miRTarBase - #MIRT544916 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CLSPN   
Synonyms -
Description claspin
Transcript NM_001190481   
Other Transcripts NM_022111   
Putative miRNA Targets on CLSPN
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            ::||::| | | ||||||| 
1179 - 1200 160.00 -9.50
            | :| ||| | |||||||| 
1602 - 1622 159.00 -14.40
            :||||::  | | ||||||  
2349 - 2371 136.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31613467 3 COSMIC
COSN31564833 7 COSMIC
COSN31495347 65 COSMIC
COSN30473873 80 COSMIC
COSN30113233 133 COSMIC
COSN6034681 160 COSMIC
COSN31568839 165 COSMIC
COSN30470292 173 COSMIC
COSN31557933 182 COSMIC
COSN30159918 184 COSMIC
COSN30172111 215 COSMIC
COSN19365865 260 COSMIC
COSN23285871 269 COSMIC
COSN17227272 581 COSMIC
COSN9025836 753 COSMIC
COSN10047850 981 COSMIC
COSN23191162 1551 COSMIC
COSN6034680 1643 COSMIC
COSN10047849 1672 COSMIC
COSN28051359 1768 COSMIC
COSN24336060 1790 COSMIC
COSN23796157 1990 COSMIC
COSN21133949 2099 COSMIC
COSN26461359 2227 COSMIC
COSN5371410 2581 COSMIC
COSN26680512 2655 COSMIC
COSN23724864 3170 COSMIC
COSN29070284 3176 COSMIC
COSN22741159 3367 COSMIC
COSN22590627 3382 COSMIC
COSN17472412 3765 COSMIC
COSN17876760 3831 COSMIC
COSN18238275 3843 COSMIC
COSN6034679 3896 COSMIC
COSN20722196 4361 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1222265767 5 dbSNP
rs375903787 6 dbSNP
rs1288807994 12 dbSNP
rs565552761 15 dbSNP
rs1350771665 18 dbSNP
rs1159063049 21 dbSNP
rs763397781 26 dbSNP
rs773325926 32 dbSNP
rs1439554757 34 dbSNP
rs371300587 36 dbSNP
rs748383467 38 dbSNP
rs992181994 39 dbSNP
rs1404144526 40 dbSNP
rs781491936 50 dbSNP
rs112552223 51 dbSNP
rs1180008786 52 dbSNP
rs1437446163 62 dbSNP
rs1352614911 67 dbSNP
rs749921795 71 dbSNP
rs1487809580 74 dbSNP
rs964279392 89 dbSNP
rs192809591 100 dbSNP
rs78523522 102 dbSNP
rs1356217059 104 dbSNP
rs1015029236 107 dbSNP
rs1239671978 110 dbSNP
rs1307529832 113 dbSNP
rs1237956864 127 dbSNP
rs1331305653 134 dbSNP
rs1006700281 137 dbSNP
rs1372054166 139 dbSNP
rs1328001869 149 dbSNP
rs760478426 150 dbSNP
rs887975208 154 dbSNP
rs1157758157 160 dbSNP
rs1349753092 165 dbSNP
rs764708283 167 dbSNP
rs532732031 170 dbSNP
rs996261073 173 dbSNP
rs999618745 177 dbSNP
rs1402760296 182 dbSNP
rs906576949 185 dbSNP
rs1024994943 199 dbSNP
rs1489550522 203 dbSNP
rs1284388862 205 dbSNP
rs1406269778 218 dbSNP
rs1012230535 223 dbSNP
rs1276205935 229 dbSNP
rs1230441107 230 dbSNP
rs1344389869 235 dbSNP
rs1278260402 238 dbSNP
rs902111601 246 dbSNP
rs1338294536 254 dbSNP
rs895129432 263 dbSNP
rs1414773175 272 dbSNP
rs1395371241 277 dbSNP
rs1055751717 278 dbSNP
rs1192951877 278 dbSNP
rs1208436744 278 dbSNP
rs1428755210 278 dbSNP
rs766839954 278 dbSNP
rs80209680 278 dbSNP
rs941269460 278 dbSNP
rs1194942344 280 dbSNP
rs76829482 282 dbSNP
rs888327486 285 dbSNP
rs1443283997 293 dbSNP
rs1281158523 295 dbSNP
rs1040998284 296 dbSNP
rs1476761775 299 dbSNP
rs1201448354 307 dbSNP
rs1322371207 311 dbSNP
rs571863443 316 dbSNP
rs145987306 317 dbSNP
rs1448717878 321 dbSNP
rs149381331 322 dbSNP
rs929753495 328 dbSNP
rs543159373 329 dbSNP
rs188300886 330 dbSNP
rs1331937063 334 dbSNP
rs1040749603 338 dbSNP
rs1287651703 341 dbSNP
rs942397258 343 dbSNP
rs138774266 346 dbSNP
rs1467208722 347 dbSNP
rs989730139 351 dbSNP
rs541302349 354 dbSNP
rs1052218073 355 dbSNP
rs552080075 363 dbSNP
rs1305918440 368 dbSNP
rs958491215 373 dbSNP
rs924140705 384 dbSNP
rs764709815 385 dbSNP
rs558326298 386 dbSNP
rs980605981 395 dbSNP
rs150212867 405 dbSNP
rs1228878969 406 dbSNP
rs528674164 415 dbSNP
rs182540073 417 dbSNP
rs554208354 418 dbSNP
rs148086568 442 dbSNP
rs1449269396 445 dbSNP
rs1435789176 447 dbSNP
rs559936651 448 dbSNP
rs1175162933 449 dbSNP
rs746125383 450 dbSNP
rs1423834096 452 dbSNP
rs888329473 453 dbSNP
rs1444330439 454 dbSNP
rs375328292 463 dbSNP
rs1180196193 464 dbSNP
rs371371879 472 dbSNP
rs1231861998 479 dbSNP
rs774476657 492 dbSNP
rs1453290567 496 dbSNP
rs553530855 500 dbSNP
rs189925066 509 dbSNP
rs1485880205 512 dbSNP
rs1354073244 513 dbSNP
rs996313623 517 dbSNP
