miRTarBase - #MIRT544593 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AP5Z1   
Synonyms KIAA0415, SPG48, zeta
Description adaptor related protein complex 5 zeta 1 subunit
Transcript NM_014855   
Putative miRNA Targets on AP5Z1
3'UTR of AP5Z1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            :|||:| ||:  ||||||| 
2991 - 3010 154.00 -13.60
            ||: ||:  :||    ||||||| 
473 - 498 150.00 -16.90
             :||||  |   |  ||||||  
438 - 462 127.00 -14.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
910859 8 ClinVar
910860 20 ClinVar
360345 46 ClinVar
360346 69 ClinVar
360347 93 ClinVar
910861 120 ClinVar
912076 150 ClinVar
912077 150 ClinVar
912078 151 ClinVar
360348 153 ClinVar
912079 159 ClinVar
360349 190 ClinVar
912080 191 ClinVar
360350 206 ClinVar
908069 207 ClinVar
908070 230 ClinVar
908071 242 ClinVar
360351 251 ClinVar
908072 262 ClinVar
360352 277 ClinVar
908073 279 ClinVar
908074 347 ClinVar
910025 374 ClinVar
360353 379 ClinVar
360354 433 ClinVar
910026 528 ClinVar
910027 532 ClinVar
360355 533 ClinVar
360356 538 ClinVar
360357 562 ClinVar
910919 587 ClinVar
910920 626 ClinVar
910921 630 ClinVar
910922 649 ClinVar
910923 660 ClinVar
360358 666 ClinVar
910924 669 ClinVar
910925 670 ClinVar
912147 684 ClinVar
360359 691 ClinVar
360360 735 ClinVar
360361 755 ClinVar
360362 762 ClinVar
360363 766 ClinVar
912148 766 ClinVar
912149 767 ClinVar
908135 807 ClinVar
360364 821 ClinVar
908136 834 ClinVar
908137 844 ClinVar
908138 857 ClinVar
908139 881 ClinVar
360365 897 ClinVar
360366 898 ClinVar
360367 902 ClinVar
360368 911 ClinVar
360369 920 ClinVar
360370 923 ClinVar
910086 941 ClinVar
360371 954 ClinVar
910087 966 ClinVar
910088 972 ClinVar
910089 1000 ClinVar
910982 1004 ClinVar
360372 1040 ClinVar
360373 1040 ClinVar
360374 1066 ClinVar
910983 1095 ClinVar
360375 1134 ClinVar
910984 1163 ClinVar
360376 1183 ClinVar
910985 1188 ClinVar
360377 1204 ClinVar
360378 1205 ClinVar
912211 1220 ClinVar
912212 1221 ClinVar
912213 1261 ClinVar
360379 1267 ClinVar
360380 1356 ClinVar
912214 1358 ClinVar
908209 1387 ClinVar
360381 1442 ClinVar
908210 1459 ClinVar
360382 1481 ClinVar
360383 1506 ClinVar
360384 1556 ClinVar
360385 1563 ClinVar
908211 1577 ClinVar
360386 1587 ClinVar
910151 1588 ClinVar
910152 1595 ClinVar
910153 1642 ClinVar
360387 1671 ClinVar
910154 1680 ClinVar
360388 1688 ClinVar
360389 1702 ClinVar
360390 1702 ClinVar
911040 1734 ClinVar
360391 1737 ClinVar
360392 1739 ClinVar
360393 1751 ClinVar
360394 1761 ClinVar
911041 1795 ClinVar
360395 1867 ClinVar
360396 1882 ClinVar
912276 1931 ClinVar
912277 2005 ClinVar
912278 2014 ClinVar
912279 2069 ClinVar
360397 2094 ClinVar
360398 2110 ClinVar
360399 2154 ClinVar
908276 2168 ClinVar
360400 2186 ClinVar
908277 2198 ClinVar
360401 2199 ClinVar
908278 2223 ClinVar
908279 2229 ClinVar
908280 2242 ClinVar
360402 2244 ClinVar
910222 2245 ClinVar
360403 2287 ClinVar
910223 2307 ClinVar
910224 2329 ClinVar
910225 2335 ClinVar
360404 2339 ClinVar
910226 2364 ClinVar
910227 2365 ClinVar
911118 2412 ClinVar
360405 2491 ClinVar
360406 2497 ClinVar
360407 2501 ClinVar
911119 2502 ClinVar
360408 2504 ClinVar
360409 2575 ClinVar
360410 2600 ClinVar
360411 2624 ClinVar
911321 2625 ClinVar
911322 2640 ClinVar
360412 2643 ClinVar
360413 2679 ClinVar
911323 2696 ClinVar
911324 2711 ClinVar
360414 2720 ClinVar
908341 2761 ClinVar
360415 2767 ClinVar
360416 2785 ClinVar
908342 2813 ClinVar
360417 2839 ClinVar
908343 2842 ClinVar
360418 2850 ClinVar
360419 2859 ClinVar
360420 2883 ClinVar
360421 2941 ClinVar
909186 2984 ClinVar
360422 3005 ClinVar
COSN31614058 4 COSMIC
COSN30501674 12 COSMIC
COSN31574073 23 COSMIC
COSN30138300 137 COSMIC
COSN1350348 237 COSMIC
rs11971803 1183 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1479237750 4 dbSNP
rs1198538738 5 dbSNP
rs768787357 7 dbSNP
rs774520916 8 dbSNP
rs762049662 9 dbSNP
rs549404448 11 dbSNP
rs773634001 12 dbSNP
rs1160237961 14 dbSNP
rs555250435 18 dbSNP
rs754463682 21 dbSNP
rs1304980479 22 dbSNP
rs372643424 23 dbSNP
rs568094732 24 dbSNP
rs1306685929 25 dbSNP
rs377206255 30 dbSNP
rs1233861529 31 dbSNP
rs566873635 34 dbSNP
rs1307038559 38 dbSNP
rs1311255903 39 dbSNP
rs777362842 40 dbSNP
rs1257602616 41 dbSNP
rs751380185 42 dbSNP
rs930265834 43 dbSNP
rs914921383 45 dbSNP
rs12154545 46 dbSNP
rs781100110 47 dbSNP
rs1183020679 48 dbSNP
rs745841055 49 dbSNP
rs1431723321 50 dbSNP
rs940305977 51 dbSNP
rs1403427879 54 dbSNP
rs1037142604 62 dbSNP
