Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT547131 [miRNA, hsa-miR-15a-5p :: PHLPP2, target gene]
miRTarBase - #MIRT547131 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PHLPP2   
Synonyms PHLPPL, PPM3B
Description PH domain and leucine rich repeat protein phosphatase 2
Transcript NM_015020   
Expression
Putative miRNA Targets on PHLPP2
3'UTR of PHLPP2
(miRNA target sites are highlighted)
>PHLPP2|NM_015020|3'UTR
   1 CTGCCCCACTGGGCACAGTGTGGGAGGAGGCTGTGCAGGGTTGGGGTAGGGACTTGCTAGAGGCATTCTGCCTCTACATT
  81 TCTTTTTGTTTGTTCGTTTTTTTTTTGTTTGTTTGTTTTGAGACGGAGTCTTGCTCAGTCGCTCAGGCTGGAGTGCAATG
 161 GTGGGGTCTCGGGTCACTGCAGCCTCTGTCCCTGGGTTCAAGCCATTCTCCTGTCTCAGCCTCCCGAGTAGCTGGGATTA
 241 CAGGCACCTGCCATTATGCCCGGCTAAGTTTTATTTTTTTTTTTTAGAGACGGGGTTTCACCATGTTGGCCAGGCTGGTG
 321 TTGAACTCTTGACCTCAGGTGATCCACCCTCCTCTGCCTCCCAAAGTGCTGTGATTACAGGCCTCAGCCACCATGCCCAG
 401 CCCTGCGTCTACATTTCTAAACCATAGCTGTGTGGGGTTGAACTCGGAGCCAAAAAGTGTGAGAGCCATCAGGGGCTGGC
 481 TCTGGATAAACTGGTAGCCACTATCAGTGTTAAGTTTCACATTTAACCTGCATTGGAATTCCCAGGGGTACTGGGAAGAA
 561 AGCAGCTGTTCTGTATCAGTCCTACCACCTGCCATTAACCCTTTCTCTCCTAGGATCATTTTGAGAATTTGCCTGCCTGG
 641 GCAGGAAAGGGACTATTTCTGTGGAGGAAAAAAGTGAAGATTGATTCTCTTTACTAGTTGCTGCTGATGGATCTCTGTGA
 721 CAGAGAAATCACCTTATCTCAGACTAATGGGGTGTGATGTGACTAGTCACATGGCTTTTCATTCTTCTCTACGAGAATAC
 801 AGCCTATCAAAATGATGTCTGTTGGAAATGTAGAACCAATCAAACAGATAATTTATGTATGTAATGTAATGAGAGCACTT
 881 TTCATTGACTGTGAACTTTTTATTTTTGAATCTGCACTCGAGCCAATCTTCTTAGAGGCAGCCCGGCACCTTCATCCATA
 961 GGCAGAGAGAGAACTGGGTGTTGGAGACTTATTCGAGGGTATAGGAAGGGCCCTGTGAAGTTGATTTAACTTTTGGATGT
1041 CAGACTGTGAAAGCTCCTGAGAAACTTGGGGTAATAGGATCTTCTTTTGGGGATGAAAATGGGGAAGGCGTGAGGACCTA
1121 GACTACTTCTCCCTAGATCAGAAAAAGAGAATTACCCCTTGACAAATATGATACCTGCTAGGTATTTCCCAGGGAAATTT
1201 AGGGATTGGCGTCTTTCCCTAGCATGTGGAGGAATTGGCAGACAGCTTCCTAAGGGCGGGGAGCGGGGGCCCAAGGCTGA
1281 CACTGCTTGCATCCACGTGACCTTAAGTTATGGCAGATGACTCTGAAACGGACTGAGGCCAATGAGAACAGATGGATGGA
1361 GCACTCAGGTTAGACTTGTTCCTTCTCCTATGCTGGAGGAGAGGGATGGTTCTCTAGAATGTTGGAGGTGAGTTGAGAGC
1441 TCGCCTCTTGAATGTTGAACAGTGTACTCTTCTGAAAACTGCATATTCACTTTATGTGGTTTCAGAATACTGGGCTCAAT
1521 ACTAACATAAGAAAGACACTTCATTGAGAAATTCTTAAGCTTACAGAAAACCTATACTCTTTGCACATTCCACATAACCC
1601 TAGCAAAATGCAGTTTCTTCATACTTCTGTCACTTTTTCCATTGGAAGATTTGCTTAGGAAAATTAATTCCTATTTATTC
1681 CCACAAAATGTTGGCATTGCTTGATTTTACCCAATGGGGAATGTGCTTTGAATTTTTGGAACACTTTTACAATTAAAAAT
1761 AAAGTAGGGCCATTTTTAATTTGTTTCATCAGAAACTATGTTAAAGAGAGGGTTAAATATAAATATATTTTCGTGTGTAT
1841 TTTTGGGAAGATTTTTGTTCAAAGCAATAGTCAAAATCAGATGACCTGTCCATAATAATTATGTGTCTTCATCTTCTCAG
1921 AGGCCCCATGCTCATATGCACGTGTCATTGGGATACACTCTTGGGGGATTTGGTACACTCTAATGGATGTCTAATGTTCA
2001 ACCCCTCGAGAATCTGAACTTGAGTCCCCAGATTGTCAAACTACTGGTCAGCTATTGAGAATTTTAGAACTCAGGTCTTT
2081 GATTTGAAGTAGGGAACATAGTGGCTCACACAGAGTTTAGGTGCTGTTAGAAAGATGGGAACAAGAGTGTTTTGCCACCT
2161 TATTTTTATATGGGAAATTTTTTTTAATGAAGAAAAAATGAAAATGAAATAACAGGATGATAGTGATGAGTGATGTAAAA
2241 CATCTTACTTAGATGGCAGAACCTTCGGGTTGTAGAATAGTGATGTCTAAAAATTAAAGTTATTTTGGGAATACACCACT
2321 TTAATAGTATAGTCTTATAAAAATTATTCATTATGGTGAACCCTTCTTGTCTGCTATTCGTTTCCCAACCTACTTATTGG
2401 AACCACCTCAAAACCCAGTTCTGAAATGACCTTACCAAAAGTAAATGTATTTATTTTTTAGTCAGCAGAACTCTGTAATT
2481 CCAAATGTTGTTCTGTGTGGTAGAATTTTTTTTCAGGAACCATTAGGTTGTATTGAAAATCTTTGTTATAGGCGATACCA
2561 AAACTGATTATTCTTTTTTGCAGTCTGCTTTAATTCATGTCCTTCTGCAGTTGCTCTGTATTAAAACAGGGTAAAAAGGC
2641 CATAGCCCATTATGAAAAATATAATACAAAACTCTTTGACCTATGAGGTAACTTACAGACATTGTGTTTTCTAAACAGGC
2721 TGTCAGTGAAAGCCCGTATCTGTCTCCAGGTGAATGTAATTTACTTCCGAGTACTTTACCCAGAGGATGTGTTCCCCAGG
2801 TGGGCAGAGTACAGTTGATCTCTAGCACAGACAGAGATTCTGGCCTCTGCATATTCTCAGGTCTCTGTGTGTACCTCCCA
2881 TTGAGTAGAGAAGCTTAAGATAATTTCTGAGAGAAGAACACTGCTGATTGTGGGAGCAGTTTAGGAGTCCATGGAAGAAA
2961 GAAAAATACATGTGTCTTGGCAGCCATGGTGTATTTTTGTCCAAATGGATTGGAAGGATATTTGAATATTTGAATGTTGG
3041 TATGACATAAAGCTGCAGTGCACTATAGAGTCAAGTCATTGAATTACCACTCCTGATACAGGGCTTTATTGTACTACTGT