rs1040805764 520 dbSNP
rs1225731524 525 dbSNP
rs901995400 537 dbSNP
rs1437221240 539 dbSNP
rs1208308866 540 dbSNP
rs1352134935 543 dbSNP
rs1053829218 552 dbSNP
rs1311880072 556 dbSNP
rs1273765978 558 dbSNP
rs760022362 562 dbSNP
rs1216468421 564 dbSNP
rs936952169 568 dbSNP
rs1339066952 571 dbSNP
rs1019215773 573 dbSNP
rs924165610 588 dbSNP
rs1406741496 596 dbSNP
rs1191293367 601 dbSNP
rs1010890616 608 dbSNP
rs892162483 617 dbSNP
rs1198671379 619 dbSNP
rs1052526777 623 dbSNP
rs1287942257 627 dbSNP
rs770983651 629 dbSNP
rs571924483 641 dbSNP
rs936284585 650 dbSNP
rs1464207734 652 dbSNP
rs1358285700 661 dbSNP
rs903616238 662 dbSNP
rs1170518769 665 dbSNP
rs1411169660 666 dbSNP
rs1044810464 667 dbSNP
rs1404932987 670 dbSNP
rs1016283527 675 dbSNP
rs1291032210 682 dbSNP
rs947889319 687 dbSNP
rs950726663 702 dbSNP
rs1415820646 703 dbSNP
rs550506733 710 dbSNP
rs531908817 711 dbSNP
rs1478123292 714 dbSNP
rs567881746 719 dbSNP
rs549435701 728 dbSNP
rs1184572869 729 dbSNP
rs907909003 733 dbSNP
rs1237832726 735 dbSNP
rs985204401 736 dbSNP
rs952018078 739 dbSNP
rs922037348 740 dbSNP
rs1222941321 741 dbSNP
rs1233720476 743 dbSNP
rs1062047 749 dbSNP
rs1319245447 750 dbSNP
rs974778846 757 dbSNP
rs1206638897 760 dbSNP
rs527816471 761 dbSNP
rs1019521084 762 dbSNP
rs1006602938 772 dbSNP
rs1234418431 773 dbSNP
rs889504192 777 dbSNP
rs1010524549 778 dbSNP
rs186895712 779 dbSNP
rs1053475208 780 dbSNP
rs1168310817 782 dbSNP
rs1377919226 782 dbSNP
rs956490930 784 dbSNP
rs77242716 789 dbSNP
rs1298400927 790 dbSNP
rs1183357464 791 dbSNP
rs1414308361 791 dbSNP
rs879289482 791 dbSNP
rs61776919 799 dbSNP
rs1462842136 814 dbSNP
rs1241482958 815 dbSNP
rs1448303118 816 dbSNP
rs1397528985 817 dbSNP
rs1203116634 824 dbSNP
rs1330153656 831 dbSNP
rs1033233099 832 dbSNP
rs1225957093 834 dbSNP
rs936357783 835 dbSNP
rs1461866173 836 dbSNP
rs1370189605 839 dbSNP
rs1248574533 840 dbSNP
rs902164986 846 dbSNP
rs560528282 847 dbSNP
rs1423037458 857 dbSNP
rs545118754 858 dbSNP
rs533364241 859 dbSNP
rs1398094520 863 dbSNP
rs903498688 864 dbSNP
rs949615794 868 dbSNP
rs918094487 878 dbSNP
rs113039854 881 dbSNP
rs1011990559 899 dbSNP
rs543325845 906 dbSNP
rs1383629286 939 dbSNP
rs749375140 950 dbSNP
rs191223979 952 dbSNP
rs1214474900 954 dbSNP
rs1440542884 957 dbSNP
rs1252818043 959 dbSNP
rs1470209605 960 dbSNP
rs1264219150 964 dbSNP
rs1244438685 965 dbSNP
rs1194104953 985 dbSNP
rs1317932582 990 dbSNP
rs1266482747 991 dbSNP
rs1225206100 994 dbSNP
rs1357817227 1001 dbSNP
rs1056698865 1009 dbSNP
rs1307200335 1012 dbSNP
rs1241839135 1014 dbSNP
rs1314790684 1015 dbSNP
rs938092970 1019 dbSNP
rs1337139049 1025 dbSNP
rs772609490 1027 dbSNP
rs1304257313 1034 dbSNP
rs575801090 1041 dbSNP
rs1390271741 1051 dbSNP
rs768605463 1056 dbSNP
rs1304816150 1071 dbSNP
rs554368177 1078 dbSNP
rs147115513 1079 dbSNP
rs1374246831 1081 dbSNP
rs1454527037 1091 dbSNP
rs1048942666 1100 dbSNP
rs930667876 1109 dbSNP
rs1330085929 1111 dbSNP
rs746770195 1130 dbSNP
rs373701877 1131 dbSNP
rs1392715821 1135 dbSNP
rs1489994249 1140 dbSNP
rs974831096 1141 dbSNP
rs1457182171 1142 dbSNP
rs1345546379 1153 dbSNP
rs779758263 1161 dbSNP
rs911939609 1162 dbSNP
rs1258512509 1170 dbSNP
rs989394820 1172 dbSNP
rs372801274 1182 dbSNP
rs771560539 1190 dbSNP
rs550829367 1191 dbSNP
rs1331235865 1203 dbSNP
rs1379986634 1207 dbSNP
rs1194277503 1208 dbSNP
rs973062558 1218 dbSNP
rs956206825 1221 dbSNP
rs1033700360 1246 dbSNP
rs1298619018 1258 dbSNP
rs1402165823 1260 dbSNP
rs1157109444 1263 dbSNP
rs1453319547 1265 dbSNP
rs1430121221 1269 dbSNP
rs369967460 1270 dbSNP
rs1479755477 1273 dbSNP
rs1268748873 1274 dbSNP
rs1019418659 1276 dbSNP
rs6660890 1276 dbSNP
rs1260066938 1287 dbSNP
rs1023299933 1290 dbSNP
rs1204247160 1296 dbSNP
rs529299397 1310 dbSNP
rs1345241756 1318 dbSNP
rs7530222 1319 dbSNP
rs1209795761 1323 dbSNP
rs1486506795 1337 dbSNP
rs1322743167 1339 dbSNP
rs1278703490 1345 dbSNP
rs1262831871 1346 dbSNP
rs1432797868 1359 dbSNP
rs529078895 1363 dbSNP
rs896227880 1364 dbSNP
rs1056188788 1373 dbSNP
rs1407047895 1385 dbSNP
rs902217727 1393 dbSNP