rs73305393 69 dbSNP
rs1453429163 70 dbSNP
rs546071452 74 dbSNP
rs1189970628 76 dbSNP
rs577301873 90 dbSNP
rs144772761 91 dbSNP
rs1444007726 92 dbSNP
rs112283999 93 dbSNP
rs1223853848 95 dbSNP
rs575436631 100 dbSNP
rs1033041152 104 dbSNP
rs1229373204 108 dbSNP
rs891701261 113 dbSNP
rs1010135078 115 dbSNP
rs1004883366 117 dbSNP
rs775400806 118 dbSNP
rs971603837 119 dbSNP
rs576259662 120 dbSNP
rs544740791 122 dbSNP
rs768593845 123 dbSNP
rs1439620487 132 dbSNP
rs1418180414 135 dbSNP
rs113317994 139 dbSNP
rs1184187998 140 dbSNP
rs139378554 142 dbSNP
rs1187111262 146 dbSNP
rs1237935975 146 dbSNP
rs951832142 147 dbSNP
rs183237366 148 dbSNP
rs540649048 149 dbSNP
rs761922257 150 dbSNP
rs186823399 151 dbSNP
rs886062355 153 dbSNP
rs990371685 154 dbSNP
rs191229687 156 dbSNP
rs570721516 156 dbSNP
rs913448357 157 dbSNP
rs202085734 158 dbSNP
rs551093436 159 dbSNP
rs977722184 162 dbSNP
rs1353518838 166 dbSNP
rs973365156 167 dbSNP
rs922883325 169 dbSNP
rs1164209231 171 dbSNP
rs934111539 172 dbSNP
rs150058274 175 dbSNP
rs944455611 180 dbSNP
rs1301248848 182 dbSNP
rs530317142 183 dbSNP
rs550104638 189 dbSNP
rs548571464 190 dbSNP
rs1232009202 191 dbSNP
rs368324617 192 dbSNP
rs1331751526 193 dbSNP
rs373838070 195 dbSNP
rs1223526494 205 dbSNP
rs73305394 206 dbSNP
rs1046021496 212 dbSNP
rs534929490 212 dbSNP
rs747375968 212 dbSNP
rs1252092486 217 dbSNP
rs907157849 218 dbSNP
rs1459814750 227 dbSNP
rs907173985 229 dbSNP
rs535419745 230 dbSNP
rs879381159 232 dbSNP
rs1034814179 234 dbSNP
rs1341615321 235 dbSNP
rs1193197808 238 dbSNP
rs957565418 239 dbSNP
rs1252452723 241 dbSNP
rs570957705 242 dbSNP
rs12154621 251 dbSNP
rs1348622362 256 dbSNP
rs1005902148 258 dbSNP
rs1315573812 262 dbSNP
rs967591842 266 dbSNP
rs1202218559 268 dbSNP
rs1261550484 269 dbSNP
rs1371193701 269 dbSNP
rs1014637952 270 dbSNP
rs1390179974 271 dbSNP
rs1289419645 272 dbSNP
rs12154622 277 dbSNP
rs1177882973 278 dbSNP
rs975774214 279 dbSNP
rs1463088777 280 dbSNP
rs922839980 283 dbSNP
rs955680031 290 dbSNP
rs986017174 291 dbSNP
rs911371268 293 dbSNP
rs921673314 294 dbSNP
rs1205118369 295 dbSNP
rs140188885 299 dbSNP
rs930496963 299 dbSNP
rs1048910965 300 dbSNP
rs1425297751 302 dbSNP
rs936168577 303 dbSNP
rs1231593677 307 dbSNP
rs1054510399 313 dbSNP
rs768009110 315 dbSNP
rs913323927 316 dbSNP
rs1304864996 320 dbSNP
rs1366805614 322 dbSNP
rs1359666567 323 dbSNP
rs946037144 326 dbSNP
rs886379275 328 dbSNP
rs940607043 329 dbSNP
rs1435148590 330 dbSNP
rs1046031945 331 dbSNP
rs1172072023 332 dbSNP
rs1328374972 337 dbSNP
rs1243892225 342 dbSNP
rs1427281079 345 dbSNP
rs907208833 346 dbSNP
rs1045763673 347 dbSNP
rs377553602 348 dbSNP
rs1208290235 351 dbSNP
rs907100294 353 dbSNP
rs1251409757 357 dbSNP
rs752113263 359 dbSNP
rs1001483409 362 dbSNP
rs1259456275 363 dbSNP
rs753206078 367 dbSNP
rs887580510 372 dbSNP
rs1006016037 373 dbSNP
rs575299983 374 dbSNP
rs1411912437 378 dbSNP
rs12154696 379 dbSNP
rs1167439519 382 dbSNP
rs1460561976 385 dbSNP
rs554872454 387 dbSNP
rs573160974 388 dbSNP
rs1030022943 391 dbSNP
rs1444693887 392 dbSNP
rs953183236 393 dbSNP
rs1343326393 401 dbSNP
rs1452822711 402 dbSNP
rs560528325 403 dbSNP
rs974804541 406 dbSNP
rs921731272 407 dbSNP
rs1333997252 410 dbSNP
rs1291233846 412 dbSNP
rs1229956938 413 dbSNP
rs200649898 414 dbSNP
rs951756185 415 dbSNP
rs984515125 418 dbSNP
rs957486766 420 dbSNP
rs1461402027 421 dbSNP
rs990357764 424 dbSNP
rs1383666113 425 dbSNP
rs1045653575 426 dbSNP
rs1363571953 427 dbSNP
rs913312560 428 dbSNP
rs928541006 430 dbSNP
rs777236237 432 dbSNP
rs149131747 433 dbSNP
rs981830238 434 dbSNP
rs1271237792 435 dbSNP
rs1316784069 435 dbSNP
rs1011637570 437 dbSNP
rs928629644 440 dbSNP
rs577176341 441 dbSNP
rs1262937551 445 dbSNP
rs544330793 446 dbSNP
rs1373414087 447 dbSNP
rs1055600191 448 dbSNP
rs778450487 450 dbSNP
rs941864113 455 dbSNP
rs1323209495 457 dbSNP
rs867600181 460 dbSNP
rs1036184954 462 dbSNP
rs897562550 463 dbSNP
rs1461405921 471 dbSNP
rs1384707488 472 dbSNP
rs1157135121 473 dbSNP
rs997254504 481 dbSNP
rs563019050 482 dbSNP
rs1193843668 483 dbSNP
rs143609133 484 dbSNP
rs548357776 485 dbSNP
rs1365368171 486 dbSNP
rs1468005804 488 dbSNP
rs1018536406 489 dbSNP
rs957643465 492 dbSNP
rs1336356391 500 dbSNP
rs745495168 513 dbSNP
rs990303800 517 dbSNP
rs951663732 518 dbSNP
rs1020486715 520 dbSNP
rs967968532 527 dbSNP
rs758084749 528 dbSNP
rs779034378 530 dbSNP
rs950086025 531 dbSNP
rs114076345 532 dbSNP
rs527985598 533 dbSNP
rs937316420 536 dbSNP
rs991487686 537 dbSNP
rs146804830 538 dbSNP
rs941978379 540 dbSNP