3121 GAAGTGTATGTGTGCAATACATTGGTGAGTTCATTTACTGGTGTACGGAAGAGCCAGCAGGAGCAGCGTGGTCATTGCTG
3201 GGTGCTATTACAGTTGCTTGTAGTGAGTGCTGTTTTCCAGGAGATGGAGCCAGTTGGGTGTGGCAGATCTACTGAATATC
3281 AAATGATGCTCTTCTTCCCATGTAGACCTTCAGCAAAAGCCGGTACTTGGAAGCCACAGGCTCACCTTCTCTATCTATCC
3361 AATAATTATTAATGAAGAGACCTCCATAAGGGAGCAGCTGGCTGTTATCGATAAATGTACCAATTATTAAATAATTAGTC
3441 TCCAAGCCATTCAGTGATGTCTTCAGCATCACTATAGGACTGTCTAGTGTCACTTTTTACTTCCTTCTGGGTGGAGGCTT
3521 TCCGACTCCCAATCATGAAGGCAAGTTAATCTTTCCAGTTAGTGACTTTTGCCCCATAGTTGGGGTAAGCACTTCCTAGA
3601 TTGAGAAAAAGCAGCTACAGTCAATCCTGCTCTGTTTGCCTCATTTGGTGATCAGTCAGTCACACATAAGTTCCTTGTAT
3681 TCTAAATTTCATGCACTTCTCCCAGATGCTATAGGGTTTTCTCTCACTGTTGCCAGTGGATGTCATCCAGACAGTGGGCT
3761 CATATCTTACGGTTTTGTGCAATCATTGTCGTATTGTAGTCTTAAGACTCATTATAGTGTATTTTTGATATTTTTGAAAT
3841 GTGTTAAATTTTTTAATTCAATAATATGAGCCAGAGCATGTTGCAGCAAATCTATTGTTTGTAAAAATAACAATAACAAT
3921 AATAAATAAAATAAAGTGGAATCTTTTTCATGGCTTTGTTTTAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                ::| ||  ||||||| 
Target 5' ttctctTTACTAGTTGCTGCTg 3'
685 - 706 148.00 -11.10
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||:| : ||| ||||||:| 
Target 5' caCAGAGT-TTAGGTGCTGTTa 3'
2109 - 2129 147.00 -17.10
3
miRNA  3' guguuugGUAAUACACGACGAu 5'
                 :| |: ||||||:| 
Target 5' ttgcttgTAGTGAGTGCTGTTt 3'
3214 - 3235 135.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31600610 18 COSMIC
COSN30485792 23 COSMIC
COSN30160030 27 COSMIC
COSN30482550 49 COSMIC
COSN30157578 68 COSMIC
COSN31593799 78 COSMIC
COSN30464482 82 COSMIC
COSN30155152 95 COSMIC
COSN30179984 103 COSMIC
COSN30107809 115 COSMIC
COSN30129840 124 COSMIC
COSN6547052 125 COSMIC
COSN30450547 133 COSMIC
COSN6093278 159 COSMIC
COSN32076759 181 COSMIC
COSN9441468 228 COSMIC
COSN20060939 273 COSMIC
COSN22260905 336 COSMIC
COSN31961234 446 COSMIC
COSN30158036 505 COSMIC
COSN26561231 551 COSMIC
COSN30238617 568 COSMIC
COSN31606644 725 COSMIC
COSN31571451 726 COSMIC
COSN31533708 799 COSMIC
COSN31571914 838 COSMIC
COSN26599628 919 COSMIC
COSN16566863 994 COSMIC
COSN31515765 995 COSMIC
COSN31524391 1002 COSMIC
COSN19150373 1023 COSMIC
COSN15731561 1470 COSMIC
COSN20113066 1523 COSMIC
COSN30544365 1638 COSMIC
COSN7270039 1655 COSMIC
COSN31522478 1784 COSMIC
COSN6547051 1787 COSMIC
COSN31579353 1941 COSMIC
COSN28713625 2067 COSMIC
COSN20113061 2203 COSMIC
COSN8672211 2409 COSMIC
COSN20113060 2548 COSMIC
COSN22810013 2573 COSMIC
COSN31610747 2801 COSMIC
COSN26576528 2828 COSMIC
COSN31492127 3172 COSMIC
COSN31484641 3200 COSMIC
COSN6093277 3290 COSMIC
COSN31486664 3442 COSMIC
COSN31543227 3689 COSMIC
COSN19313211 3797 COSMIC
COSN31520591 3854 COSMIC
COSN31599930 3929 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs201990639 3 dbSNP
rs766925624 5 dbSNP
rs371565551 7 dbSNP
rs759096889 7 dbSNP
rs1224060573 9 dbSNP
rs745867400 10 dbSNP
rs557846154 18 dbSNP
rs776468659 18 dbSNP
rs961802089 21 dbSNP
rs1416495367 22 dbSNP
rs1376027375 29 dbSNP
rs1297282826 33 dbSNP
rs770587173 37 dbSNP
rs746839361 41 dbSNP
rs777229982 43 dbSNP
rs758126134 45 dbSNP
rs534044390 51 dbSNP
rs898284467 53 dbSNP
rs540816929 68 dbSNP
rs1467636760 72 dbSNP
rs1183052242 74 dbSNP
rs1332858281 83 dbSNP
rs1400406231 84 dbSNP
rs573383735 86 dbSNP
rs555083461 93 dbSNP
rs958371869 96 dbSNP
rs1233764572 97 dbSNP
rs566812443 97 dbSNP
rs1000141575 98 dbSNP
rs575679600 103 dbSNP
rs1239731933 105 dbSNP
rs968610236 105 dbSNP
rs1452385473 107 dbSNP
rs374906434 107 dbSNP
rs938673151 107 dbSNP
rs1193478858 112 dbSNP
rs1421917107 114 dbSNP
rs1214227532 119 dbSNP
rs1478973452 119 dbSNP
rs1368355946 122 dbSNP
rs372040747 124 dbSNP
rs538701229 125 dbSNP
rs1392487238 127 dbSNP
rs545916742 129 dbSNP
rs1297419641 134 dbSNP
rs1338168191 138 dbSNP
rs946153668 139 dbSNP
rs558609247 140 dbSNP
rs1320998265 141 dbSNP
rs533974235 145 dbSNP
rs964618493 158 dbSNP
rs1357392387 165 dbSNP