rs1468236417 1412 dbSNP
rs1308090813 1416 dbSNP
rs1234291978 1417 dbSNP
rs1169054992 1420 dbSNP
rs1476670623 1423 dbSNP
rs1332345798 1425 dbSNP
rs1371738568 1427 dbSNP
rs1005142005 1429 dbSNP
rs141817844 1431 dbSNP
rs1048995448 1434 dbSNP
rs1461517812 1443 dbSNP
rs1386117188 1455 dbSNP
rs571280600 1457 dbSNP
rs1460536913 1464 dbSNP
rs896713949 1471 dbSNP
rs1216299417 1483 dbSNP
rs1299797728 1486 dbSNP
rs930553043 1493 dbSNP
rs1417646655 1495 dbSNP
rs1360063028 1518 dbSNP
rs1383806654 1521 dbSNP
rs1174533240 1530 dbSNP
rs1467607018 1533 dbSNP
rs778629066 1534 dbSNP
rs1405522633 1537 dbSNP
rs1198296384 1544 dbSNP
rs1039011274 1547 dbSNP
rs944687826 1551 dbSNP
rs1394901027 1555 dbSNP
rs1167706503 1559 dbSNP
rs756765732 1564 dbSNP
rs543374930 1567 dbSNP
rs753418511 1584 dbSNP
rs929367384 1587 dbSNP
rs988890451 1597 dbSNP
rs1443599983 1602 dbSNP
rs934849749 1605 dbSNP
rs1488168645 1606 dbSNP
rs976026270 1611 dbSNP
rs1284812559 1614 dbSNP
rs965283094 1621 dbSNP
rs926099024 1624 dbSNP
rs111674418 1625 dbSNP
rs970296199 1637 dbSNP
rs985331040 1638 dbSNP
rs1231970061 1656 dbSNP
rs1312638191 1672 dbSNP
rs1244105243 1673 dbSNP
rs1382276665 1689 dbSNP
rs1307950385 1691 dbSNP
rs751972732 1692 dbSNP
rs1397866698 1693 dbSNP
rs1334528507 1699 dbSNP
rs954048781 1706 dbSNP
rs609070 1707 dbSNP
rs1397972637 1715 dbSNP
rs1001026925 1716 dbSNP
rs990493766 1718 dbSNP
rs1423632167 1738 dbSNP
rs1408214194 1739 dbSNP
rs761303151 1743 dbSNP
rs1178435857 1751 dbSNP
rs1468105222 1753 dbSNP
rs1231801353 1766 dbSNP
rs1400416110 1769 dbSNP
rs1172054528 1773 dbSNP
rs1021056152 1778 dbSNP
rs1221392036 1782 dbSNP
rs1462575033 1783 dbSNP
rs1426324256 1784 dbSNP
rs1285153845 1789 dbSNP
rs1348720140 1790 dbSNP
rs778519048 1790 dbSNP
rs1347889030 1795 dbSNP
rs1406148768 1795 dbSNP
rs1169197719 1797 dbSNP
rs1477670191 1800 dbSNP
rs1356786422 1801 dbSNP
rs1345431988 1804 dbSNP
rs1025569950 1805 dbSNP
rs1398588768 1806 dbSNP
rs745810715 1806 dbSNP
rs762025593 1806 dbSNP
rs754662734 1807 dbSNP
rs1176490750 1808 dbSNP
rs761823903 1808 dbSNP
rs1198441248 1809 dbSNP
rs1266631609 1809 dbSNP
rs1013237281 1810 dbSNP
rs1243632979 1810 dbSNP
rs1486107512 1810 dbSNP
rs1224157945 1812 dbSNP
rs1326287076 1816 dbSNP
rs1281865997 1819 dbSNP
rs201129964 1819 dbSNP
rs71062891 1819 dbSNP
rs1306395381 1820 dbSNP
rs1363355882 1820 dbSNP
rs1258625191 1823 dbSNP
rs1190135501 1827 dbSNP
rs1443775883 1831 dbSNP
rs1426578587 1857 dbSNP
rs620296 1863 dbSNP
rs186998662 1864 dbSNP
rs1339524603 1866 dbSNP
rs1421456106 1869 dbSNP
rs1259861284 1870 dbSNP
rs1485035154 1881 dbSNP
rs1216701956 1886 dbSNP
rs1002453228 1887 dbSNP
rs960379048 1890 dbSNP
rs1210078801 1897 dbSNP
rs534295675 1902 dbSNP
rs1049194678 1905 dbSNP
rs1338860354 1911 dbSNP
rs1035205731 1914 dbSNP
rs1004622535 1915 dbSNP
rs1454244546 1928 dbSNP
rs1391996761 1933 dbSNP
rs1403323780 1935 dbSNP
rs144795256 1951 dbSNP
rs767828773 1965 dbSNP
rs551861142 1973 dbSNP
rs1027440485 1983 dbSNP
rs919325671 1984 dbSNP
rs1329447151 1987 dbSNP
rs994587918 1995 dbSNP
rs1427644625 1996 dbSNP
rs866181753 1999 dbSNP
rs1385617938 2000 dbSNP
rs182021554 2006 dbSNP
rs1446637767 2010 dbSNP
rs1038901000 2014 dbSNP
rs1199891606 2017 dbSNP
rs944725737 2019 dbSNP
rs890444769 2025 dbSNP
rs1053642706 2027 dbSNP
rs934755586 2045 dbSNP
rs926149950 2046 dbSNP
rs553161987 2050 dbSNP
rs1247785258 2051 dbSNP
rs1380063711 2060 dbSNP
rs1311428463 2064 dbSNP
rs149185937 2077 dbSNP
rs985383408 2083 dbSNP
rs1429021669 2088 dbSNP
rs1366002679 2094 dbSNP
rs916183720 2095 dbSNP
rs993077200 2098 dbSNP
rs1457975514 2115 dbSNP
rs144966764 2133 dbSNP
rs1034682649 2135 dbSNP
rs983644131 2139 dbSNP
rs531543278 2140 dbSNP
rs149902726 2148 dbSNP
rs774371380 2149 dbSNP
rs1252735509 2159 dbSNP
rs925117620 2161 dbSNP
rs1483004851 2162 dbSNP
rs1457250837 2166 dbSNP
rs1270084208 2188 dbSNP
rs1027323558 2189 dbSNP
rs1225133949 2193 dbSNP
rs1356829918 2197 dbSNP
rs1264439368 2205 dbSNP
rs1239302840 2210 dbSNP
rs577647109 2212 dbSNP
rs542413181 2214 dbSNP
rs572217117 2222 dbSNP
rs900323426 2225 dbSNP
rs1211340147 2228 dbSNP