rs1475720833 541 dbSNP
rs1036256843 542 dbSNP
rs1223243452 545 dbSNP
rs1190912848 546 dbSNP
rs1486564696 548 dbSNP
rs914590685 550 dbSNP
rs370722002 551 dbSNP
rs1215198023 555 dbSNP
rs1323730503 557 dbSNP
rs538631490 562 dbSNP
rs1230731723 563 dbSNP
rs550379429 564 dbSNP
rs1008423489 565 dbSNP
rs1041590547 567 dbSNP
rs1357019457 568 dbSNP
rs1172052349 570 dbSNP
rs1253830251 571 dbSNP
rs1410094697 572 dbSNP
rs568952005 577 dbSNP
rs1418153408 578 dbSNP
rs888903015 579 dbSNP
rs1007226004 582 dbSNP
rs899973613 584 dbSNP
rs1418324308 585 dbSNP
rs557128223 586 dbSNP
rs34767537 587 dbSNP
rs111443000 588 dbSNP
rs1205458245 588 dbSNP
rs1270963989 590 dbSNP
rs1168585647 592 dbSNP
rs1011811917 597 dbSNP
rs573113917 602 dbSNP
rs1020561750 603 dbSNP
rs370271108 618 dbSNP
rs1231890288 620 dbSNP
rs1442980654 623 dbSNP
rs1003453377 624 dbSNP
rs1035773887 625 dbSNP
rs959075651 626 dbSNP
rs991435082 627 dbSNP
rs1353421233 629 dbSNP
rs1328620014 630 dbSNP
rs558891748 630 dbSNP
rs963362688 631 dbSNP
rs1421888190 634 dbSNP
rs971923585 635 dbSNP
rs914484473 639 dbSNP
rs919171496 648 dbSNP
rs577133170 649 dbSNP
rs1469327751 653 dbSNP
rs977378576 655 dbSNP
rs1052068207 658 dbSNP
rs140612456 660 dbSNP
rs1224008325 662 dbSNP
rs1372097723 665 dbSNP
rs78468795 666 dbSNP
rs1442515683 667 dbSNP
rs375098115 669 dbSNP
rs893447235 670 dbSNP
rs1346747750 671 dbSNP
rs1159489383 672 dbSNP
rs1276704793 674 dbSNP
rs1009244332 675 dbSNP
rs1378653239 676 dbSNP
rs1195714245 678 dbSNP
rs888694128 683 dbSNP
rs763158624 684 dbSNP
rs903469949 687 dbSNP
rs189323274 688 dbSNP
rs1185041502 689 dbSNP
rs145742120 691 dbSNP
rs1410629765 692 dbSNP
rs1236022881 695 dbSNP
rs1371175360 697 dbSNP
rs1036295344 698 dbSNP
rs1003051614 700 dbSNP
rs958923291 701 dbSNP
rs1012926783 703 dbSNP
rs1364258836 708 dbSNP
rs1016313349 710 dbSNP
rs560305767 714 dbSNP
rs1175840306 716 dbSNP
rs368797254 717 dbSNP
rs1304254618 721 dbSNP
rs991273121 722 dbSNP
rs1471918695 724 dbSNP
rs774451137 725 dbSNP
rs1186421274 727 dbSNP
rs1429005985 728 dbSNP
rs968586536 729 dbSNP
rs977283954 730 dbSNP
rs1360768854 732 dbSNP
rs552406935 734 dbSNP
rs193235922 735 dbSNP
rs987304389 738 dbSNP
rs1356623613 739 dbSNP
rs910353002 740 dbSNP
rs943195455 741 dbSNP
rs944019326 741 dbSNP
rs1314429122 742 dbSNP
rs531980213 743 dbSNP
rs1053498341 744 dbSNP
rs921356345 745 dbSNP
rs1373702522 747 dbSNP
rs914995793 749 dbSNP
rs945020138 752 dbSNP
rs1485809927 753 dbSNP
rs888725285 753 dbSNP
rs940274852 754 dbSNP
rs759877524 755 dbSNP
rs903420852 758 dbSNP
rs1037259683 759 dbSNP
rs1190751804 760 dbSNP
rs1294938065 761 dbSNP
rs185362971 761 dbSNP
rs115198050 762 dbSNP
rs1310919194 763 dbSNP
rs753187560 765 dbSNP
rs114829927 766 dbSNP
rs549943787 767 dbSNP
rs1166243320 771 dbSNP
rs1397270655 771 dbSNP
rs1016300346 772 dbSNP
rs1012725733 773 dbSNP
rs566621601 774 dbSNP
rs993500787 779 dbSNP
rs1250647491 781 dbSNP
rs533996873 782 dbSNP
rs1275029842 784 dbSNP
rs1456046169 784 dbSNP
rs1346151082 786 dbSNP
rs954750508 790 dbSNP
rs1031547327 792 dbSNP
rs987765132 793 dbSNP
rs1017529425 794 dbSNP
rs1336527754 795 dbSNP
rs1322112852 796 dbSNP
rs866574152 797 dbSNP
rs112128865 798 dbSNP
rs1244550112 799 dbSNP
rs976772225 801 dbSNP
rs1315672956 802 dbSNP
rs749893447 803 dbSNP
rs558855056 806 dbSNP
rs190210301 807 dbSNP
rs1177604106 809 dbSNP
rs954093836 813 dbSNP
rs984183221 815 dbSNP
rs910066073 818 dbSNP
rs762228088 819 dbSNP
rs575429444 821 dbSNP
rs1206629631 822 dbSNP
rs1351085868 824 dbSNP
rs1037694518 825 dbSNP
rs757865082 826 dbSNP
rs928227283 831 dbSNP
rs1184220745 833 dbSNP
rs1329819591 834 dbSNP
rs1320813938 835 dbSNP
rs1370706900 838 dbSNP
rs1469113715 839 dbSNP
rs1157748067 842 dbSNP
rs537779263 844 dbSNP
rs1056779948 847 dbSNP
rs945134534 848 dbSNP
rs1477674503 849 dbSNP
rs894108334 852 dbSNP
rs1044857534 855 dbSNP
rs1459127825 855 dbSNP
rs977765997 855 dbSNP
rs368407419 856 dbSNP
rs148032002 857 dbSNP
rs1218766037 858 dbSNP
rs1403382923 860 dbSNP
rs574779508 860 dbSNP
rs1340301191 862 dbSNP
rs1451298572 862 dbSNP
rs1296672782 863 dbSNP
rs1397774979 866 dbSNP
rs1032040384 867 dbSNP
rs1334362106 868 dbSNP
rs1413457155 868 dbSNP
rs965311691 869 dbSNP
rs1169643117 873 dbSNP
rs1341741531 873 dbSNP
rs1422686502 874 dbSNP
rs1475669145 874 dbSNP
rs1440011843 875 dbSNP
rs998618832 876 dbSNP
rs1028344888 877 dbSNP
rs541881743 878 dbSNP
rs939040057 879 dbSNP
rs1317791801 880 dbSNP
rs535535946 881 dbSNP
rs972911081 882 dbSNP
rs894771974 883 dbSNP
rs948881711 887 dbSNP