rs892555449 170 dbSNP
rs1261219090 171 dbSNP
rs1489491086 181 dbSNP
rs1379172950 184 dbSNP
rs1018519875 191 dbSNP
rs1422547401 196 dbSNP
rs1162170777 200 dbSNP
rs13333988 203 dbSNP
rs955016269 204 dbSNP
rs547852955 211 dbSNP
rs1401640404 225 dbSNP
rs994289427 230 dbSNP
rs889098877 238 dbSNP
rs749241618 241 dbSNP
rs1394202401 244 dbSNP
rs1314706880 245 dbSNP
rs1030690152 246 dbSNP
rs1050837431 247 dbSNP
rs930922656 251 dbSNP
rs1383632771 253 dbSNP
rs146231024 261 dbSNP
rs1255763777 262 dbSNP
rs1424507723 266 dbSNP
rs1482597804 269 dbSNP
rs1012066384 275 dbSNP
rs1184130378 275 dbSNP
rs1444749552 277 dbSNP
rs1036526704 278 dbSNP
rs11301738 286 dbSNP
rs1378153881 286 dbSNP
rs398029862 286 dbSNP
rs940830080 291 dbSNP
rs917011352 292 dbSNP
rs1056304642 303 dbSNP
rs181074659 313 dbSNP
rs1383369706 321 dbSNP
rs1485811916 323 dbSNP
rs907171916 328 dbSNP
rs958683829 331 dbSNP
rs1379476336 337 dbSNP
rs1241135849 341 dbSNP
rs550540021 351 dbSNP
rs1300782781 354 dbSNP
rs1310817955 355 dbSNP
rs1489944425 358 dbSNP
rs1289142680 359 dbSNP
rs866860107 362 dbSNP
rs1321815608 366 dbSNP
rs1457694450 371 dbSNP
rs532056276 379 dbSNP
rs1487938135 387 dbSNP
rs978826344 396 dbSNP
rs565549181 397 dbSNP
rs1020175914 400 dbSNP
rs1339741616 403 dbSNP
rs1177427952 405 dbSNP
rs988650721 407 dbSNP
rs965178375 411 dbSNP
rs1177936469 415 dbSNP
rs1041724870 423 dbSNP
rs760625459 424 dbSNP
rs1009004338 437 dbSNP
rs889184797 438 dbSNP
rs1029027206 445 dbSNP
rs574249089 446 dbSNP
rs899433970 450 dbSNP
rs1221343418 455 dbSNP
rs540602325 458 dbSNP
rs942832521 470 dbSNP
rs1168424732 473 dbSNP
rs1260474956 474 dbSNP
rs1477811253 475 dbSNP
rs911426647 476 dbSNP
rs1487281091 484 dbSNP
rs987047755 485 dbSNP
rs1036546306 497 dbSNP
rs1479677786 498 dbSNP
rs955617556 502 dbSNP
rs1429716166 508 dbSNP
rs1477341226 511 dbSNP
rs918228477 515 dbSNP
rs1267050210 518 dbSNP
rs528658729 523 dbSNP
rs1208919123 527 dbSNP
rs1488584984 529 dbSNP
rs1322952905 533 dbSNP
rs1348402525 540 dbSNP
rs972444997 541 dbSNP
rs561485770 547 dbSNP
rs1016673134 548 dbSNP
rs1280672484 558 dbSNP
rs896011917 560 dbSNP
rs1214687424 561 dbSNP
rs1288522460 565 dbSNP
rs1319612316 566 dbSNP
rs1223329492 571 dbSNP
rs1057480396 582 dbSNP
rs937141607 584 dbSNP
rs927033328 594 dbSNP
rs959198534 599 dbSNP
rs1265313531 614 dbSNP
rs1475684897 636 dbSNP
rs1034820122 637 dbSNP
rs1003380400 639 dbSNP
rs1407085221 640 dbSNP
rs978454814 641 dbSNP
rs1360075473 642 dbSNP
rs1418302464 643 dbSNP
rs947000398 647 dbSNP
rs543105259 649 dbSNP
rs1278803335 653 dbSNP
rs1327597643 657 dbSNP
rs1220339578 661 dbSNP
rs1376350878 670 dbSNP
rs1343465246 673 dbSNP
rs368631651 696 dbSNP
rs1292082492 700 dbSNP
rs1300300376 702 dbSNP
rs1214235675 705 dbSNP
rs1286085492 722 dbSNP
rs988703128 730 dbSNP
rs965270744 747 dbSNP
rs1186770607 749 dbSNP
rs200217743 759 dbSNP
rs1235624004 760 dbSNP
rs374209609 763 dbSNP
rs1393124618 770 dbSNP
rs1019470583 775 dbSNP
rs1010217417 787 dbSNP
rs893155133 789 dbSNP
rs1414193642 791 dbSNP
rs1054537170 792 dbSNP
rs985688636 806 dbSNP
rs1401069742 807 dbSNP
rs1454164178 808 dbSNP
rs1315106065 815 dbSNP
rs942800009 837 dbSNP
rs1237493619 842 dbSNP
rs1173480664 861 dbSNP
rs189132896 864 dbSNP
rs1199613134 865 dbSNP
rs1051279069 866 dbSNP
rs1462569654 872 dbSNP
rs1029452455 875 dbSNP
rs767542547 881 dbSNP
rs557222841 884 dbSNP
rs1377461342 887 dbSNP
rs1200020979 891 dbSNP
rs994813113 900 dbSNP
rs747045576 910 dbSNP
rs899149465 919 dbSNP
rs1184252678 920 dbSNP
rs1364561984 923 dbSNP
rs545367103 926 dbSNP
rs1014862014 931 dbSNP
rs1477918918 931 dbSNP
rs1427916028 934 dbSNP
rs1269027438 943 dbSNP
rs554468124 944 dbSNP
rs373247552 945 dbSNP
rs1336888675 949 dbSNP
rs1398941314 953 dbSNP
rs973425965 958 dbSNP
rs577986764 966 dbSNP
rs1330499586 967 dbSNP
rs1258119909 971 dbSNP
rs1232306550 976 dbSNP
rs1200499462 979 dbSNP