rs1017500529 2229 dbSNP
rs1354031538 2234 dbSNP
rs1283766994 2241 dbSNP
rs1304760433 2249 dbSNP
rs780036831 2255 dbSNP
rs1008804582 2265 dbSNP
rs1402794260 2279 dbSNP
rs35253145 2317 dbSNP
rs890488385 2319 dbSNP
rs1053123589 2322 dbSNP
rs999224258 2327 dbSNP
rs1454476347 2337 dbSNP
rs1379444743 2344 dbSNP
rs966882886 2357 dbSNP
rs1020743372 2358 dbSNP
rs1446149617 2367 dbSNP
rs1013331783 2369 dbSNP
rs539123596 2371 dbSNP
rs146650981 2374 dbSNP
rs1205395445 2380 dbSNP
rs1486629678 2381 dbSNP
rs1258457407 2394 dbSNP
rs1002463333 2397 dbSNP
rs1324187138 2404 dbSNP
rs1285049054 2405 dbSNP
rs1221595904 2410 dbSNP
rs948889398 2412 dbSNP
rs1330367344 2417 dbSNP
rs1318705588 2428 dbSNP
rs536705820 2434 dbSNP
rs1383017387 2440 dbSNP
rs143494039 2449 dbSNP
rs1318628074 2459 dbSNP
rs1057513144 2461 dbSNP
rs1381840553 2463 dbSNP
rs1179295986 2471 dbSNP
rs115417360 2481 dbSNP
rs571585785 2492 dbSNP
rs1477307439 2502 dbSNP
rs139953459 2508 dbSNP
rs897976524 2522 dbSNP
rs773313900 2526 dbSNP
rs1438540856 2538 dbSNP
rs1194285406 2544 dbSNP
rs1429961559 2556 dbSNP
rs538529146 2563 dbSNP
rs1207567712 2568 dbSNP
rs1461422575 2575 dbSNP
rs1264450487 2579 dbSNP
rs1201750312 2582 dbSNP
rs1040469937 2583 dbSNP
rs1270586768 2584 dbSNP
rs944791632 2586 dbSNP
rs768552473 2587 dbSNP
rs1328441540 2592 dbSNP
rs1295751614 2593 dbSNP
rs574432329 2598 dbSNP
rs1406977348 2600 dbSNP
rs1338756068 2602 dbSNP
rs1223706024 2619 dbSNP
rs556027672 2636 dbSNP
rs910556657 2638 dbSNP
rs534090608 2647 dbSNP
rs1476558850 2650 dbSNP
rs1388688944 2653 dbSNP
rs1187609132 2654 dbSNP
rs375988658 2655 dbSNP
rs1184732922 2665 dbSNP
rs897846705 2669 dbSNP
rs1273559563 2682 dbSNP
rs551553647 2695 dbSNP
rs539571350 2696 dbSNP
rs57220608 2698 dbSNP
rs973109781 2704 dbSNP
rs979742650 2713 dbSNP
rs191456058 2715 dbSNP
rs370462989 2717 dbSNP
rs529255860 2729 dbSNP
rs746973000 2730 dbSNP
rs560986407 2740 dbSNP
rs186653891 2756 dbSNP
rs779890645 2758 dbSNP
rs1369136826 2764 dbSNP
rs1168304091 2773 dbSNP
rs1424939797 2774 dbSNP
rs1386640293 2775 dbSNP
rs527467577 2786 dbSNP
rs11264195 2789 dbSNP
rs1472211900 2791 dbSNP
rs1183956285 2805 dbSNP
rs1482020963 2807 dbSNP
rs1250827884 2814 dbSNP
rs757325593 2819 dbSNP
rs1360442929 2825 dbSNP
rs1292221080 2835 dbSNP
rs1421916398 2836 dbSNP
rs1355811027 2841 dbSNP
rs1043191778 2846 dbSNP
rs1263860863 2850 dbSNP
rs1012997513 2856 dbSNP
rs894686177 2858 dbSNP
rs1405875984 2871 dbSNP
rs1057301345 2878 dbSNP
rs1033357687 2882 dbSNP
rs1001853238 2889 dbSNP
rs1361988494 2892 dbSNP
rs1027935939 2894 dbSNP
rs562040201 2894 dbSNP
rs938813199 2901 dbSNP
rs994148906 2903 dbSNP
rs908805116 2906 dbSNP
rs1418508117 2923 dbSNP
rs1019032615 2925 dbSNP
rs573065494 2935 dbSNP
rs1244756383 2937 dbSNP
rs146005131 2948 dbSNP
rs1451227345 2955 dbSNP
rs1285086492 2956 dbSNP
rs1230236314 2958 dbSNP
rs562463913 2959 dbSNP
rs1288338038 2964 dbSNP
rs1246068794 2971 dbSNP
rs181291808 2973 dbSNP
rs936041699 2978 dbSNP
rs1435337547 2980 dbSNP
rs973163570 2984 dbSNP
rs1319721363 2986 dbSNP
rs1455132677 2991 dbSNP
rs1261241511 2992 dbSNP
rs1043685019 2994 dbSNP
rs1177145073 2994 dbSNP
rs1216141038 3003 dbSNP
rs1313044378 3006 dbSNP
rs964429097 3008 dbSNP
rs1190360450 3016 dbSNP
rs1477827118 3018 dbSNP
rs573590633 3029 dbSNP
rs1280825727 3038 dbSNP
rs555749534 3044 dbSNP
rs1210811013 3059 dbSNP
rs987330399 3060 dbSNP
rs376892752 3061 dbSNP
rs939100845 3070 dbSNP
rs1031607491 3078 dbSNP
rs573333270 3081 dbSNP
rs977322975 3086 dbSNP
rs1298023005 3093 dbSNP
rs968739350 3096 dbSNP
rs1299438955 3105 dbSNP
rs1398972317 3112 dbSNP
rs1432434516 3121 dbSNP
rs141747656 3134 dbSNP
rs980916574 3135 dbSNP
rs942146927 3139 dbSNP
rs889195605 3149 dbSNP
rs1051070918 3156 dbSNP
rs1412266658 3158 dbSNP
rs1424328688 3159 dbSNP
rs57561208 3159 dbSNP
rs1027731635 3165 dbSNP
rs1190794874 3166 dbSNP
rs972346197 3168 dbSNP
rs1478792542 3169 dbSNP
rs77749164 3170 dbSNP
rs1019084955 3171 dbSNP
rs202083923 3171 dbSNP
rs1008998207 3172 dbSNP
rs1308512622 3172 dbSNP
rs1192759854 3173 dbSNP
rs1225784405 3173 dbSNP
rs1315176979 3174 dbSNP