rs1261508284 890 dbSNP
rs553851601 892 dbSNP
rs1037863264 893 dbSNP
rs371780577 894 dbSNP
rs1323014678 895 dbSNP
rs886062356 897 dbSNP
rs572278037 898 dbSNP
rs1436130548 899 dbSNP
rs890416549 900 dbSNP
rs112176131 902 dbSNP
rs1418302931 902 dbSNP
rs1181503580 903 dbSNP
rs1471898794 904 dbSNP
rs1234694913 905 dbSNP
rs1017530609 906 dbSNP
rs1182569497 907 dbSNP
rs1457347616 908 dbSNP
rs1256764625 909 dbSNP
rs773520179 911 dbSNP
rs1042822272 917 dbSNP
rs904279234 917 dbSNP
rs1376472116 920 dbSNP
rs374967757 920 dbSNP
rs1280899463 922 dbSNP
rs1446951283 922 dbSNP
rs11971749 923 dbSNP
rs1329311767 925 dbSNP
rs1462890160 926 dbSNP
rs1052943822 927 dbSNP
rs1163746691 928 dbSNP
rs964655168 929 dbSNP
rs1410489420 930 dbSNP
rs181322047 931 dbSNP
rs900972510 933 dbSNP
rs905987022 933 dbSNP
rs989298572 936 dbSNP
rs1469032173 937 dbSNP
rs1246525463 939 dbSNP
rs1172791533 940 dbSNP
rs1219881668 941 dbSNP
rs1403785959 941 dbSNP
rs1407669871 943 dbSNP
rs1306384386 945 dbSNP
rs1328121126 945 dbSNP
rs1368163042 945 dbSNP
rs1292839722 947 dbSNP
rs941518189 947 dbSNP
rs1350969347 948 dbSNP
rs1159545569 949 dbSNP
rs889797407 950 dbSNP
rs1175556406 951 dbSNP
rs1425148278 952 dbSNP
rs543810252 952 dbSNP
rs1189973776 953 dbSNP
rs11976063 954 dbSNP
rs1242991051 955 dbSNP
rs1216902607 956 dbSNP
rs1344622355 957 dbSNP
rs781185378 958 dbSNP
rs1017056344 959 dbSNP
rs1234302641 960 dbSNP
rs961443219 963 dbSNP
rs1363817604 964 dbSNP
rs1257947586 965 dbSNP
rs1337568762 966 dbSNP
rs1314985048 967 dbSNP
rs567846012 967 dbSNP
rs1195253860 968 dbSNP
rs868013790 970 dbSNP
rs529715248 972 dbSNP
rs1193348857 973 dbSNP
rs1197890097 974 dbSNP
rs1260650016 975 dbSNP
rs548276417 976 dbSNP
rs1207951143 978 dbSNP
rs1480957767 978 dbSNP
rs1309132291 980 dbSNP
rs1278731383 981 dbSNP
rs1217838246 982 dbSNP
rs1338132535 983 dbSNP
rs1199183505 984 dbSNP
rs1396757410 986 dbSNP
rs1401605419 986 dbSNP
rs1301117344 987 dbSNP
rs1401710821 988 dbSNP
rs1464009041 988 dbSNP
rs1378949859 989 dbSNP
rs868148894 990 dbSNP
rs1166736015 993 dbSNP
rs1370629480 994 dbSNP
rs1431611257 995 dbSNP
rs1170562051 996 dbSNP
rs1301192952 997 dbSNP
rs1420462579 1001 dbSNP
rs1364775699 1002 dbSNP
rs565631932 1004 dbSNP
rs1423971605 1005 dbSNP
rs1303706993 1007 dbSNP
rs372775469 1008 dbSNP
rs1226794027 1009 dbSNP
rs1298511811 1010 dbSNP
rs916823509 1013 dbSNP
rs948429279 1013 dbSNP
rs1344393712 1015 dbSNP
rs966586754 1016 dbSNP
rs566585002 1018 dbSNP
rs927740361 1020 dbSNP
rs939013932 1022 dbSNP
rs978379173 1022 dbSNP
rs990537109 1023 dbSNP
rs916151384 1024 dbSNP
rs948997376 1025 dbSNP
rs925732862 1028 dbSNP
rs1037936968 1029 dbSNP
rs934439148 1034 dbSNP
rs1490621055 1035 dbSNP
rs1053256013 1036 dbSNP
rs1367585146 1039 dbSNP
rs899309687 1039 dbSNP
rs115180718 1040 dbSNP
rs1048236010 1041 dbSNP
rs1269022719 1042 dbSNP
rs890584421 1044 dbSNP
rs1426434573 1049 dbSNP
rs1009302879 1050 dbSNP
rs1049705273 1052 dbSNP
rs1390300446 1052 dbSNP
rs1242574792 1058 dbSNP
rs1039080264 1065 dbSNP
rs558005571 1066 dbSNP
rs1161628123 1067 dbSNP
rs1384482953 1071 dbSNP
rs1016961134 1073 dbSNP
rs1010803192 1076 dbSNP
rs1022230543 1077 dbSNP
rs1389022560 1079 dbSNP
rs1291436429 1080 dbSNP
rs966909048 1087 dbSNP
rs999407745 1088 dbSNP
rs1157492192 1090 dbSNP
rs140844502 1095 dbSNP
rs1381927015 1097 dbSNP
rs183819296 1098 dbSNP
rs1367497312 1101 dbSNP
rs1243825652 1104 dbSNP
rs990428040 1107 dbSNP
rs1219090492 1110 dbSNP
rs1488711410 1111 dbSNP
rs1314977976 1112 dbSNP
rs1322773707 1113 dbSNP
rs1347203201 1115 dbSNP
rs916225143 1116 dbSNP
rs1247619024 1122 dbSNP
rs1259395620 1123 dbSNP
rs962368477 1124 dbSNP
rs1207757920 1125 dbSNP
rs973590327 1130 dbSNP
rs558006465 1134 dbSNP
rs886062357 1134 dbSNP
rs991393890 1134 dbSNP
rs920847920 1135 dbSNP
rs929461297 1138 dbSNP
rs1403710537 1141 dbSNP
rs1173091222 1142 dbSNP
rs1047926448 1143 dbSNP
rs979624898 1145 dbSNP
rs112074284 1153 dbSNP
rs911948934 1154 dbSNP
rs944831975 1157 dbSNP
rs1361899326 1158 dbSNP
rs1039153331 1159 dbSNP
rs1279354144 1162 dbSNP
rs749324858 1163 dbSNP
rs1010915970 1164 dbSNP
rs1391027401 1168 dbSNP
rs1043663668 1169 dbSNP
rs902464360 1171 dbSNP
rs988584576 1172 dbSNP
rs999755966 1174 dbSNP
rs1340287502 1175 dbSNP
rs1277249158 1177 dbSNP
rs1341753250 1178 dbSNP
rs539514781 1179 dbSNP
rs1413871798 1180 dbSNP
rs1172705336 1182 dbSNP
rs11971803 1183 dbSNP
rs1011923757 1184 dbSNP
rs188242891 1188 dbSNP
rs1191794000 1189 dbSNP
rs894877580 1192 dbSNP
rs1473871124 1194 dbSNP
rs962312613 1196 dbSNP
rs1238158496 1198 dbSNP