rs558783898 986 dbSNP
rs1321333223 988 dbSNP
rs1272848362 989 dbSNP
rs896049092 992 dbSNP
rs1057341156 995 dbSNP
rs534582133 999 dbSNP
rs1451222538 1002 dbSNP
rs1332534757 1015 dbSNP
rs774538105 1015 dbSNP
rs909581080 1018 dbSNP
rs1446256166 1019 dbSNP
rs905621717 1021 dbSNP
rs1422043505 1023 dbSNP
rs566894637 1029 dbSNP
rs1169106943 1037 dbSNP
rs1396846907 1043 dbSNP
rs1377804195 1047 dbSNP
rs959121135 1051 dbSNP
rs1333410698 1052 dbSNP
rs1321108172 1066 dbSNP
rs1034785690 1069 dbSNP
rs1003347788 1075 dbSNP
rs77559569 1077 dbSNP
rs865949954 1078 dbSNP
rs566284502 1079 dbSNP
rs1229756769 1081 dbSNP
rs1173605080 1086 dbSNP
rs1355988977 1090 dbSNP
rs912925021 1092 dbSNP
rs184110649 1108 dbSNP
rs536083222 1109 dbSNP
rs1156512450 1120 dbSNP
rs1438664784 1124 dbSNP
rs1261702386 1125 dbSNP
rs1430801007 1128 dbSNP
rs1011273832 1131 dbSNP
rs893132888 1131 dbSNP
rs1238332403 1132 dbSNP
rs1179963070 1138 dbSNP
rs944001355 1150 dbSNP
rs1161314884 1152 dbSNP
rs912465388 1168 dbSNP
rs1054866494 1169 dbSNP
rs1425120862 1173 dbSNP
rs759394877 1173 dbSNP
rs1338423830 1174 dbSNP
rs1383838810 1184 dbSNP
rs889893545 1185 dbSNP
rs1255387164 1188 dbSNP
rs149295364 1189 dbSNP
rs550430747 1191 dbSNP
rs1200920718 1194 dbSNP
rs1294280402 1204 dbSNP
rs181117882 1209 dbSNP
rs2052585 1211 dbSNP
rs1487020275 1221 dbSNP
rs934134101 1224 dbSNP
rs1239746020 1236 dbSNP
rs922060571 1244 dbSNP
rs973485289 1245 dbSNP
rs1181192152 1257 dbSNP
rs963419338 1258 dbSNP
rs1444860434 1263 dbSNP
rs80274051 1264 dbSNP
rs941612861 1265 dbSNP
rs1289407085 1267 dbSNP
rs1004837816 1268 dbSNP
rs1450549696 1269 dbSNP
rs4788822 1278 dbSNP
rs1383870642 1279 dbSNP
rs1239708362 1280 dbSNP
rs1307266686 1283 dbSNP
rs528796006 1286 dbSNP
rs1216888698 1292 dbSNP
rs1001722434 1296 dbSNP
rs557777961 1297 dbSNP
rs1383306992 1299 dbSNP
rs1461331051 1305 dbSNP
rs1043228840 1306 dbSNP
rs927696872 1317 dbSNP
rs1405300691 1319 dbSNP
rs747733971 1329 dbSNP
rs891541412 1330 dbSNP
rs1021246035 1331 dbSNP
rs757773013 1337 dbSNP
rs1406927298 1342 dbSNP
rs150530680 1343 dbSNP
rs780402209 1350 dbSNP
rs1375770741 1363 dbSNP
rs943661246 1366 dbSNP
rs912487210 1369 dbSNP
rs549596965 1375 dbSNP
rs772623444 1378 dbSNP
rs1264231499 1381 dbSNP
rs1032990418 1390 dbSNP
rs1461405826 1390 dbSNP
rs1230873293 1393 dbSNP
rs1481406766 1400 dbSNP
rs1177626568 1404 dbSNP
rs1266420741 1412 dbSNP
rs1479293680 1421 dbSNP
rs546592124 1421 dbSNP
rs1429851091 1429 dbSNP
rs531159578 1442 dbSNP
rs919790468 1443 dbSNP
rs1356564738 1457 dbSNP
rs1443191454 1462 dbSNP
rs1293101831 1463 dbSNP
rs973869886 1464 dbSNP
rs963471667 1466 dbSNP
rs1317823961 1473 dbSNP
rs1213545335 1474 dbSNP
rs1270254766 1475 dbSNP
rs1308684145 1479 dbSNP
rs551054296 1484 dbSNP
rs907928430 1485 dbSNP
rs983426185 1487 dbSNP
rs1029744650 1493 dbSNP
rs1489804863 1496 dbSNP
rs563789933 1497 dbSNP
rs1260847830 1510 dbSNP
rs1477453113 1513 dbSNP
rs960286493 1519 dbSNP
rs1421759591 1520 dbSNP
rs200864174 1526 dbSNP
rs200321033 1528 dbSNP
rs3841347 1531 dbSNP
rs753954329 1531 dbSNP
rs75533396 1531 dbSNP
rs1037615917 1533 dbSNP
rs1363894924 1535 dbSNP
rs941591252 1537 dbSNP
rs1304103968 1542 dbSNP
rs538539194 1544 dbSNP
rs1055325474 1567 dbSNP
rs937663930 1572 dbSNP
rs1002215653 1574 dbSNP
rs1214595274 1578 dbSNP
rs1313987459 1580 dbSNP
rs377372976 1583 dbSNP
rs550300119 1583 dbSNP
rs1341608476 1597 dbSNP
rs981824098 1609 dbSNP
rs1292214369 1614 dbSNP
rs1487806363 1620 dbSNP
rs1213566746 1621 dbSNP
rs746224677 1624 dbSNP
rs1475797355 1628 dbSNP
rs1181333316 1639 dbSNP
rs10500560 1640 dbSNP
rs989738052 1644 dbSNP
rs1339067160 1649 dbSNP
rs1164383740 1653 dbSNP
rs1360290708 1658 dbSNP
rs1278055751 1668 dbSNP
rs141648584 1680 dbSNP
rs1320876921 1685 dbSNP
rs1011748452 1686 dbSNP
rs1346283360 1688 dbSNP
rs1401001800 1690 dbSNP
rs566999806 1691 dbSNP
rs757409840 1694 dbSNP
rs571243013 1695 dbSNP
