbSNP
rs1038789264 881 dbSNP
rs1387722163 887 dbSNP
rs1451263115 888 dbSNP
rs939989166 888 dbSNP
rs1461109151 889 dbSNP
rs1261693563 890 dbSNP
rs1225815126 892 dbSNP
rs765671673 895 dbSNP
rs183222537 900 dbSNP
rs933186715 903 dbSNP
rs578221333 904 dbSNP
rs1396737741 914 dbSNP
rs1294946736 921 dbSNP
rs1363069245 925 dbSNP
rs1231285466 930 dbSNP
rs1298961758 942 dbSNP
rs1363507477 947 dbSNP
rs969283740 951 dbSNP
rs16833133 959 dbSNP
rs1483379256 960 dbSNP
rs1204118906 966 dbSNP
rs1010740721 972 dbSNP
rs893602532 983 dbSNP
rs1052282436 993 dbSNP
rs1403583118 997 dbSNP
rs1394372249 999 dbSNP
rs541633843 1004 dbSNP
rs999652786 1006 dbSNP
rs1338462434 1011 dbSNP
rs1177954169 1018 dbSNP
rs1377930709 1035 dbSNP
rs1466771669 1036 dbSNP
rs1320082121 1042 dbSNP
rs1470177303 1043 dbSNP
rs76664127 1049 dbSNP
rs914300204 1061 dbSNP
rs989823524 1071 dbSNP
rs3833584 1073 dbSNP
rs924897152 1078 dbSNP
rs1051848193 1086 dbSNP
rs931677966 1087 dbSNP
rs971579542 1091 dbSNP
rs1444237707 1094 dbSNP
rs555510827 1112 dbSNP
rs377576741 1113 dbSNP
rs1487473456 1128 dbSNP
rs1037879514 1130 dbSNP
rs1013055211 1135 dbSNP
rs1267816213 1137 dbSNP
rs1418263942 1138 dbSNP
rs1158757169 1154 dbSNP
rs1241618243 1163 dbSNP
rs942296038 1167 dbSNP
rs1458936081 1171 dbSNP
rs1205957246 1186 dbSNP
rs1349302219 1189 dbSNP
rs1462099860 1193 dbSNP
rs963124851 1195 dbSNP
rs191710875 1203 dbSNP
rs983657857 1206 dbSNP
rs1004207000 1207 dbSNP
rs1330763483 1208 dbSNP
rs960384010 1215 dbSNP
rs764397766 1217 dbSNP
rs556236878 1218 dbSNP
rs1223738118 1220 dbSNP
rs1265924025 1223 dbSNP
rs1480223351 1230 dbSNP
rs997372373 1233 dbSNP
rs1473697303 1243 dbSNP
rs901737914 1251 dbSNP
rs980088170 1252 dbSNP
rs1403656982 1256 dbSNP
rs970083513 1259 dbSNP
rs1021636555 1266 dbSNP
rs1010793122 1267 dbSNP
rs1227319051 1268 dbSNP
rs1350975124 1281 dbSNP
rs1429584145 1281 dbSNP
rs957992699 1282 dbSNP
rs1031227365 1291 dbSNP
rs1380143413 1301 dbSNP
rs999389769 1302 dbSNP
rs1453056790 1303 dbSNP
rs539730150 1305 dbSNP
rs1399335073 1316 dbSNP
rs890188873 1337 dbSNP
rs1229530579 1342 dbSNP
rs760854513 1345 dbSNP
rs1313424290 1350 dbSNP
rs1341385161 1351 dbSNP
rs1463486876 1352 dbSNP
rs934349755 1373 dbSNP
rs1356281894 1376 dbSNP
rs148156094 1379 dbSNP
rs981080833 1381 dbSNP
rs1206201727 1383 dbSNP
rs781412002 1393 dbSNP
rs972068401 1395 dbSNP
rs995885902 1395 dbSNP
rs900144052 1396 dbSNP
rs868211932 1400 dbSNP
rs572817046 1406 dbSNP
rs942264980 1418 dbSNP
rs1333168382 1419 dbSNP
rs908144400 1420 dbSNP
rs916130483 1429 dbSNP
rs76736876 1432 dbSNP
rs938898978 1433 dbSNP
rs928706191 1440 dbSNP
rs1226115969 1444 dbSNP
rs1017006118 1445 dbSNP
rs1004238529 1447 dbSNP
rs1333578359 1449 dbSNP
rs767480492 1450 dbSNP
rs980145375 1451 dbSNP
rs1440925484 1458 dbSNP
rs998114325 1460 dbSNP
rs1238156894 1462 dbSNP
rs527488732 1469 dbSNP
rs188752470 1477 dbSNP
rs1175951303 1481 dbSNP
rs914549336 1483 dbSNP
rs990168305 1484 dbSNP
rs143786513 1485 dbSNP
rs1172374815 1492 dbSNP
rs1415849992 1499 dbSNP
rs1423415788 1499 dbSNP
rs72958406 1505 dbSNP
rs563325889 1506 dbSNP
rs1293463141 1518 dbSNP
rs1246286223 1528 dbSNP
rs148980889 1535 dbSNP
rs533432234 1542 dbSNP
rs1404533436 1544 dbSNP