rs1186988606 1201 dbSNP
rs886062358 1204 dbSNP
rs886062359 1205 dbSNP
rs1260615598 1206 dbSNP
rs1049578751 1209 dbSNP
rs1317686352 1209 dbSNP
rs1256491384 1210 dbSNP
rs911031942 1215 dbSNP
rs973748688 1217 dbSNP
rs572193795 1220 dbSNP
rs1446711478 1221 dbSNP
rs1229340362 1222 dbSNP
rs1038256045 1224 dbSNP
rs763875579 1226 dbSNP
rs897163161 1227 dbSNP
rs951023462 1228 dbSNP
rs1168011321 1232 dbSNP
rs984005595 1234 dbSNP
rs912038941 1237 dbSNP
rs1162878683 1238 dbSNP
rs944867454 1238 dbSNP
rs1330693268 1239 dbSNP
rs545922435 1242 dbSNP
rs1240028189 1243 dbSNP
rs922051788 1252 dbSNP
rs1179826029 1253 dbSNP
rs374744640 1254 dbSNP
rs1236761927 1255 dbSNP
rs1380104184 1256 dbSNP
rs1322672027 1257 dbSNP
rs1183570786 1261 dbSNP
rs1290216247 1264 dbSNP
rs1227318954 1265 dbSNP
rs946694014 1266 dbSNP
rs1418310897 1267 dbSNP
rs886062360 1267 dbSNP
rs1182540932 1270 dbSNP
rs1413894035 1273 dbSNP
rs1296364025 1274 dbSNP
rs1438419993 1275 dbSNP
rs1468485534 1279 dbSNP
rs1043780090 1280 dbSNP
rs902410658 1282 dbSNP
rs1159284605 1283 dbSNP
rs1439130178 1286 dbSNP
rs1012398233 1287 dbSNP
rs1175944804 1290 dbSNP
rs1359856818 1291 dbSNP
rs1246433189 1292 dbSNP
rs1220405045 1295 dbSNP
rs935239271 1296 dbSNP
rs774627297 1297 dbSNP
rs1287680898 1302 dbSNP
rs896287833 1304 dbSNP
rs1352319566 1305 dbSNP
rs1012036618 1307 dbSNP
rs1023337969 1310 dbSNP
rs968162874 1311 dbSNP
rs1001073949 1315 dbSNP
rs1403366664 1318 dbSNP
rs558329513 1320 dbSNP
rs1299004432 1322 dbSNP
rs1031178454 1326 dbSNP
rs1290673332 1327 dbSNP
rs367987052 1331 dbSNP
rs898283660 1336 dbSNP
rs1434213788 1338 dbSNP
rs1221361344 1341 dbSNP
rs753403152 1342 dbSNP
rs576603024 1345 dbSNP
rs1487680299 1346 dbSNP
rs544045575 1349 dbSNP
rs1212177629 1350 dbSNP
rs1211562652 1352 dbSNP
rs1312656841 1352 dbSNP
rs1221511547 1353 dbSNP
rs562263791 1354 dbSNP
rs955315346 1354 dbSNP
rs951138337 1355 dbSNP
rs6967542 1356 dbSNP
rs1359983570 1358 dbSNP
rs911062916 1365 dbSNP
rs1205765694 1369 dbSNP
rs1359146130 1372 dbSNP
rs1253767562 1374 dbSNP
rs368886206 1376 dbSNP
rs1467576467 1378 dbSNP
rs1424707415 1382 dbSNP
rs115479706 1384 dbSNP
rs541829370 1387 dbSNP
rs966199402 1388 dbSNP
rs930017493 1390 dbSNP
rs974943001 1393 dbSNP
rs1434994339 1395 dbSNP
rs1483275940 1398 dbSNP
rs1242518291 1401 dbSNP
rs180721551 1402 dbSNP
rs896456208 1406 dbSNP
rs946807178 1411 dbSNP
rs1306025228 1412 dbSNP
rs1315083329 1415 dbSNP
rs1396738983 1418 dbSNP
rs1378529233 1419 dbSNP
rs375334869 1426 dbSNP
rs1401505033 1427 dbSNP
rs1000978828 1428 dbSNP
rs1371030443 1430 dbSNP
rs1166453354 1433 dbSNP
rs1310367596 1434 dbSNP
rs1364145218 1435 dbSNP
rs1241913306 1437 dbSNP
rs1459004510 1438 dbSNP
rs112405589 1442 dbSNP
rs1273905953 1446 dbSNP
rs957155934 1447 dbSNP
rs923938035 1449 dbSNP
rs1312957623 1451 dbSNP
rs935339586 1452 dbSNP
rs113820369 1453 dbSNP
rs954987412 1457 dbSNP
rs896431597 1459 dbSNP
rs564265161 1463 dbSNP
rs985216794 1464 dbSNP
rs1018030012 1465 dbSNP
rs1274432113 1467 dbSNP
rs1380905772 1472 dbSNP
rs947880494 1473 dbSNP
rs1340812075 1479 dbSNP
rs1417088928 1480 dbSNP
rs886062361 1481 dbSNP
rs1205829815 1482 dbSNP
rs1482332550 1483 dbSNP
rs1044901864 1484 dbSNP
rs898232655 1485 dbSNP
rs995193197 1486 dbSNP
rs1218947675 1488 dbSNP
rs1276639191 1489 dbSNP
rs973883917 1489 dbSNP
rs1237430430 1490 dbSNP
rs1302355034 1493 dbSNP
rs1010673884 1496 dbSNP
rs1386533492 1497 dbSNP
rs531409764 1504 dbSNP
rs73305396 1506 dbSNP
rs1421064057 1509 dbSNP
rs1360535600 1511 dbSNP
rs1157944827 1513 dbSNP
rs992064916 1513 dbSNP
rs568031052 1517 dbSNP
rs1199352421 1519 dbSNP
rs948021945 1520 dbSNP
rs1008350084 1521 dbSNP
rs1283575782 1523 dbSNP
rs1019186365 1524 dbSNP
rs1223342637 1524 dbSNP
rs1450134612 1525 dbSNP
rs903943174 1526 dbSNP
rs1280982573 1529 dbSNP
rs1401402440 1529 dbSNP
rs1326532070 1530 dbSNP
rs966312212 1532 dbSNP
rs1398418028 1533 dbSNP
rs36046096 1535 dbSNP
rs535396945 1538 dbSNP
rs1053017292 1540 dbSNP
rs892614069 1541 dbSNP
rs1173074103 1542 dbSNP
rs1405157955 1550 dbSNP
rs1324694349 1551 dbSNP
rs34910786 1551 dbSNP
rs78049494 1556 dbSNP
rs1438228273 1561 dbSNP
rs1029144417 1562 dbSNP
rs150159238 1563 dbSNP
rs890831135 1564 dbSNP
rs979508537 1568 dbSNP
rs1363864981 1570 dbSNP
rs1444188756 1572 dbSNP
rs745617315 1576 dbSNP
rs539916245 1577 dbSNP
rs1299749751 1578 dbSNP
rs1203517443 1579 dbSNP
rs935342179 1580 dbSNP
rs1260346013 1582 dbSNP
rs1227668314 1583 dbSNP
rs992600391 1584 dbSNP
rs917818063 1585 dbSNP
rs1290403189 1586 dbSNP
rs555597896 1587 dbSNP