rs1222789867 3176 dbSNP
rs1284565821 3176 dbSNP
rs1302263117 3176 dbSNP
rs1372236828 3176 dbSNP
rs1376329048 3176 dbSNP
rs1442797121 3176 dbSNP
rs369315983 3176 dbSNP
rs1029110617 3177 dbSNP
rs1000683595 3180 dbSNP
rs1021632345 3180 dbSNP
rs904523909 3181 dbSNP
rs1042075437 3182 dbSNP
rs539533419 3183 dbSNP
rs1259207060 3185 dbSNP
rs1220980024 3186 dbSNP
rs1246528175 3187 dbSNP
rs1489292481 3187 dbSNP
rs988403797 3187 dbSNP
rs1224296949 3193 dbSNP
rs1352216543 3194 dbSNP
rs1012882790 3195 dbSNP
rs568965996 3196 dbSNP
rs1305962480 3202 dbSNP
rs1408928438 3206 dbSNP
rs1365945865 3207 dbSNP
rs1294403243 3210 dbSNP
rs758896720 3212 dbSNP
rs188488296 3213 dbSNP
rs535426247 3215 dbSNP
rs1164112345 3217 dbSNP
rs373621945 3231 dbSNP
rs144306073 3236 dbSNP
rs527617715 3237 dbSNP
rs1180635539 3260 dbSNP
rs1003060172 3265 dbSNP
rs1056375648 3271 dbSNP
rs1270012071 3280 dbSNP
rs1211318167 3297 dbSNP
rs887258282 3298 dbSNP
rs1264388431 3304 dbSNP
rs566540137 3304 dbSNP
rs1239059364 3305 dbSNP
rs1331150769 3308 dbSNP
rs939195634 3311 dbSNP
rs1304263157 3312 dbSNP
rs926435724 3319 dbSNP
rs1047339620 3328 dbSNP
rs1345951561 3336 dbSNP
rs980587199 3339 dbSNP
rs1404694048 3340 dbSNP
rs753365476 3348 dbSNP
rs113134659 3361 dbSNP
rs898877000 3368 dbSNP
rs1467121776 3370 dbSNP
rs920283124 3374 dbSNP
rs1421466815 3378 dbSNP
rs1457891280 3379 dbSNP
rs1390920708 3385 dbSNP
rs1157640552 3403 dbSNP
rs1037332219 3407 dbSNP
rs1424178647 3411 dbSNP
rs943004472 3416 dbSNP
rs910316302 3420 dbSNP
rs1201414512 3422 dbSNP
rs1416173999 3422 dbSNP
rs987603651 3444 dbSNP
rs1266161561 3453 dbSNP
rs111666288 3456 dbSNP
rs1205337682 3458 dbSNP
rs962290013 3462 dbSNP
rs1019181042 3463 dbSNP
rs1472620058 3469 dbSNP
rs933196191 3470 dbSNP
rs1208079440 3478 dbSNP
rs1238833676 3480 dbSNP
rs924431566 3487 dbSNP
rs953583329 3491 dbSNP
rs1029534447 3492 dbSNP
rs1257984882 3493 dbSNP
rs1000292083 3495 dbSNP
rs977375046 3509 dbSNP
rs969177443 3513 dbSNP
rs1457210158 3515 dbSNP
rs968624954 3518 dbSNP
rs1021515923 3520 dbSNP
rs551648819 3521 dbSNP
rs1226230718 3522 dbSNP
rs533164529 3523 dbSNP
rs1003458777 3525 dbSNP
rs1056428934 3525 dbSNP
rs1450914878 3525 dbSNP
rs958931787 3525 dbSNP
rs1187340666 3529 dbSNP
rs1035801357 3533 dbSNP
rs1442937306 3537 dbSNP
rs905029054 3538 dbSNP
rs1003358735 3540 dbSNP
rs1309339180 3553 dbSNP
rs1251651971 3561 dbSNP
rs1229442418 3562 dbSNP
rs373776338 3563 dbSNP
rs1295504665 3566 dbSNP
rs920316783 3567 dbSNP
rs1434394853 3569 dbSNP
rs1397937577 3570 dbSNP
rs1297568026 3572 dbSNP
rs1036095713 3574 dbSNP
rs887319275 3581 dbSNP
rs1401997620 3588 dbSNP
rs1169563253 3596 dbSNP
rs562527486 3603 dbSNP
rs1423457923 3604 dbSNP
rs1381213509 3616 dbSNP
rs1238671786 3620 dbSNP
rs987683719 3626 dbSNP
rs953594267 3632 dbSNP
rs1180521294 3653 dbSNP
rs1308582003 3662 dbSNP
rs1252312261 3665 dbSNP
rs1206950862 3675 dbSNP
rs544339534 3676 dbSNP
rs528853606 3688 dbSNP
rs1272828252 3699 dbSNP
rs183767527 3701 dbSNP
rs1214202328 3710 dbSNP
rs922135016 3711 dbSNP
rs1489777867 3719 dbSNP
rs536474136 3724 dbSNP
rs1039904651 3739 dbSNP
rs1221374268 3752 dbSNP
rs1340349491 3759 dbSNP
rs935552035 3765 dbSNP
rs1309022900 3775 dbSNP
rs1411999667 3781 dbSNP
rs1286295853 3787 dbSNP
rs1241630377 3804 dbSNP
rs1369080082 3808 dbSNP
rs968895125 3812 dbSNP
rs1405573169 3814 dbSNP
rs1415359708 3820 dbSNP
rs888762293 3821 dbSNP
rs1412553358 3833 dbSNP
rs1020815867 3835 dbSNP
rs1481990895 3837 dbSNP
rs1051556429 3843 dbSNP
rs1204148589 3844 dbSNP
rs1010316851 3849 dbSNP
rs933061608 3853 dbSNP
rs924345432 3855 dbSNP
rs868439925 3864 dbSNP
rs753211105 3865 dbSNP
rs1208069040 3866 dbSNP
rs1334781270 3873 dbSNP
rs947173522 3874 dbSNP
rs1230767749 3881 dbSNP
rs540551803 3891 dbSNP
rs1288064749 3896 dbSNP
rs1345281802 3910 dbSNP
rs1436791908 3914 dbSNP
rs1351193092 3919 dbSNP
rs1321030316 3929 dbSNP
rs1361369332 3935 dbSNP
rs914508243 3939 dbSNP
rs370495540 3940 dbSNP
rs1003470107 3941 dbSNP
rs573520050 3967 dbSNP
rs1388729183 3971 dbSNP
rs905081031 3978 dbSNP
rs1471554877 3986 dbSNP
rs1418154417 4020 dbSNP
rs567674968 4029 dbSNP