rs1045432329 1549 dbSNP
rs755405524 1562 dbSNP
rs949705114 1568 dbSNP
rs748609931 1572 dbSNP
rs1328656649 1575 dbSNP
rs1393003470 1578 dbSNP
rs1206885997 1579 dbSNP
rs1249908571 1582 dbSNP
rs1373947408 1604 dbSNP
rs1448087531 1605 dbSNP
rs1198727834 1615 dbSNP
rs11540851 1617 dbSNP
rs796484174 1622 dbSNP
rs1245364831 1623 dbSNP
rs1404379801 1642 dbSNP
rs564818371 1646 dbSNP
rs772650200 1652 dbSNP
rs991746333 1652 dbSNP
rs941552281 1655 dbSNP
rs910037403 1656 dbSNP
rs1363847851 1657 dbSNP
rs1455242004 1657 dbSNP
rs1160762549 1659 dbSNP
rs1015863102 1663 dbSNP
rs1388647408 1672 dbSNP
rs1386173965 1675 dbSNP
rs1005869390 1676 dbSNP
rs1332648232 1681 dbSNP
rs1436923521 1682 dbSNP
rs769319332 1687 dbSNP
rs747818935 1699 dbSNP
rs1350111418 1711 dbSNP
rs1425570351 1712 dbSNP
rs1363516787 1714 dbSNP
rs886680556 1724 dbSNP
rs1270127696 1734 dbSNP
rs1351430208 1748 dbSNP
rs1157394260 1751 dbSNP
rs1288315311 1768 dbSNP
rs1453756293 1768 dbSNP
rs1421311959 1773 dbSNP
rs1251830171 1779 dbSNP
rs1199388585 1781 dbSNP
rs1471410637 1785 dbSNP
rs541226097 1786 dbSNP
rs1363903232 1787 dbSNP
rs780806186 1788 dbSNP
rs1161455041 1790 dbSNP
rs1489610256 1792 dbSNP
rs1405820521 1798 dbSNP
rs1307181676 1800 dbSNP
rs938937216 1814 dbSNP
rs538670914 1817 dbSNP
rs1029669184 1820 dbSNP
rs907336381 1824 dbSNP
rs572604410 1830 dbSNP
rs183293821 1838 dbSNP
rs746161104 1839 dbSNP
rs1258646623 1841 dbSNP
rs1359093195 1848 dbSNP
rs540422826 1850 dbSNP
rs190918915 1856 dbSNP
rs1282539353 1857 dbSNP
rs924608865 1858 dbSNP
rs1206916977 1866 dbSNP
rs978001109 1867 dbSNP
rs954799886 1869 dbSNP
rs1422787398 1871 dbSNP
rs1007463833 1875 dbSNP
rs893019306 1877 dbSNP
rs1030096784 1879 dbSNP
rs755027600 1880 dbSNP
rs964414431 1881 dbSNP
rs1431368007 1888 dbSNP
rs1015999400 1894 dbSNP
rs1397469913 1899 dbSNP
rs902936661 1900 dbSNP
rs1045503804 1907 dbSNP
rs11540850 1908 dbSNP
rs1287374451 1910 dbSNP
rs1006295504 1916 dbSNP
rs1455649795 1925 dbSNP
rs949786520 1930 dbSNP
rs886069348 1933 dbSNP
rs894126066 1940 dbSNP
rs1176285201 1948 dbSNP
rs369274648 1948 dbSNP
rs1479743283 1954 dbSNP
rs1430713928 1956 dbSNP
rs1461359598 1959 dbSNP
rs1187893447 1961 dbSNP
rs1199488634 1963 dbSNP
rs1026409695 1978 dbSNP
rs1376790144 1980 dbSNP
rs1445981621 1985 dbSNP
rs1170991119 1995 dbSNP
rs1408458677 1999 dbSNP
rs1453435763 2001 dbSNP
rs1003099685 2003 dbSNP
rs1320537508 2005 dbSNP
rs1363657508 2006 dbSNP
rs1206582016 2020 dbSNP
rs1311926125 2021 dbSNP
rs1486046600 2037 dbSNP
rs907473986 2044 dbSNP
rs941642101 2048 dbSNP
rs1044566725 2052 dbSNP
rs1221540564 2058 dbSNP
rs1466203556 2065 dbSNP
rs1186995552 2066 dbSNP
rs1266440019 2068 dbSNP
rs1431212774 2069 dbSNP
rs910110823 2071 dbSNP
rs556046913 2081 dbSNP
rs1431717699 2090 dbSNP
rs948895926 2098 dbSNP
rs893217800 2100 dbSNP
rs1283916605 2109 dbSNP
rs186062939 2109 dbSNP
rs1158523537 2114 dbSNP
rs1386487457 2119 dbSNP
rs747149860 2124 dbSNP
rs114211730 2130 dbSNP
rs1367393404 2146 dbSNP
rs1385448942 2165 dbSNP
rs924605273 2169 dbSNP
rs181017641 2175 dbSNP
rs1314526365 2176 dbSNP
rs149080180 2176 dbSNP
rs1330547208 2179 dbSNP
rs539432451 2186 dbSNP
rs1384166736 2193 dbSNP