rs973821177 1587 dbSNP
rs1044980148 1590 dbSNP
rs919731375 1591 dbSNP
rs138654444 1595 dbSNP
rs1451753816 1595 dbSNP
rs1046770378 1596 dbSNP
rs992492546 1598 dbSNP
rs1213968118 1601 dbSNP
rs1465917187 1604 dbSNP
rs917831728 1605 dbSNP
rs537262180 1607 dbSNP
rs886893357 1610 dbSNP
rs1473821480 1611 dbSNP
rs1007881900 1612 dbSNP
rs948093275 1612 dbSNP
rs1465421124 1613 dbSNP
rs1041132940 1614 dbSNP
rs925398202 1615 dbSNP
rs555960098 1616 dbSNP
rs1271927854 1617 dbSNP
rs1241843745 1619 dbSNP
rs996404564 1623 dbSNP
rs1052493959 1624 dbSNP
rs1357862692 1624 dbSNP
rs1029258696 1625 dbSNP
rs1245189783 1627 dbSNP
rs1380546193 1628 dbSNP
rs1333271475 1629 dbSNP
rs968171267 1630 dbSNP
rs1001479358 1633 dbSNP
rs1031075430 1640 dbSNP
rs192055966 1642 dbSNP
rs992151490 1646 dbSNP
rs933498618 1648 dbSNP
rs1052486649 1649 dbSNP
rs541791014 1652 dbSNP
rs1163057532 1653 dbSNP
rs917893390 1655 dbSNP
rs560181212 1656 dbSNP
rs1382758796 1657 dbSNP
rs572080134 1659 dbSNP
rs1006590596 1660 dbSNP
rs1231474820 1660 dbSNP
rs919845400 1661 dbSNP
rs1284678741 1662 dbSNP
rs1292012041 1662 dbSNP
rs1381114686 1663 dbSNP
rs931154121 1664 dbSNP
rs1221812238 1665 dbSNP
rs149234202 1671 dbSNP
rs908268738 1674 dbSNP
rs943762069 1676 dbSNP
rs1372377816 1680 dbSNP
rs977637864 1682 dbSNP
rs147352536 1685 dbSNP
rs76039626 1688 dbSNP
rs899467173 1692 dbSNP
rs1441880479 1698 dbSNP
rs549694643 1699 dbSNP
rs1239672264 1701 dbSNP
rs80311758 1702 dbSNP
rs371664477 1703 dbSNP
rs1480955133 1705 dbSNP
rs904135187 1706 dbSNP
rs1198159482 1712 dbSNP
rs767393817 1712 dbSNP
rs1160886141 1713 dbSNP
rs866044904 1715 dbSNP
rs1031608567 1717 dbSNP
rs1316314236 1722 dbSNP
rs1282044126 1724 dbSNP
rs1220799367 1725 dbSNP
rs1399495475 1727 dbSNP
rs1403271354 1728 dbSNP
rs182383318 1734 dbSNP
rs1014058980 1735 dbSNP
rs781023359 1737 dbSNP
rs768610280 1739 dbSNP
rs933509702 1740 dbSNP
rs1051926022 1741 dbSNP
rs910695009 1742 dbSNP
rs943620722 1750 dbSNP
rs886062362 1751 dbSNP
rs1037918095 1752 dbSNP
rs1230521927 1753 dbSNP
rs1281562264 1754 dbSNP
rs980776849 1755 dbSNP
rs1344442022 1757 dbSNP
rs77146005 1761 dbSNP
rs551815433 1762 dbSNP
rs1212063842 1763 dbSNP
rs1324012132 1764 dbSNP
rs1281365832 1766 dbSNP
rs570033468 1768 dbSNP
rs995174731 1769 dbSNP
rs1320321652 1770 dbSNP
rs988027035 1771 dbSNP
rs1214118920 1772 dbSNP
rs1359875695 1774 dbSNP
rs1253039132 1775 dbSNP
rs1047288840 1778 dbSNP
rs1405847940 1779 dbSNP
rs952762067 1780 dbSNP
rs537577608 1782 dbSNP
rs982738716 1783 dbSNP
rs1185373514 1787 dbSNP
rs908343870 1788 dbSNP
rs1242422415 1791 dbSNP
rs777788359 1794 dbSNP
rs186935731 1795 dbSNP
rs1226896855 1797 dbSNP
rs574323515 1802 dbSNP
rs976461595 1805 dbSNP
rs1314891770 1811 dbSNP
rs535295016 1817 dbSNP
rs1382759379 1826 dbSNP
rs921056261 1827 dbSNP
rs1375528373 1832 dbSNP
rs1024774589 1833 dbSNP
rs1477409609 1835 dbSNP
rs1461131462 1837 dbSNP
rs969156784 1840 dbSNP
rs932299823 1841 dbSNP
rs1164979830 1847 dbSNP
rs1444695044 1848 dbSNP
rs1384596916 1849 dbSNP
rs1181674240 1852 dbSNP
rs1250912381 1855 dbSNP
rs1042770219 1856 dbSNP
rs749250102 1857 dbSNP
rs1195474835 1861 dbSNP
rs1479802749 1863 dbSNP
rs771028794 1864 dbSNP
rs748344258 1867 dbSNP
rs1358810098 1869 dbSNP
rs1032214546 1872 dbSNP
rs1290216642 1872 dbSNP
rs936893732 1872 dbSNP
rs1491476935 1873 dbSNP
rs958320524 1875 dbSNP
rs1052715563 1877 dbSNP
rs553705355 1878 dbSNP
rs557936576 1881 dbSNP
rs886062363 1882 dbSNP
rs746070374 1885 dbSNP
rs1370965886 1889 dbSNP
rs988141313 1889 dbSNP
rs545497965 1891 dbSNP
rs1321836483 1899 dbSNP
rs1180881153 1902 dbSNP
rs1025010572 1903 dbSNP
rs954829907 1905 dbSNP
rs1234221851 1909 dbSNP
rs772238165 1913 dbSNP
rs910726050 1921 dbSNP
rs1228373916 1923 dbSNP
rs943483276 1925 dbSNP
rs1275911499 1926 dbSNP
rs1237413236 1927 dbSNP
rs1484258080 1929 dbSNP
rs1284812693 1931 dbSNP
rs1405126256 1933 dbSNP
rs557770214 1935 dbSNP
rs1220631528 1936 dbSNP
rs572912657 1938 dbSNP
rs1300787512 1939 dbSNP
rs1037991699 1940 dbSNP
rs1385649900 1944 dbSNP
rs1264840170 1948 dbSNP
rs1451359852 1957 dbSNP
rs1431078835 1959 dbSNP
rs1002143221 1961 dbSNP
rs930995952 1964 dbSNP
rs1026919711 1965 dbSNP
rs1195483841 1967 dbSNP
rs1447644364 1971 dbSNP
rs1261722759 1978 dbSNP
rs952755856 1980 dbSNP
rs983073338 1981 dbSNP
rs1203835406 1986 dbSNP
rs1462947266 1992 dbSNP
rs775706918 1994 dbSNP
rs1223248493 1996 dbSNP
rs1450737075 1998 dbSNP
rs1199121349 1999 dbSNP
rs1046712878 2001 dbSNP
rs886744322 2002 dbSNP
rs965586184 2003 dbSNP
rs143513418 2005 dbSNP