rs1247735139 1700 dbSNP
rs559492684 1703 dbSNP
rs540097251 1714 dbSNP
rs1447485604 1721 dbSNP
rs1299682762 1728 dbSNP
rs1007913261 1732 dbSNP
rs986081024 1740 dbSNP
rs890811071 1741 dbSNP
rs1403225191 1742 dbSNP
rs954027268 1743 dbSNP
rs1389439723 1745 dbSNP
rs1163328320 1747 dbSNP
rs1029674237 1749 dbSNP
rs572791438 1751 dbSNP
rs1468968266 1763 dbSNP
rs1049392753 1764 dbSNP
rs932594913 1793 dbSNP
rs919843793 1797 dbSNP
rs549546523 1798 dbSNP
rs1409440985 1799 dbSNP
rs897246933 1800 dbSNP
rs1038171790 1801 dbSNP
rs1015737549 1806 dbSNP
rs1335247242 1812 dbSNP
rs778101640 1814 dbSNP
rs1454083306 1828 dbSNP
rs1337009822 1829 dbSNP
rs554490422 1832 dbSNP
rs369834753 1833 dbSNP
rs983917335 1844 dbSNP
rs938759692 1853 dbSNP
rs1219694200 1857 dbSNP
rs1261130220 1865 dbSNP
rs1325779894 1868 dbSNP
rs928653756 1876 dbSNP
rs906169752 1878 dbSNP
rs938304318 1878 dbSNP
rs1046053468 1880 dbSNP
rs1451244907 1885 dbSNP
rs1436287007 1886 dbSNP
rs1290749033 1887 dbSNP
rs575128746 1892 dbSNP
rs913623837 1903 dbSNP
rs1174949201 1907 dbSNP
rs1432022201 1909 dbSNP
rs1053570846 1910 dbSNP
rs1316066757 1916 dbSNP
rs970337037 1921 dbSNP
rs1021845395 1925 dbSNP
rs1219736450 1926 dbSNP
rs1330391093 1931 dbSNP
rs1467404321 1934 dbSNP
rs556981590 1936 dbSNP
rs1342832838 1937 dbSNP
rs990323654 1938 dbSNP
rs956162365 1941 dbSNP
rs1281353112 1942 dbSNP
rs148051052 1949 dbSNP
rs954620321 1951 dbSNP
rs1250817661 1953 dbSNP
rs538376021 1955 dbSNP
rs1008423749 1956 dbSNP
rs890872370 1957 dbSNP
rs1028446756 1958 dbSNP
rs996488604 1960 dbSNP
rs1197687619 1964 dbSNP
rs767560497 1967 dbSNP
rs898428887 1976 dbSNP
rs1323743608 1981 dbSNP
rs1481049278 1982 dbSNP
rs1406606475 1984 dbSNP
rs370135420 1985 dbSNP
rs1397439795 1995 dbSNP
rs922570587 1995 dbSNP
rs1169302983 1996 dbSNP
rs1038224030 2002 dbSNP
rs137873354 2004 dbSNP
rs1423811174 2005 dbSNP
rs961423231 2007 dbSNP
rs886964144 2008 dbSNP
rs146910671 2013 dbSNP
rs1056285719 2014 dbSNP
rs1405496527 2015 dbSNP
rs938796656 2024 dbSNP
rs1324795177 2028 dbSNP
rs534654449 2030 dbSNP
rs377747026 2031 dbSNP
rs980512541 2032 dbSNP
rs1466046027 2039 dbSNP
rs948665439 2043 dbSNP
rs751344057 2047 dbSNP
rs567940811 2050 dbSNP
rs144051733 2051 dbSNP
rs1260192925 2052 dbSNP
rs1426266937 2059 dbSNP
rs1247511949 2070 dbSNP
rs1194655213 2075 dbSNP
rs956263709 2079 dbSNP
rs1201234032 2089 dbSNP
rs1390474148 2091 dbSNP
rs1032291446 2106 dbSNP
rs986984277 2107 dbSNP
rs1456522231 2113 dbSNP
rs955305405 2115 dbSNP
rs759246098 2119 dbSNP
rs1367214004 2125 dbSNP
rs1458184897 2126 dbSNP
rs1028040823 2133 dbSNP
rs996483788 2135 dbSNP
rs774077387 2136 dbSNP
rs1382667958 2138 dbSNP
rs898144438 2139 dbSNP
rs1002375699 2142 dbSNP
rs1199870164 2145 dbSNP
rs531093398 2149 dbSNP
rs1016534831 2158 dbSNP
rs1277021879 2159 dbSNP
rs1004112328 2160 dbSNP
rs887016318 2164 dbSNP
rs1056737224 2170 dbSNP
rs1360642067 2171 dbSNP
rs1238748724 2175 dbSNP
rs1219021897 2186 dbSNP
rs1259522907 2186 dbSNP
rs189025866 2188 dbSNP
rs1206435038 2194 dbSNP
rs1046669708 2195 dbSNP
rs939159409 2199 dbSNP
rs2052586 2206 dbSNP
rs3057059 2206 dbSNP
rs138845616 2209 dbSNP
rs376939644 2209 dbSNP
rs764202414 2209 dbSNP
rs907288491 2209 dbSNP
rs1424231352 2212 dbSNP
rs1158067155 2213 dbSNP
rs1362061205 2213 dbSNP
rs1275094784 2214 dbSNP
rs1159745886 2217 dbSNP
rs1405452247 2226 dbSNP
rs1450471550 2228 dbSNP
rs1338996227 2233 dbSNP
rs1044457559 2238 dbSNP
rs1391244386 2242 dbSNP
rs1305288825 2252 dbSNP
rs551807330 2256 dbSNP
rs914606583 2262 dbSNP
rs1240393089 2263 dbSNP
rs1263020471 2266 dbSNP
rs1330084138 2267 dbSNP
rs1201208597 2279 dbSNP
rs766301056 2280 dbSNP
rs1483371887 2286 dbSNP
rs1176468957 2289 dbSNP
rs544240195 2299 dbSNP
rs1420589683 2303 dbSNP
rs868626895 2307 dbSNP
rs866854181 2308 dbSNP
rs1159864447 2313 dbSNP
rs1428483272 2314 dbSNP
rs1356218315 2319 dbSNP