rs1389757114 2198 dbSNP
rs1336496336 2201 dbSNP
rs370698924 2206 dbSNP
rs1427531049 2216 dbSNP
rs1480901946 2233 dbSNP
rs577811533 2234 dbSNP
rs923218192 2237 dbSNP
rs1420924657 2238 dbSNP
rs756206152 2264 dbSNP
rs868019523 2270 dbSNP
rs1474784128 2271 dbSNP
rs964552727 2271 dbSNP
rs752111429 2272 dbSNP
rs570612495 2273 dbSNP
rs1194832901 2274 dbSNP
rs57518969 2278 dbSNP
rs1032889268 2284 dbSNP
rs950535259 2288 dbSNP
rs1306210889 2292 dbSNP
rs752983506 2303 dbSNP
rs1223851921 2314 dbSNP
rs1311997722 2315 dbSNP
rs903010111 2331 dbSNP
rs1462539946 2334 dbSNP
rs1024501359 2339 dbSNP
rs1221537917 2344 dbSNP
rs1002977002 2350 dbSNP
rs189676830 2351 dbSNP
rs567904789 2367 dbSNP
rs1481691927 2374 dbSNP
rs548015585 2390 dbSNP
rs1249692227 2397 dbSNP
rs1177866466 2401 dbSNP
rs780589111 2401 dbSNP
rs1422613727 2404 dbSNP
rs529324112 2405 dbSNP
rs1366181091 2410 dbSNP
rs557968559 2415 dbSNP
rs754018922 2416 dbSNP
rs1442414299 2421 dbSNP
rs1385501763 2429 dbSNP
rs1047301711 2434 dbSNP
rs1376281850 2440 dbSNP
rs569838537 2440 dbSNP
rs750903558 2443 dbSNP
rs998925740 2454 dbSNP
rs1041549314 2466 dbSNP
rs1225884906 2467 dbSNP
rs1274783030 2468 dbSNP
rs942811798 2468 dbSNP
rs911262330 2470 dbSNP
rs903288931 2481 dbSNP
rs145777089 2486 dbSNP
rs1244291376 2495 dbSNP
rs1410202285 2495 dbSNP
rs1449308522 2495 dbSNP
rs538135958 2495 dbSNP
rs796707805 2495 dbSNP
rs1174885520 2497 dbSNP
rs1356966724 2502 dbSNP
rs1454113284 2504 dbSNP
rs1337373033 2505 dbSNP
rs1384220101 2506 dbSNP
rs759436101 2509 dbSNP
rs1271747405 2512 dbSNP
rs1446177181 2515 dbSNP
rs934025363 2519 dbSNP
rs1243559824 2524 dbSNP
rs1215432564 2526 dbSNP
rs1278147945 2535 dbSNP
rs923186929 2538 dbSNP
rs1321586810 2539 dbSNP
rs1180913556 2540 dbSNP
rs1038885384 2548 dbSNP
rs1436022149 2562 dbSNP
rs1464847090 2568 dbSNP
rs1187170128 2570 dbSNP
rs1244240296 2571 dbSNP
rs1275096650 2572 dbSNP
rs943300431 2575 dbSNP
rs1197621079 2579 dbSNP
rs1475926484 2586 dbSNP
rs909023170 2592 dbSNP
rs1190337127 2595 dbSNP
rs1422602362 2599 dbSNP
rs1470718437 2603 dbSNP
rs1176524837 2614 dbSNP
rs985049645 2618 dbSNP
rs533372589 2629 dbSNP
rs1387226935 2630 dbSNP
rs950480320 2631 dbSNP
rs1343010765 2635 dbSNP
rs1320184245 2638 dbSNP
rs1326849272 2644 dbSNP
rs1435496627 2655 dbSNP
rs977321557 2658 dbSNP
rs967225626 2659 dbSNP
rs1024158813 2663 dbSNP
rs919030863 2665 dbSNP
rs1244088533 2666 dbSNP
rs1014477557 2667 dbSNP
rs958492332 2673 dbSNP
rs1005216152 2682 dbSNP
rs1034476098 2682 dbSNP
rs1221311920 2687 dbSNP
rs888106049 2694 dbSNP
rs751354508 2700 dbSNP
rs1285164349 2702 dbSNP
rs1481231127 2704 dbSNP
rs564577288 2714 dbSNP
rs1410649074 2715 dbSNP
rs1471308034 2716 dbSNP
rs994361481 2719 dbSNP
rs1385566444 2722 dbSNP
rs1334495561 2724 dbSNP
rs1321353137 2725 dbSNP
rs1022641054 2730 dbSNP
rs1407043457 2734 dbSNP
rs1331542261 2740 dbSNP
rs766179000 2747 dbSNP
rs758578101 2748 dbSNP
rs1013145914 2750 dbSNP
rs1284122025 2758 dbSNP
rs957626967 2759 dbSNP
rs1409871792 2760 dbSNP
rs569241445 2761 dbSNP
rs1281295656 2762 dbSNP
rs750634877 2763 dbSNP
rs1033162591 2766 dbSNP
rs1161237930 2770 dbSNP
rs1426167740 2772 dbSNP
rs901410041 2773 dbSNP
rs1222824843 2784 dbSNP