rs921000500 2006 dbSNP
rs1317570593 2009 dbSNP
rs191668940 2014 dbSNP
rs1408071387 2015 dbSNP
rs978524231 2016 dbSNP
rs1337197192 2017 dbSNP
rs925578548 2018 dbSNP
rs1427536895 2021 dbSNP
rs934350797 2024 dbSNP
rs1053077170 2026 dbSNP
rs892756391 2031 dbSNP
rs1372517857 2039 dbSNP
rs949547351 2040 dbSNP
rs1389744317 2047 dbSNP
rs1032245817 2050 dbSNP
rs367552347 2050 dbSNP
rs1046572787 2051 dbSNP
rs905389337 2058 dbSNP
rs1460254391 2059 dbSNP
rs1434411549 2060 dbSNP
rs1197118962 2067 dbSNP
rs1002215360 2068 dbSNP
rs561538511 2069 dbSNP
rs529066651 2072 dbSNP
rs888408082 2078 dbSNP
rs1451735009 2080 dbSNP
rs1357148453 2082 dbSNP
rs987561507 2082 dbSNP
rs113435364 2084 dbSNP
rs1004258945 2086 dbSNP
rs540895729 2089 dbSNP
rs1396001700 2092 dbSNP
rs1210089158 2093 dbSNP
rs7784925 2094 dbSNP
rs533289846 2096 dbSNP
rs1386478103 2098 dbSNP
rs1183442796 2102 dbSNP
rs965319357 2109 dbSNP
rs766301854 2110 dbSNP
rs1438091777 2111 dbSNP
rs1028134752 2114 dbSNP
rs551462008 2115 dbSNP
rs953870328 2116 dbSNP
rs570078600 2118 dbSNP
rs973547360 2120 dbSNP
rs920872987 2122 dbSNP
rs929585054 2125 dbSNP
rs978473458 2127 dbSNP
rs530898668 2131 dbSNP
rs984082872 2131 dbSNP
rs955894516 2132 dbSNP
rs988528754 2133 dbSNP
rs949050931 2136 dbSNP
rs1367728950 2138 dbSNP
rs1046172767 2141 dbSNP
rs1163526754 2144 dbSNP
rs1458176702 2146 dbSNP
rs1410766648 2147 dbSNP
rs1159561896 2148 dbSNP
rs904934674 2149 dbSNP
rs937876533 2150 dbSNP
rs914122772 2151 dbSNP
rs1165250309 2152 dbSNP
rs949616616 2153 dbSNP
rs111994210 2154 dbSNP
rs926760028 2155 dbSNP
rs938186074 2156 dbSNP
rs1009489471 2158 dbSNP
rs777112844 2164 dbSNP
rs112158331 2166 dbSNP
rs182688215 2168 dbSNP
rs1346261484 2170 dbSNP
rs1004610604 2173 dbSNP
rs1341481655 2175 dbSNP
rs1434377042 2176 dbSNP
rs1037056518 2177 dbSNP
rs1247360530 2178 dbSNP
rs1400496797 2184 dbSNP
rs886062364 2186 dbSNP
rs998071244 2187 dbSNP
rs1429527481 2191 dbSNP
rs1190187191 2194 dbSNP
rs1028249393 2195 dbSNP
rs953819170 2196 dbSNP
rs187056670 2198 dbSNP
rs148554790 2199 dbSNP
rs1324604737 2201 dbSNP
rs1217615181 2203 dbSNP
rs374125034 2204 dbSNP
rs1255336162 2205 dbSNP
rs1289983391 2207 dbSNP
rs1424178943 2209 dbSNP
rs373055710 2210 dbSNP
rs568309944 2210 dbSNP
rs917488515 2210 dbSNP
rs1189288955 2211 dbSNP
rs1470499219 2212 dbSNP
rs1406448913 2218 dbSNP
rs988986113 2221 dbSNP
rs1430963106 2222 dbSNP
rs377673816 2223 dbSNP
rs926263191 2225 dbSNP
rs971046036 2225 dbSNP
rs564354304 2226 dbSNP
rs386709640 2227 dbSNP
rs57071738 2227 dbSNP
rs982290186 2228 dbSNP
rs115179819 2229 dbSNP
rs61623336 2229 dbSNP
rs1262760465 2230 dbSNP
rs938176188 2235 dbSNP
rs1048587515 2236 dbSNP
rs909940167 2240 dbSNP
rs940095344 2241 dbSNP
rs1037534193 2242 dbSNP
rs539348967 2244 dbSNP
rs117144087 2245 dbSNP
rs576031149 2247 dbSNP
rs778697136 2248 dbSNP
rs1049670692 2251 dbSNP
rs1301915994 2252 dbSNP
rs543076796 2254 dbSNP
rs1355887866 2255 dbSNP
rs1039064807 2258 dbSNP
rs900479607 2259 dbSNP
rs1288534716 2264 dbSNP
rs1318229536 2265 dbSNP
rs1207332700 2267 dbSNP
rs1255352982 2270 dbSNP
rs1185277827 2271 dbSNP
rs1445036160 2272 dbSNP
rs1000423389 2273 dbSNP
rs1255159426 2274 dbSNP
rs1032823433 2275 dbSNP
rs1212926692 2278 dbSNP
rs111762282 2287 dbSNP
rs1009954381 2289 dbSNP
rs1183205843 2291 dbSNP
rs1340055345 2292 dbSNP
rs950953421 2295 dbSNP
rs1024012027 2296 dbSNP
rs1311074962 2297 dbSNP
rs1414383923 2299 dbSNP
rs573464267 2303 dbSNP
rs979774249 2306 dbSNP
rs540809527 2307 dbSNP
rs1378275317 2310 dbSNP
rs980299414 2313 dbSNP
rs1468067502 2316 dbSNP
rs559148045 2318 dbSNP
rs1306694334 2322 dbSNP
rs959675121 2322 dbSNP
rs984796290 2324 dbSNP
rs1370359473 2325 dbSNP
rs565562831 2329 dbSNP
rs1420647561 2331 dbSNP
rs1251519614 2332 dbSNP
rs926295751 2334 dbSNP
rs533072379 2335 dbSNP
rs989277915 2336 dbSNP
rs545326390 2338 dbSNP
rs189898090 2339 dbSNP
rs1264187047 2340 dbSNP
rs1312225614 2341 dbSNP
rs933971599 2342 dbSNP
rs1042600684 2343 dbSNP
rs1307283884 2344 dbSNP
rs1049785503 2351 dbSNP
rs1408790904 2354 dbSNP
rs889688072 2358 dbSNP
rs1348121910 2362 dbSNP
rs530936725 2364 dbSNP
rs1054789444 2365 dbSNP
rs1482611051 2372 dbSNP
rs891588062 2377 dbSNP
rs1158744741 2379 dbSNP
rs944621923 2379 dbSNP
rs1471754481 2383 dbSNP
rs549470135 2384 dbSNP
rs1038928762 2385 dbSNP
rs900509438 2390 dbSNP
rs1426022564 2391 dbSNP
rs1455607736 2393 dbSNP
rs1024002490 2394 dbSNP
rs906993453 2396 dbSNP
rs1049171209 2398 dbSNP
rs567778014 2399 dbSNP
rs528631963 2402 dbSNP
rs1383808551 2403 dbSNP
rs547195646 2405 dbSNP