rs1044924751 4047 dbSNP
rs1176968701 4049 dbSNP
rs180822351 4055 dbSNP
rs1197006318 4061 dbSNP
rs573745578 4062 dbSNP
rs558035881 4072 dbSNP
rs898987622 4075 dbSNP
rs1036107383 4089 dbSNP
rs1284013592 4092 dbSNP
rs545950971 4094 dbSNP
rs940403454 4096 dbSNP
rs958764405 4101 dbSNP
rs1272787543 4102 dbSNP
rs1439671194 4104 dbSNP
rs1488837599 4106 dbSNP
rs1263390769 4119 dbSNP
rs928620891 4122 dbSNP
rs1218308354 4124 dbSNP
rs1351100687 4129 dbSNP
rs1051341949 4135 dbSNP
rs1259623643 4136 dbSNP
rs1416018227 4145 dbSNP
rs932269553 4149 dbSNP
rs190645289 4157 dbSNP
rs1453954731 4163 dbSNP
rs1248760278 4165 dbSNP
rs1313823546 4177 dbSNP
rs951551520 4179 dbSNP
rs1242108218 4182 dbSNP
rs557009395 4195 dbSNP
rs979023036 4201 dbSNP
rs1314352034 4209 dbSNP
rs1025650816 4220 dbSNP
rs1276923572 4234 dbSNP
rs115579550 4235 dbSNP
rs1342382621 4243 dbSNP
rs962829251 4244 dbSNP
rs1340874442 4251 dbSNP
rs1432188916 4251 dbSNP
rs568348622 4253 dbSNP
rs1299850610 4254 dbSNP
rs1398381343 4259 dbSNP
rs1018506410 4273 dbSNP
rs766550270 4279 dbSNP
rs913396977 4281 dbSNP
rs1384601965 4284 dbSNP
rs553372239 4285 dbSNP
rs888825764 4289 dbSNP
rs138307400 4295 dbSNP
rs1035708115 4309 dbSNP
rs1390957790 4317 dbSNP
rs1376392283 4327 dbSNP
rs1176360479 4330 dbSNP
rs997157105 4338 dbSNP
rs1447808407 4347 dbSNP
rs980076609 4355 dbSNP
rs902946398 4361 dbSNP
rs1484495060 4366 dbSNP
rs1041462360 4374 dbSNP
rs1236112885 4374 dbSNP
rs1210526547 4376 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 63967.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
              ||::| | | ||||||| 
1 - 18
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000318121.3 | 3UTR | AAUUAAUUUUUGCUGCUUAAUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000318121.3 | 3UTR | AAUUAAUUUUUGCUGCUUAAUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38974 Chronic obstructive pulmonary disease -0.415 2.0e-2 -0.525 3.5e-3 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.384 3.5e-2 -0.400 2.9e-2 23 Click to see details
GSE21849 B cell lymphoma -0.233 1.1e-1 -0.205 1.4e-1 29 Click to see details
GSE19783 ER+ ER+ breast cancer -0.284 1.1e-1 -0.365 5.7e-2 20 Click to see details
GSE19536 Breast cancer -0.118 1.2e-1 -0.104 1.5e-1 100 Click to see details
GSE28260 Renal cortex and medulla -0.334 1.3e-1 -0.027 4.7e-1 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.247 1.5e-1 0.362 5.8e-2 20 Click to see details
GSE19783 ER- ER- breast cancer -0.115 1.6e-1 -0.064 2.9e-1 79 Click to see details
GSE14794 Lymphoblastoid cells -0.093 1.9e-1 -0.112 1.5e-1 90 Click to see details
GSE21687 Ependynoma primary tumors -0.089 2.4e-1 -0.026 4.2e-1 64 Click to see details
GSE38226 Liver fibrosis -0.157 2.5e-1 0.177 2.2e-1 21 Click to see details
GSE17306 Multiple myeloma -0.092 2.6e-1 -0.072 3.1e-1 49 Click to see details
GSE21032 Prostate cancer -0.066 2.8e-1 -0.113 1.5e-1 83 Click to see details
GSE27834 Pluripotent stem cells 0.104 3.5e-1 0.197 2.3e-1 16 Click to see details
GSE28544 Breast cancer 0.036 4.3e-1 0.319 6.4e-2 24 Click to see details
GSE19350 CNS germ cell tumors -0.046 4.4e-1 -0.238 2.3e-1 12 Click to see details
GSE32688 Pancreatic cancer 0.026 4.4e-1 0.081 3.3e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.019 4.6e-1 -0.120 2.8e-1 25 Click to see details
GSE17498 Multiple myeloma 0.007 4.8e-1 0.059 3.6e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells 0.006 4.9e-1 -0.004 4.9e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.006 4.9e-1 -0.004 4.9e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.742 0 0.659 0 32 Click to see details
KIRC 0.303 0.01 0.277 0.01 68 Click to see details
CHOL -0.606 0.04 -0.533 0.07 9 Click to see details
HNSC 0.251 0.05 0.250 0.06 42 Click to see details
PAAD 0.858 0.07 0.200 0.4 4 Click to see details
THCA 0.185 0.08 0.161 0.11 59 Click to see details
PCPG -0.959 0.09 -1.000 0.5 3 Click to see details
BRCA 0.139 0.1 0.149 0.09 84 Click to see details
COAD 0.46 0.13 0.286 0.25 8 Click to see details
PRAD 0.162 0.13 0.059 0.34 50 Click to see details