rs764677684 2789 dbSNP
rs1435632944 2791 dbSNP
rs942823890 2796 dbSNP
rs1472446855 2797 dbSNP
rs1161365160 2809 dbSNP
rs1386900366 2811 dbSNP
rs1425058275 2819 dbSNP
rs1304040287 2823 dbSNP
rs1157764883 2829 dbSNP
rs555449979 2833 dbSNP
rs1054271598 2839 dbSNP
rs1234500270 2841 dbSNP
rs1244762712 2845 dbSNP
rs1313519262 2847 dbSNP
rs1182495044 2852 dbSNP
rs903257088 2854 dbSNP
rs1051653314 2861 dbSNP
rs936683246 2866 dbSNP
rs1337049608 2867 dbSNP
rs998225055 2869 dbSNP
rs1301515204 2870 dbSNP
rs548069332 2876 dbSNP
rs1039695065 2878 dbSNP
rs528019072 2879 dbSNP
rs943267874 2888 dbSNP
rs917122742 2889 dbSNP
rs1445103687 2890 dbSNP
rs887715887 2892 dbSNP
rs1371088060 2897 dbSNP
rs186493964 2905 dbSNP
rs1169850100 2910 dbSNP
rs1349038365 2924 dbSNP
rs1395522930 2926 dbSNP
rs992680114 2927 dbSNP
rs929165493 2928 dbSNP
rs150215704 2929 dbSNP
rs1034138120 2930 dbSNP
rs1325005102 2930 dbSNP
rs1229201465 2941 dbSNP
rs1229578770 2950 dbSNP
rs981559112 2960 dbSNP
rs1251520763 2968 dbSNP
rs576170728 2970 dbSNP
rs562577478 2975 dbSNP
rs1025283369 2977 dbSNP
rs1461735963 2982 dbSNP
rs753435782 2990 dbSNP
rs991175970 2996 dbSNP
rs1259457027 2997 dbSNP
rs993760051 2997 dbSNP
rs1195686715 2998 dbSNP
rs901428544 3000 dbSNP
rs1469433160 3002 dbSNP
rs1174378739 3004 dbSNP
rs1408342487 3015 dbSNP
rs566812742 3020 dbSNP
rs547074651 3022 dbSNP
rs1383336642 3036 dbSNP
rs1384257610 3044 dbSNP
rs545428501 3046 dbSNP
rs1053894851 3049 dbSNP
rs967909866 3064 dbSNP
rs576766768 3065 dbSNP
rs1029836627 3070 dbSNP
rs1323592616 3082 dbSNP
rs377693432 3083 dbSNP
rs1159766542 3084 dbSNP
rs1258890258 3099 dbSNP
rs1205519150 3100 dbSNP
rs1486759144 3100 dbSNP
rs1266330837 3108 dbSNP
rs1480074054 3112 dbSNP
rs116647857 3122 dbSNP
rs1197481857 3126 dbSNP
rs553527140 3126 dbSNP
rs1480799816 3132 dbSNP
rs899947854 3133 dbSNP
rs1455742858 3136 dbSNP
rs1289847672 3142 dbSNP
rs1018213422 3151 dbSNP
rs1197351440 3152 dbSNP
rs1489545237 3155 dbSNP
rs1247479146 3158 dbSNP
rs1365287602 3160 dbSNP
rs141278941 3164 dbSNP
rs16833132 3168 dbSNP
rs1445592784 3169 dbSNP
rs1286785158 3177 dbSNP
rs1209843224 3178 dbSNP
rs1323433648 3196 dbSNP
rs1227231595 3197 dbSNP
rs937219901 3197 dbSNP
rs927102422 3206 dbSNP
rs887693422 3207 dbSNP
rs1264666161 3208 dbSNP
rs1489791194 3222 dbSNP
rs776266015 3223 dbSNP
rs1220595187 3230 dbSNP
rs1043483415 3231 dbSNP
rs952478636 3232 dbSNP
rs1025308013 3235 dbSNP
rs972411964 3237 dbSNP
rs570643754 3240 dbSNP
rs1421419268 3244 dbSNP
rs929242941 3249 dbSNP
rs768257277 3251 dbSNP
rs1160438915 3252 dbSNP
rs1224775482 3254 dbSNP
rs746253282 3255 dbSNP
rs1045608515 3261 dbSNP
rs1365813173 3269 dbSNP
rs554314619 3272 dbSNP
rs1019893471 3274 dbSNP
rs1295966484 3279 dbSNP
rs1374821497 3280 dbSNP
rs1391931541 3287 dbSNP
rs1314261610 3288 dbSNP
rs1357103420 3290 dbSNP
rs1269172736 3293 dbSNP
rs1292161923 3295 dbSNP
rs1007533225 3301 dbSNP
rs890018293 3302 dbSNP
rs1346679220 3315 dbSNP
rs1032522994 3318 dbSNP
rs949764143 3346 dbSNP
rs572244663 3347 dbSNP
rs181213907 3357 dbSNP
rs558569147 3358 dbSNP
rs1443250814 3380 dbSNP
rs1165876919 3381 dbSNP
rs1469156921 3384 dbSNP
rs16845530 3385 dbSNP
rs1409039190 3390 dbSNP