rs533276211 2322 dbSNP
rs1360023289 2324 dbSNP
rs531377509 2327 dbSNP
rs1425551969 2332 dbSNP
rs1174586937 2333 dbSNP
rs1296598244 2335 dbSNP
rs1376023359 2353 dbSNP
rs375430328 2362 dbSNP
rs371053794 2363 dbSNP
rs1264447509 2364 dbSNP
rs1312206592 2369 dbSNP
rs559327188 2373 dbSNP
rs868258024 2379 dbSNP
rs567356082 2380 dbSNP
rs1236236775 2384 dbSNP
rs921033681 2385 dbSNP
rs972033544 2390 dbSNP
rs1479406890 2397 dbSNP
rs961666096 2401 dbSNP
rs1425963935 2406 dbSNP
rs1427952282 2409 dbSNP
rs975158534 2416 dbSNP
rs962421696 2417 dbSNP
rs1016587283 2421 dbSNP
rs1356474455 2430 dbSNP
rs1003829332 2433 dbSNP
rs951374733 2435 dbSNP
rs1034910130 2437 dbSNP
rs1302921464 2446 dbSNP
rs1209981913 2448 dbSNP
rs1003798704 2454 dbSNP
rs1407315257 2475 dbSNP
rs905001134 2479 dbSNP
rs1045289410 2481 dbSNP
rs1013040928 2485 dbSNP
rs1313204334 2486 dbSNP
rs1213430865 2490 dbSNP
rs1293042315 2494 dbSNP
rs908577999 2495 dbSNP
rs893223944 2503 dbSNP
rs74027275 2505 dbSNP
rs1489769755 2514 dbSNP
rs776269329 2515 dbSNP
rs952806774 2517 dbSNP
rs1033779439 2518 dbSNP
rs1240244063 2530 dbSNP
rs575365038 2545 dbSNP
rs1301032713 2546 dbSNP
rs934617240 2549 dbSNP
rs1359569255 2550 dbSNP
rs369387189 2553 dbSNP
rs1418165147 2554 dbSNP
rs1426887755 2561 dbSNP
rs1379933113 2563 dbSNP
rs1009861505 2566 dbSNP
rs1429492760 2569 dbSNP
rs193107988 2573 dbSNP
rs538684061 2589 dbSNP
rs746384000 2595 dbSNP
rs1228704016 2596 dbSNP
rs1313860400 2597 dbSNP
rs774645317 2600 dbSNP
rs1357050051 2605 dbSNP
rs1229789489 2607 dbSNP
rs769683492 2608 dbSNP
rs975543150 2609 dbSNP
rs1290567340 2616 dbSNP
rs1446343196 2622 dbSNP
rs747135861 2623 dbSNP
rs138485213 2627 dbSNP
rs1181830217 2628 dbSNP
rs1483861288 2629 dbSNP
rs1465354975 2630 dbSNP
rs1000591138 2638 dbSNP
rs909594603 2639 dbSNP
rs1214919806 2642 dbSNP
rs1488128578 2644 dbSNP
rs771258856 2652 dbSNP
rs1407984319 2655 dbSNP
rs749713908 2665 dbSNP
rs1399474301 2667 dbSNP
rs888888665 2671 dbSNP
rs1390235205 2688 dbSNP
rs1050193861 2696 dbSNP
rs951051003 2698 dbSNP
rs1035366653 2700 dbSNP
rs143788406 2701 dbSNP
rs1284564916 2706 dbSNP
rs1349597810 2712 dbSNP
rs969703238 2716 dbSNP
rs148974686 2718 dbSNP
rs567288302 2719 dbSNP
rs1010705070 2724 dbSNP
rs549670486 2733 dbSNP
rs1054517474 2734 dbSNP
rs777847030 2735 dbSNP
rs1359616803 2736 dbSNP
rs980856671 2737 dbSNP
rs1457357184 2741 dbSNP
rs1175070881 2742 dbSNP
rs970867467 2749 dbSNP
rs1299055547 2750 dbSNP
rs1334335895 2754 dbSNP
rs1025144557 2756 dbSNP
rs903209351 2761 dbSNP
rs1351004947 2763 dbSNP
rs1223058837 2766 dbSNP
rs1051523276 2768 dbSNP
rs1347148751 2769 dbSNP
rs1201271342 2774 dbSNP
rs1272514005 2776 dbSNP
rs1436472970 2778 dbSNP
rs1207715353 2784 dbSNP
rs1253240320 2789 dbSNP
rs7188675 2791 dbSNP
rs1197808166 2799 dbSNP
rs570193053 2802 dbSNP
rs532272356 2805 dbSNP
rs1375439836 2814 dbSNP
rs1478695412 2818 dbSNP
rs900079647 2823 dbSNP
rs1172827928 2836 dbSNP
rs1395274926 2840 dbSNP
rs1039847904 2844 dbSNP
rs1408044355 2846 dbSNP
rs941496987 2848 dbSNP
rs551674506 2867 dbSNP
rs772340083 2869 dbSNP
rs1404274547 2881 dbSNP
rs533620060 2883 dbSNP
rs1281248907 2887 dbSNP
rs754915153 2888 dbSNP
rs1000517440 2895 dbSNP
rs1348279349 2900 dbSNP
rs112778674 2915 dbSNP
rs982471397 2916 dbSNP
rs1337681132 2920 dbSNP
rs1231159172 2921 dbSNP
rs1275803884 2937 dbSNP
rs1424411966 2945 dbSNP
rs1220930240 2947 dbSNP
rs1420654817 2950 dbSNP
rs1270043709 2959 dbSNP
rs1192077224 2968 dbSNP
rs188880665 2981 dbSNP
rs1372200753 2986 dbSNP
rs1264314791 2993 dbSNP
rs927686532 2995 dbSNP
rs1216940647 3002 dbSNP
rs1028737075 3004 dbSNP
rs775690490 3012 dbSNP
rs1301262024 3015 dbSNP
rs751579619 3017 dbSNP
rs1486642221 3020 dbSNP
rs1387483469 3025 dbSNP
rs1263232802 3034 dbSNP
rs1220204443 3035 dbSNP
rs1317720283 3039 dbSNP
rs1324693472 3047 dbSNP
rs1321727548 3048 dbSNP
rs563050807 3053 dbSNP