KICH 0.233 0.13 0.256 0.11 25 Click to see details
LUSC -0.133 0.21 -0.125 0.23 38 Click to see details
BLCA 0.167 0.25 0.199 0.21 18 Click to see details
LUAD 0.131 0.34 0.154 0.32 12 Click to see details
KIRP 0.053 0.39 -0.021 0.45 32 Click to see details
LIHC -0.032 0.41 0.063 0.33 49 Click to see details
CESC -0.262 0.42 -0.500 0.33 3 Click to see details
ESCA 0.068 0.42 0.173 0.31 11 Click to see details
UCEC -0.007 0.49 -0.049 0.42 19 Click to see details
UCEC -0.007 0.49 -0.049 0.42 19 Click to see details
UCEC -0.007 0.49 -0.049 0.42 19 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000285 CCND2 cyclin D2 4 7
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 3 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472263 NFIC nuclear factor I C 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505116 YTHDC1 YTH domain containing 1 2 6
MIRT505349 TMEM245 transmembrane protein 245 2 6
MIRT505398 TMEM100 transmembrane protein 100 2 2
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505549 SNX16 sorting nexin 16 2 6
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505930 RCAN3 RCAN family member 3 2 4
MIRT506112 PPIG peptidylprolyl isomerase G 2 6
MIRT506138 PLRG1 pleiotropic regulator 1 2 4
MIRT506166 PLAG1 PLAG1 zinc finger 2 9
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506487 MYO5A myosin VA 2 7
MIRT506854 KIF23 kinesin family member 23 2 7
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507820 CDK1 cyclin dependent kinase 1 2 6
MIRT507853 CCNE2 cyclin E2 2 6
MIRT507877 CBX6 chromobox 6 2 2
MIRT508041 AXIN2 axin 2 2 6
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509368 DMPK DM1 protein kinase 2 11
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511847 GPATCH8 G-patch domain containing 8 2 5
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT514042 ATG14 autophagy related 14 2 2
MIRT518095 TRIM35 tripartite motif containing 35 2 2
MIRT518533 FLCN folliculin 2 6
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521055 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521207 SBNO1 strawberry notch homolog 1 2 6
MIRT521818 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522778 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537815 EFNB2 ephrin B2 2 4
MIRT539902 RPL14 ribosomal protein L14 2 4
MIRT540847 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541217 HOXA10 homeobox A10 2 2
MIRT541432 CBX4 chromobox 4 2 3
MIRT542810 PHC3 polyhomeotic homolog 3 2 3
MIRT542837 PDCD1 programmed cell death 1 2 7
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543310 ZNF585B zinc finger protein 585B 2 2
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543529 PRSS21 protease, serine 21 2 2
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543839 GSG1 germ cell associated 1 2 2
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544916 CLSPN claspin 2 2
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545351 CCDC83 coiled-coil domain containing 83 2 2
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546118 USP48 ubiquitin specific peptidase 48 2 4
MIRT546611 SALL1 spalt like transcription factor 1 2 4
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546640 RTN4 reticulon 4 2 2
MIRT547069 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547406 MKX mohawk homeobox 2 2
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547661 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547702 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT548001 HCFC2 host cell factor C2 2 4
MIRT548018 GRB2 growth factor receptor bound protein 2 2 4
MIRT548219 FKBP1A FK506 binding protein 1A 2 2
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548727 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548946 CDK17 cyclin dependent kinase 17 2 3
MIRT549076 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549123 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549389 AMOT angiomotin 2 2
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550619 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550827 FAM229B family with sequence similarity 229 member B 2 2