rs935704343 3397 dbSNP
rs1167836999 3405 dbSNP
rs1355820145 3406 dbSNP
rs752944007 3407 dbSNP
rs896466226 3416 dbSNP
rs749820324 3425 dbSNP
rs778285988 3426 dbSNP
rs1057073916 3427 dbSNP
rs1315511209 3427 dbSNP
rs1360976175 3428 dbSNP
rs1425989198 3429 dbSNP
rs1271131395 3431 dbSNP
rs550252409 3435 dbSNP
rs1309407542 3437 dbSNP
rs978041274 3441 dbSNP
rs1250197502 3444 dbSNP
rs1262523759 3448 dbSNP
rs927185096 3449 dbSNP
rs1189607836 3450 dbSNP
rs1244171514 3451 dbSNP
rs1461174480 3453 dbSNP
rs967670845 3454 dbSNP
rs1030223498 3457 dbSNP
rs1421218079 3458 dbSNP
rs983921815 3467 dbSNP
rs1206143644 3469 dbSNP
rs1403219048 3475 dbSNP
rs976913706 3481 dbSNP
rs918368353 3483 dbSNP
rs1212380378 3488 dbSNP
rs972442633 3502 dbSNP
rs965094846 3503 dbSNP
rs1364367366 3512 dbSNP
rs964085905 3518 dbSNP
rs1451606994 3520 dbSNP
rs1219425799 3528 dbSNP
rs146552932 3531 dbSNP
rs1338571563 3543 dbSNP
rs144175870 3550 dbSNP
rs764188891 3551 dbSNP
rs888406388 3557 dbSNP
rs1279932884 3558 dbSNP
rs1446848396 3566 dbSNP
rs1025651952 3568 dbSNP
rs756153224 3570 dbSNP
rs985112174 3575 dbSNP
rs1475557130 3576 dbSNP
rs1198204588 3580 dbSNP
rs1426659095 3582 dbSNP
rs1359754049 3607 dbSNP
rs993798711 3608 dbSNP
rs897765951 3609 dbSNP
rs1045576967 3627 dbSNP
rs1169808271 3635 dbSNP
rs1014129918 3646 dbSNP
rs1408347104 3659 dbSNP
rs894225025 3665 dbSNP
rs1055512053 3666 dbSNP
rs1392218972 3678 dbSNP
rs763833385 3679 dbSNP
rs1032558828 3681 dbSNP
rs1001074769 3687 dbSNP
rs1302753660 3688 dbSNP
rs530796288 3694 dbSNP
rs935769705 3704 dbSNP
rs1343778755 3705 dbSNP
rs902676691 3708 dbSNP
rs1444338566 3711 dbSNP
rs1241716082 3712 dbSNP
rs1021080511 3713 dbSNP
rs925578525 3715 dbSNP
rs1041402585 3716 dbSNP
rs1222528988 3729 dbSNP
rs1286833974 3730 dbSNP
rs1488810291 3731 dbSNP
rs1014070438 3735 dbSNP
rs1266325888 3741 dbSNP
rs1483873435 3744 dbSNP
rs752785264 3753 dbSNP
rs1490719078 3785 dbSNP
rs1198968280 3788 dbSNP
rs1231768335 3789 dbSNP
rs1468564282 3800 dbSNP
rs922887504 3802 dbSNP
rs369327148 3810 dbSNP
rs1201820121 3816 dbSNP
rs374895933 3817 dbSNP
rs1408498912 3819 dbSNP
rs781591301 3822 dbSNP
rs760262223 3823 dbSNP
rs527965860 3830 dbSNP
rs1406946803 3831 dbSNP
rs1324322373 3836 dbSNP
rs1335218577 3839 dbSNP
rs1440716772 3846 dbSNP
rs984578310 3856 dbSNP
rs905826789 3867 dbSNP
rs1245707545 3877 dbSNP
rs151007472 3896 dbSNP
rs1361179173 3900 dbSNP
rs751802742 3910 dbSNP
rs548757644 3912 dbSNP
rs1026046576 3919 dbSNP
rs1962046 3929 dbSNP
rs189438762 3932 dbSNP
rs1443855442 3940 dbSNP
rs1296419359 3941 dbSNP
rs1181550774 3963 dbSNP
rs1386822387 3966 dbSNP
rs1024266472 3971 dbSNP
rs1164029811 3977 dbSNP
rs1014180766 3992 dbSNP
rs943796490 3994 dbSNP
rs563119845 3995 dbSNP
rs912278509 3996 dbSNP
rs1372512599 3997 dbSNP
rs985535018 3998 dbSNP
rs1169422303 4000 dbSNP
rs1452484931 4000 dbSNP
rs187011946 4001 dbSNP
rs1424265703 4002 dbSNP
rs1313415424 4005 dbSNP
rs953737247 4008 dbSNP
rs894277395 4009 dbSNP
rs979669952 4023 dbSNP
rs1336956520 4025 dbSNP
rs966892354 4026 dbSNP
rs1055646988 4030 dbSNP
rs1167334011 4033 dbSNP
rs1000331833 4040 dbSNP
rs1424828757 4044 dbSNP
rs1460842887 4051 dbSNP
rs904297836 4052 dbSNP