rs766458851 3058 dbSNP
rs997303908 3062 dbSNP
rs185552540 3065 dbSNP
rs1216671331 3071 dbSNP
rs901632015 3087 dbSNP
rs1267801760 3091 dbSNP
rs1339639523 3094 dbSNP
rs1278602440 3096 dbSNP
rs1036205788 3098 dbSNP
rs1365772199 3099 dbSNP
rs1463126851 3102 dbSNP
rs543064609 3103 dbSNP
rs887717882 3111 dbSNP
rs957836787 3121 dbSNP
rs1162416983 3122 dbSNP
rs529213448 3123 dbSNP
rs1458350994 3127 dbSNP
rs1157868648 3128 dbSNP
rs778937405 3137 dbSNP
rs1030823483 3140 dbSNP
rs1382278269 3144 dbSNP
rs998979752 3144 dbSNP
rs750289498 3148 dbSNP
rs1029701036 3150 dbSNP
rs931306629 3152 dbSNP
rs769856682 3153 dbSNP
rs1259449572 3156 dbSNP
rs900099858 3158 dbSNP
rs561765738 3159 dbSNP
rs1039904466 3162 dbSNP
rs542465199 3166 dbSNP
rs888637226 3167 dbSNP
rs1258026870 3168 dbSNP
rs1465538291 3173 dbSNP
rs1424878446 3183 dbSNP
rs1047204821 3188 dbSNP
rs35357266 3188 dbSNP
rs988347165 3193 dbSNP
rs929781497 3201 dbSNP
rs1195765403 3205 dbSNP
rs957118545 3211 dbSNP
rs927665915 3227 dbSNP
rs1032580610 3230 dbSNP
rs981808603 3238 dbSNP
rs764792106 3239 dbSNP
rs865809079 3244 dbSNP
rs530722789 3248 dbSNP
rs1304762270 3254 dbSNP
rs1391152375 3263 dbSNP
rs192800110 3266 dbSNP
rs1352856366 3267 dbSNP
rs186739014 3269 dbSNP
rs8048170 3271 dbSNP
rs577805964 3283 dbSNP
rs376762594 3290 dbSNP
rs1196742611 3291 dbSNP
rs373136859 3292 dbSNP
rs887642030 3295 dbSNP
rs1030875502 3299 dbSNP
rs1194987919 3300 dbSNP
rs757661248 3301 dbSNP
rs1001410470 3303 dbSNP
rs1473527275 3305 dbSNP
rs1182725413 3307 dbSNP
rs553072930 3321 dbSNP
rs1045060220 3322 dbSNP
rs1178558270 3334 dbSNP
rs1229345009 3336 dbSNP
rs763613170 3339 dbSNP
rs1461848351 3342 dbSNP
rs989353212 3347 dbSNP
rs1310173890 3349 dbSNP
rs1372725282 3351 dbSNP
rs182746829 3351 dbSNP
rs1030123735 3353 dbSNP
rs935502661 3353 dbSNP
rs1373334885 3360 dbSNP
rs1312393738 3365 dbSNP
rs1329395598 3369 dbSNP
rs1272210905 3376 dbSNP
rs749574273 3386 dbSNP
rs998207664 3394 dbSNP
rs1483887802 3398 dbSNP
rs573633579 3400 dbSNP
rs759993229 3404 dbSNP
rs1268060732 3408 dbSNP
rs1018211798 3409 dbSNP
rs371307146 3410 dbSNP
rs1401683552 3415 dbSNP
rs1426224060 3417 dbSNP
rs1428147513 3423 dbSNP
rs1166886732 3435 dbSNP
rs1170083325 3454 dbSNP
rs1430756560 3459 dbSNP
rs1303120625 3466 dbSNP
rs1464887087 3470 dbSNP
rs1348623133 3482 dbSNP
rs555412572 3484 dbSNP
rs1005786985 3486 dbSNP
rs888697570 3487 dbSNP
rs1294900056 3499 dbSNP
rs1344096875 3500 dbSNP
rs921568339 3503 dbSNP
rs1289136011 3505 dbSNP
rs1396420548 3510 dbSNP
rs537090712 3523 dbSNP
rs994709501 3524 dbSNP
rs570248912 3528 dbSNP
rs1485557482 3532 dbSNP
rs1186940573 3538 dbSNP
rs774821139 3551 dbSNP
rs1014663111 3558 dbSNP
rs1450535076 3588 dbSNP
rs1058747 3589 dbSNP
rs1412345251 3594 dbSNP
rs1407577560 3595 dbSNP
rs1482178963 3601 dbSNP
rs951874005 3608 dbSNP
rs1255159945 3618 dbSNP
rs1318195456 3623 dbSNP
rs539629117 3624 dbSNP
rs566277527 3628 dbSNP
rs936610108 3632 dbSNP
rs1376627536 3642 dbSNP
rs547456085 3643 dbSNP
rs1290454032 3648 dbSNP
rs1377692083 3649 dbSNP
rs905808566 3650 dbSNP
rs923813224 3658 dbSNP
rs1013577332 3659 dbSNP
rs1183144076 3665 dbSNP
rs977957022 3666 dbSNP
rs896515241 3682 dbSNP
rs1052526299 3684 dbSNP
rs1394778598 3697 dbSNP
rs1407868640 3699 dbSNP
rs1472014303 3706 dbSNP
rs190099911 3711 dbSNP
rs1401994158 3718 dbSNP
rs935414966 3728 dbSNP
rs1058750 3736 dbSNP
rs1333041976 3737 dbSNP
rs1357245510 3739 dbSNP
rs1449915500 3741 dbSNP
rs1284756990 3742 dbSNP
rs922728216 3745 dbSNP
rs1043930324 3747 dbSNP
rs1290292789 3749 dbSNP
rs1340199271 3761 dbSNP
rs11670 3766 dbSNP
rs1200112576 3770 dbSNP
rs8062948 3770 dbSNP
rs976769586 3771 dbSNP
rs1018263936 3777 dbSNP
rs748425699 3778 dbSNP
rs1211253189 3782 dbSNP
rs1005471199 3790 dbSNP
rs907535874 3791 dbSNP
rs1183947457 3796 dbSNP
rs1413562093 3800 dbSNP
rs952974890 3803 dbSNP
rs951900958 3805 dbSNP