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551621 ZNF267 zinc finger protein 267 2 2
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552348 ZNF704 zinc finger protein 704 2 2
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553442 TPM3 tropomyosin 3 2 2
MIRT553565 TMEM161B transmembrane protein 161B 2 2
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553777 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554702 RNF149 ring finger protein 149 2 2
MIRT554965 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555035 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555278 PRDM4 PR/SET domain 4 2 2
MIRT555431 PPAP2B phospholipid phosphatase 3 2 2
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557484 GPR27 G protein-coupled receptor 27 2 4
MIRT558041 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558664 CNKSR3 CNKSR family member 3 2 2
MIRT559006 CA8 carbonic anhydrase 8 2 2
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560855 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561153 KRT33B keratin 33B 2 2
MIRT561404 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562031 LANCL1 LanC like 1 2 2
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562881 KIAA1456 KIAA1456 2 2
MIRT563090 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563507 DLGAP3 DLG associated protein 3 2 2
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564336 CCNT1 cyclin T1 2 2
MIRT564482 ZNF391 zinc finger protein 391 2 2
MIRT564556 CCDC80 coiled-coil domain containing 80 2 2
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564954 XKR7 XK related 7 2 2
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566122 RASEF RAS and EF-hand domain containing 2 2
MIRT566654 NCKAP1 NCK associated protein 1 2 2
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567017 KLHL15 kelch like family member 15 2 2
MIRT567450 GNG12 G protein subunit gamma 12 2 2
MIRT567482 FZD9 frizzled class receptor 9 2 2
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568143 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568477 ARMC12 armadillo repeat containing 12 2 2
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568621 ACVR2A activin A receptor type 2A 2 2
MIRT570464 TLK1 tousled like kinase 1 2 3
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571431 RIF1 replication timing regulatory factor 1 2 2
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571824 PHF19 PHD finger protein 19 5 2
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 2 3
MIRT574062 PROSC pyridoxal phosphate binding protein 2 2
MIRT574207 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574595 N4BP1 NEDD4 binding protein 1 2 3
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575928 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576100 Pdcd1 programmed cell death 1 2 5
MIRT576593 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614697 TRAK1 trafficking kinesin protein 1 2 2
MIRT616471 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640542 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645514 BSPRY B-box and SPRY domain containing 2 2
MIRT646599 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648788 KLHL40 kelch like family member 40 2 2
MIRT655815 NOTCH2 notch 2 2 3
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659260 CUL3 cullin 3 5 2
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682280 RS1 retinoschisin 1 2 2
MIRT682518 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691713 FLOT2 flotillin 2 2 3
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701510 NEGR1 neuronal growth regulator 1 2 2
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713423 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716436 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717465 ADORA3 adenosine A3 receptor 2 2
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725130 SYNRG synergin gamma 2 2
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13