rs1407855619 4056 dbSNP
rs72956601 4062 dbSNP
rs945768237 4065 dbSNP
rs1424165711 4069 dbSNP
rs142641106 4074 dbSNP
rs1251951563 4075 dbSNP
rs758195008 4076 dbSNP
rs1041243205 4079 dbSNP
rs560071620 4080 dbSNP
rs1172937388 4083 dbSNP
rs1489710970 4083 dbSNP
rs1401072229 4084 dbSNP
rs1469773664 4085 dbSNP
rs1033765689 4089 dbSNP
rs181482495 4090 dbSNP
rs1316172579 4095 dbSNP
rs1396966267 4099 dbSNP
rs1295214884 4100 dbSNP
rs1324332510 4105 dbSNP
rs1304719624 4107 dbSNP
rs574357750 4109 dbSNP
rs887765715 4110 dbSNP
rs750339148 4113 dbSNP
rs148449338 4114 dbSNP
rs952893588 4115 dbSNP
rs765151106 4116 dbSNP
rs897046643 4119 dbSNP
rs1037278853 4123 dbSNP
rs973141137 4134 dbSNP
rs1445526160 4145 dbSNP
rs1196076473 4152 dbSNP
rs970675656 4154 dbSNP
rs1363940265 4155 dbSNP
rs912341782 4157 dbSNP
rs1295548097 4159 dbSNP
rs1379882599 4159 dbSNP
rs1288675818 4162 dbSNP
rs1383227077 4165 dbSNP
rs116838176 4177 dbSNP
rs1014149445 4178 dbSNP
rs932337484 4190 dbSNP
rs1221161088 4196 dbSNP
rs1157511961 4206 dbSNP
rs1312724766 4209 dbSNP
rs1473862017 4232 dbSNP
rs1258784321 4242 dbSNP
rs924924957 4243 dbSNP
rs761340492 4247 dbSNP
rs1479191638 4248 dbSNP
rs1034168168 4249 dbSNP
rs775399631 4251 dbSNP
rs1197373474 4253 dbSNP
rs1210086795 4257 dbSNP
rs1434296193 4259 dbSNP
rs1158994967 4260 dbSNP
rs966964455 4263 dbSNP
rs1159559767 4272 dbSNP
rs1485398787 4272 dbSNP
rs1364589898 4276 dbSNP
rs1000065394 4283 dbSNP
rs1402662302 4283 dbSNP
rs1367657403 4284 dbSNP
rs1390797541 4289 dbSNP
rs904265739 4291 dbSNP
rs1020073528 4293 dbSNP
rs1337378851 4293 dbSNP
rs776070347 4296 dbSNP
rs1010404830 4300 dbSNP
rs575093961 4310 dbSNP
rs1267358130 4311 dbSNP
rs766952393 4312 dbSNP
rs1254354583 4314 dbSNP
rs1329468034 4317 dbSNP
rs547831366 4319 dbSNP
rs1442027155 4331 dbSNP
rs900814668 4334 dbSNP
rs558514308 4335 dbSNP
rs1422407107 4339 dbSNP
rs1387599797 4344 dbSNP
rs1166443254 4345 dbSNP
rs1350019798 4346 dbSNP
rs1461040517 4350 dbSNP
rs1295875974 4357 dbSNP
rs1379036581 4361 dbSNP
rs1027623490 4364 dbSNP
rs1314145230 4367 dbSNP
rs1380281987 4370 dbSNP
rs1226880766 4374 dbSNP
rs1040700523 4375 dbSNP
rs942933069 4381 dbSNP
rs1322488959 4382 dbSNP
rs890064964 4383 dbSNP
rs763572931 4392 dbSNP
rs1389975438 4393 dbSNP
rs1459505139 4393 dbSNP
rs78398014 4396 dbSNP
rs1242971741 4397 dbSNP
rs918753335 4401 dbSNP
rs1008514183 4413 dbSNP
rs972806662 4414 dbSNP
rs144512503 4434 dbSNP
rs189638567 4440 dbSNP
rs1183305469 4443 dbSNP
rs772172165 4452 dbSNP
rs1467729706 4453 dbSNP
rs1378891400 4458 dbSNP
rs1199047431 4459 dbSNP
rs1427568787 4467 dbSNP
rs534192571 4474 dbSNP
rs1167727657 4478 dbSNP
rs35721308 4484 dbSNP
rs917898934 4485 dbSNP
rs1335990334 4487 dbSNP
rs1465214565 4491 dbSNP
rs528090261 4493 dbSNP
rs1201720308 4497 dbSNP
rs775202108 4499 dbSNP
rs1034306497 4500 dbSNP
rs1276432916 4504 dbSNP
rs568721895 4508 dbSNP
rs1043421622 4516 dbSNP
rs979001336 4518 dbSNP
rs1460319810 4520 dbSNP
rs914173024 4525 dbSNP
rs1238358888 4529 dbSNP
rs1257841183 4533 dbSNP
rs1485357113 4533 dbSNP
rs1184372482 4536 dbSNP
rs968542722 4539 dbSNP
rs992408049 4546 dbSNP
rs1234166546 4547 dbSNP
rs1175008140 4553 dbSNP
rs1427135120 4554 dbSNP