rs1422589992 3807 dbSNP
rs1027423806 3808 dbSNP
rs1026287519 3814 dbSNP
rs994365486 3816 dbSNP
rs747753393 3826 dbSNP
rs906720716 3827 dbSNP
rs1211355188 3837 dbSNP
rs1369640790 3839 dbSNP
rs549014017 3847 dbSNP
rs1309719045 3848 dbSNP
rs1351215649 3854 dbSNP
rs572250314 3856 dbSNP
rs781380944 3857 dbSNP
rs1273356947 3858 dbSNP
rs8203 3861 dbSNP
rs1219970161 3865 dbSNP
rs1274389730 3875 dbSNP
rs1216104070 3879 dbSNP
rs1482250750 3889 dbSNP
rs374882737 3892 dbSNP
rs1207963633 3894 dbSNP
rs747133258 3895 dbSNP
rs1053450219 3897 dbSNP
rs1197533711 3908 dbSNP
rs780124031 3911 dbSNP
rs1340410391 3912 dbSNP
rs923890737 3913 dbSNP
rs1389340745 3923 dbSNP
rs1042673017 3926 dbSNP
rs1031426770 3931 dbSNP
rs1371076993 3932 dbSNP
rs74027273 3933 dbSNP
rs1358966265 3936 dbSNP
rs923125899 3943 dbSNP
rs559592459 3946 dbSNP
rs1296010382 3949 dbSNP
rs539460193 3950 dbSNP
rs964100124 3954 dbSNP
rs1297093707 3959 dbSNP
rs573771905 3961 dbSNP
rs145778348 3966 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                ::| ||  ||||||| 
Target 5' uucucuUUACUAGUUGCUGCUg 3'
2 - 23
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000568954.1 | 3UTR | AUUCUCUUUACUAGUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.698 3.1e-4 0.839 1.9e-6 20 Click to see details
GSE21032 Prostate cancer 0.281 5.0e-3 0.282 4.9e-3 83 Click to see details
GSE17498 Multiple myeloma 0.326 2.0e-2 0.360 1.1e-2 40 Click to see details
GSE28260 Renal cortex and medulla -0.483 4.7e-2 -0.368 1.1e-1 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.356 4.8e-2 0.422 2.2e-2 23 Click to see details
GSE21849 B cell lymphoma 0.224 1.2e-1 0.044 4.1e-1 29 Click to see details
GSE21687 Ependynoma primary tumors -0.147 1.2e-1 -0.019 4.4e-1 64 Click to see details
GSE32688 Pancreatic cancer 0.195 1.4e-1 0.323 3.6e-2 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.211 1.6e-1 -0.307 6.8e-2 25 Click to see details
GSE27834 Pluripotent stem cells -0.269 1.6e-1 -0.124 3.2e-1 16 Click to see details
GSE28544 Breast cancer -0.195 1.8e-1 -0.317 6.6e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.192 2.1e-1 -0.194 2.1e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.116 2.9e-1 0.208 1.6e-1 24 Click to see details
GSE14794 Lymphoblastoid cells -0.057 3.0e-1 -0.025 4.1e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.125 3.5e-1 -0.112 3.6e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.075 3.6e-1 0.022 4.6e-1 25 Click to see details
GSE38226 Liver fibrosis -0.061 4.0e-1 0.151 2.6e-1 21 Click to see details
GSE17306 Multiple myeloma 0.022 4.4e-1 -0.011 4.7e-1 49 Click to see details
GSE19783 ER- ER- breast cancer 0.01 4.7e-1 -0.058 3.1e-1 79 Click to see details
GSE19536 Breast cancer -0.006 4.8e-1 -0.062 2.7e-1 100 Click to see details
GSE19536 Breast cancer -0.006 4.8e-1 -0.062 2.7e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.367 0.01 -0.384 0.01 42 Click to see details
THCA -0.279 0.02 -0.313 0.01 59 Click to see details
BLCA -0.455 0.03 -0.459 0.03 18 Click to see details
LUAD 0.503 0.05 0.531 0.04 12 Click to see details
CHOL -0.542 0.07 -0.533 0.07 9 Click to see details
COAD -0.559 0.07 -0.476 0.12 8 Click to see details
KIRP -0.17 0.18 -0.279 0.06 32 Click to see details
PAAD 0.609 0.2 0.400 0.3 4 Click to see details
PRAD -0.119 0.21 -0.117 0.21 50 Click to see details
LUSC -0.136 0.21 -0.118 0.24 38 Click to see details
KICH 0.165 0.22 0.089 0.34 25 Click to see details
KIRC 0.097 0.22 0.123 0.16 68 Click to see details
UCEC 0.159 0.26 0.042 0.43 19 Click to see details
ESCA 0.21 0.27 0.182 0.3 11 Click to see details
LIHC 0.069 0.32 0.096 0.26 49 Click to see details
STAD 0.078 0.34 0.120 0.26 32 Click to see details
BRCA -0.04 0.36 -0.044 0.35 84 Click to see details
CESC -0.228 0.43 -0.500 0.33 3 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8