rs1020545746 4562 dbSNP
rs939538091 4563 dbSNP
rs1009913409 4564 dbSNP
rs368577006 4565 dbSNP
rs926829540 4567 dbSNP
rs1430340811 4575 dbSNP
rs770160278 4580 dbSNP
rs1296565577 4584 dbSNP
rs1342523016 4591 dbSNP
rs1400695601 4610 dbSNP
rs980874567 4619 dbSNP
rs1343515814 4620 dbSNP
rs1221393729 4622 dbSNP
rs952136344 4622 dbSNP
rs1316672110 4624 dbSNP
rs1264890648 4625 dbSNP
rs900949123 4625 dbSNP
rs1366400523 4626 dbSNP
rs1027654333 4627 dbSNP
rs1266102412 4628 dbSNP
rs1478991068 4629 dbSNP
rs1336602078 4636 dbSNP
rs1407055891 4637 dbSNP
rs1394805208 4638 dbSNP
rs1403645294 4639 dbSNP
rs1160164324 4640 dbSNP
rs1257771699 4640 dbSNP
rs1302661678 4640 dbSNP
rs1329382777 4640 dbSNP
rs1362706357 4640 dbSNP
rs1420485634 4640 dbSNP
rs34738974 4640 dbSNP
rs35206635 4640 dbSNP
rs562770905 4640 dbSNP
rs58446233 4640 dbSNP
rs776305873 4640 dbSNP
rs869225060 4640 dbSNP
rs748257891 4641 dbSNP
rs1199574499 4642 dbSNP
rs1287192340 4642 dbSNP
rs1491568630 4642 dbSNP
rs1491218526 4643 dbSNP
rs1437685138 4644 dbSNP
rs1180298729 4645 dbSNP
rs972077114 4646 dbSNP
rs548894469 4652 dbSNP
rs1052279012 4654 dbSNP
rs1170147570 4656 dbSNP
rs1388735447 4658 dbSNP
rs1407161849 4658 dbSNP
rs1324224087 4660 dbSNP
rs1354494322 4671 dbSNP
rs1449797219 4672 dbSNP
rs1242337940 4690 dbSNP
rs1019226628 4694 dbSNP
rs1444080040 4696 dbSNP
rs11932 4697 dbSNP
rs34671815 4701 dbSNP
rs1008130611 4702 dbSNP
rs200609629 4703 dbSNP
rs35746407 4704 dbSNP
rs1282064429 4707 dbSNP
rs890032473 4715 dbSNP
rs569418384 4721 dbSNP
rs903609741 4722 dbSNP
rs552523539 4726 dbSNP
rs1272689615 4738 dbSNP
rs1200418528 4741 dbSNP
rs749602224 4742 dbSNP
rs897291019 4743 dbSNP
rs536425747 4752 dbSNP
rs1185061403 4753 dbSNP
rs773623475 4754 dbSNP
rs1163943684 4769 dbSNP
rs576565427 4773 dbSNP
rs1314810172 4774 dbSNP
rs1464566225 4784 dbSNP
rs1491319245 4785 dbSNP
rs1446355500 4786 dbSNP
rs1491460065 4786 dbSNP
rs1452374518 4794 dbSNP
rs949428232 4806 dbSNP
rs945052894 4811 dbSNP
rs770377288 4825 dbSNP
rs866755149 4837 dbSNP
rs918037245 4845 dbSNP
rs1269115146 4846 dbSNP
rs990812823 4847 dbSNP
rs1315502106 4857 dbSNP
rs532204432 4860 dbSNP
rs1056511191 4862 dbSNP
rs564319691 4864 dbSNP
rs1368190930 4865 dbSNP
rs372934551 4865 dbSNP
rs1309431365 4866 dbSNP
rs925280739 4872 dbSNP
rs866238574 4884 dbSNP
rs540187087 4895 dbSNP
rs529644964 4901 dbSNP
rs1423080877 4904 dbSNP
rs55781608 4913 dbSNP
rs1172828820 4915 dbSNP
rs1424984976 4922 dbSNP
rs1465935742 4923 dbSNP
rs1171222533 4930 dbSNP
rs1161233310 4935 dbSNP
rs1404762993 4950 dbSNP
rs755106493 4951 dbSNP
rs980905675 4952 dbSNP
rs1317174306 4953 dbSNP
rs1337857907 4954 dbSNP
rs1020094556 4956 dbSNP
rs747255506 4958 dbSNP
rs988629104 4964 dbSNP
rs1230941138 4967 dbSNP
rs184890366 4984 dbSNP
rs1345437389 4988 dbSNP
rs556037852 4989 dbSNP
rs758128745 4992 dbSNP
rs972111542 5001 dbSNP
rs1487396827 5002 dbSNP
rs1019360290 5005 dbSNP
rs1263945438 5007 dbSNP
rs1006596691 5009 dbSNP
rs1197339051 5015 dbSNP
rs1433155601 5015 dbSNP
rs1483495927 5022 dbSNP
rs1379786806 5026 dbSNP
rs1466868278 5031 dbSNP
rs1158346443 5040 dbSNP
rs1018967728 5061 dbSNP
rs1421101222 5063 dbSNP
rs987848892 5068 dbSNP
rs575190129 5072 dbSNP
rs1303314071 5084 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guguUUGGUAAU-------A-CACGACGAu 5'
              |||::|||       | |||||||| 
9 - 38
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000344337.6 | 3UTR | UUACUUUUUCUAGUGCUGCUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000344337.6 | 3UTR | UUACUUUUUCUAGUGCUGCUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.35 5.9e-4 0.202 3.4e-2 83 Click to see details
GSE38226 Liver fibrosis 0.601 2.0e-3 0.663 5.3e-4 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.564 4.8e-3 0.701 2.9e-4 20 Click to see details
GSE28260 Renal cortex and medulla -0.527 3.2e-2 -0.385 9.7e-2 13 Click to see details
GSE32688 Pancreatic cancer 0.306 4.4e-2 0.321 3.7e-2 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.345 4.6e-2 -0.262 1.0e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.358 4.7e-2 0.363 4.4e-2 23 Click to see details
GSE14794 Lymphoblastoid cells -0.138 9.7e-2 -0.080 2.3e-1 90 Click to see details
GSE19783 ER- ER- breast cancer 0.111 1.7e-1 0.059 3.0e-1 79 Click to see details
GSE27834 Pluripotent stem cells 0.249 1.8e-1 0.206 2.2e-1 16 Click to see details
GSE21849 B cell lymphoma 0.179 1.8e-1 0.273 7.6e-2 29 Click to see details
GSE28544 Breast cancer -0.178 2.0e-1 -0.388 3.1e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.102 2.1e-1 0.063 3.1e-1 64 Click to see details
GSE19783 ER+ ER+ breast cancer -0.188 2.1e-1 -0.120 3.1e-1 20 Click to see details
GSE19536 Breast cancer 0.08 2.1e-1 0.063 2.7e-1 100 Click to see details
GSE19350 CNS germ cell tumors 0.226 2.4e-1 0.245 2.2e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.091 3.4e-1 0.132 2.7e-1 24 Click to see details
GSE17498 Multiple myeloma 0.059 3.6e-1 0.008 4.8e-1 40 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.019 4.6e-1 -0.027 4.5e-1 25 Click to see details
GSE17306 Multiple myeloma 0.001 5.0e-1 -0.106 2.3e-1 49 Click to see details
GSE17306 Multiple myeloma 0.001 5.0e-1 -0.106 2.3e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.279 0.01 0.257 0.01 84 Click to see details
BLCA -0.481 0.02 -0.307 0.11 18 Click to see details
HNSC 0.289 0.03 0.250 0.06 42 Click to see details
STAD -0.31 0.04 -0.337 0.03 32 Click to see details
PAAD 0.776 0.11 0.400 0.3 4 Click to see details
UCEC 0.287 0.12 0.272 0.13 19 Click to see details
LUAD 0.351 0.13 0.364 0.12 12 Click to see details
LIHC -0.137 0.17 -0.171 0.12 49 Click to see details
THCA 0.101 0.22 0.025 0.43 59 Click to see details
CHOL -0.264 0.25 -0.083 0.42 9 Click to see details
COAD -0.226 0.3 -0.667 0.04 8 Click to see details
LUSC 0.078 0.32 0.097 0.28 38 Click to see details
CESC 0.477 0.34 0.500 0.33 3 Click to see details
KICH 0.067 0.38 0.095 0.33 25 Click to see details
PRAD 0.032 0.41 0.030 0.42 50 Click to see details
PCPG -0.24 0.42 -0.500 0.33 3 Click to see details
KIRP 0.031 0.43 -0.178 0.16 32 Click to see details
KIRC -0.012 0.46 -0.021 0.43 68 Click to see details
ESCA -0.026 0.47 -0.027 0.47 11 Click to see details
ESCA -0.026 0.47 -0.027 0.47 11 Click to see details
ESCA -0.026 0.47 -0.027 0.47 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1