rs866381682 2406 dbSNP
rs1348491863 2407 dbSNP
rs1177340076 2409 dbSNP
rs1477749214 2411 dbSNP
rs571859846 2412 dbSNP
rs1292554871 2413 dbSNP
rs1462933465 2417 dbSNP
rs1264629650 2420 dbSNP
rs1200627586 2421 dbSNP
rs1228941550 2425 dbSNP
rs961564362 2425 dbSNP
rs972929827 2426 dbSNP
rs1432636638 2427 dbSNP
rs1384655448 2431 dbSNP
rs1367716102 2433 dbSNP
rs1335133596 2434 dbSNP
rs540565440 2435 dbSNP
rs1400300330 2437 dbSNP
rs971499610 2437 dbSNP
rs922666141 2438 dbSNP
rs1295340330 2443 dbSNP
rs1462551457 2445 dbSNP
rs1187161546 2446 dbSNP
rs1001750610 2449 dbSNP
rs538955432 2451 dbSNP
rs1229051222 2452 dbSNP
rs1441532383 2456 dbSNP
rs1276047283 2457 dbSNP
rs985556927 2460 dbSNP
rs911192337 2461 dbSNP
rs936003022 2462 dbSNP
rs1273849088 2463 dbSNP
rs373275397 2464 dbSNP
rs1361373016 2467 dbSNP
rs1284613271 2468 dbSNP
rs1446989001 2474 dbSNP
rs760274187 2475 dbSNP
rs891743547 2477 dbSNP
rs945890291 2479 dbSNP
rs1369970811 2482 dbSNP
rs1469882142 2484 dbSNP
rs1186688792 2485 dbSNP
rs1045565756 2490 dbSNP
rs150684624 2491 dbSNP
rs753348874 2497 dbSNP
rs1235385730 2498 dbSNP
rs1183460104 2500 dbSNP
rs139997541 2501 dbSNP
rs1483111135 2501 dbSNP
rs115452328 2502 dbSNP
rs886062365 2504 dbSNP
rs1353915551 2507 dbSNP
rs1163646005 2508 dbSNP
rs561809937 2509 dbSNP
rs1281512873 2511 dbSNP
rs1394698160 2515 dbSNP
rs961958659 2518 dbSNP
rs1350069829 2519 dbSNP
rs1462682320 2520 dbSNP
rs1406827609 2526 dbSNP
rs994318475 2534 dbSNP
rs1318037036 2535 dbSNP
rs1351038274 2538 dbSNP
rs1029811858 2540 dbSNP
rs1363791069 2545 dbSNP
rs955533258 2547 dbSNP
rs544799839 2552 dbSNP
rs1271808809 2559 dbSNP
rs1049544516 2560 dbSNP
rs1160970529 2564 dbSNP
rs985503173 2568 dbSNP
rs1472739343 2569 dbSNP
rs1410746850 2570 dbSNP
rs911336958 2571 dbSNP
rs886062366 2575 dbSNP
rs1490696148 2581 dbSNP
rs1376742646 2583 dbSNP
rs1227462759 2585 dbSNP
rs990585959 2589 dbSNP
rs1449684652 2591 dbSNP
rs182415280 2594 dbSNP
rs913131645 2595 dbSNP
rs143539039 2600 dbSNP
rs1045760204 2601 dbSNP
rs1045638179 2608 dbSNP
rs928435060 2611 dbSNP
rs1001654241 2613 dbSNP
rs1274796811 2617 dbSNP
rs1034587557 2621 dbSNP
rs1347436742 2622 dbSNP
rs1434895060 2622 dbSNP
rs2880933 2624 dbSNP
rs1055465900 2625 dbSNP
rs1457035524 2625 dbSNP
rs1156417124 2626 dbSNP
rs577775560 2629 dbSNP
rs1425205570 2630 dbSNP
rs1022393904 2631 dbSNP
rs966361227 2632 dbSNP
rs1182868981 2635 dbSNP
rs1189045837 2636 dbSNP
rs1420471888 2637 dbSNP
rs978252224 2638 dbSNP
rs1018696369 2639 dbSNP
rs1205750842 2640 dbSNP
rs537332416 2643 dbSNP
rs1278057772 2658 dbSNP
rs974562119 2661 dbSNP
rs1298985913 2664 dbSNP
rs1036461920 2665 dbSNP
rs897508061 2667 dbSNP
rs778937679 2670 dbSNP
rs984685702 2671 dbSNP
rs1467295159 2673 dbSNP
rs1359357819 2676 dbSNP
rs186689012 2679 dbSNP
rs955523453 2680 dbSNP
rs1007098492 2681 dbSNP
rs907874663 2683 dbSNP
rs1448663692 2686 dbSNP
rs1018348744 2688 dbSNP
rs1183351413 2690 dbSNP
rs575675624 2692 dbSNP
rs543029183 2693 dbSNP
rs1309266493 2696 dbSNP
rs1045833390 2700 dbSNP
rs1447181923 2701 dbSNP
rs907278157 2703 dbSNP
rs1357093854 2704 dbSNP
rs1226845128 2705 dbSNP
rs561295670 2707 dbSNP
rs990271026 2709 dbSNP
rs193143390 2711 dbSNP
rs1379523303 2712 dbSNP
rs1301831094 2714 dbSNP
rs1012243805 2717 dbSNP
rs1371814366 2717 dbSNP
rs1169175415 2718 dbSNP
rs967357513 2719 dbSNP
rs140555165 2720 dbSNP
rs565298263 2721 dbSNP
rs1442419005 2722 dbSNP
rs928594327 2726 dbSNP
rs937166551 2728 dbSNP
rs532746384 2730 dbSNP
rs1484092047 2731 dbSNP
rs999174450 2734 dbSNP
rs1056062061 2739 dbSNP
rs1018735665 2745 dbSNP
rs965801452 2747 dbSNP
rs185535788 2750 dbSNP
rs974468696 2755 dbSNP
rs1029246724 2759 dbSNP
rs569515120 2762 dbSNP
rs951878993 2763 dbSNP
rs1260116158 2764 dbSNP
rs985147195 2766 dbSNP
rs1482251559 2767 dbSNP
rs886062367 2767 dbSNP
rs907782999 2769 dbSNP
rs1179610802 2770 dbSNP
rs772150298 2772 dbSNP
rs1458236731 2777 dbSNP
rs941751629 2779 dbSNP
rs940710210 2782 dbSNP
rs573731436 2785 dbSNP
rs897456795 2788 dbSNP
rs997222972 2789 dbSNP
rs981393527 2790 dbSNP
rs1413878169 2791 dbSNP
rs928610762 2792 dbSNP
rs1051341044 2796 dbSNP
rs1210907106 2807 dbSNP
rs1488376138 2808 dbSNP
rs188402033 2811 dbSNP
rs144268420 2813 dbSNP
rs548564053 2816 dbSNP
rs1407720615 2821 dbSNP
rs914730650 2825 dbSNP
rs947570123 2827 dbSNP
rs566962174 2828 dbSNP
rs1042399217 2832 dbSNP
rs1227249965 2832 dbSNP
rs903424163 2833 dbSNP
rs1241449679 2837 dbSNP
rs534373877 2839 dbSNP
rs1018836629 2841 dbSNP
rs62453211 2842 dbSNP
rs1040082733 2843 dbSNP
rs577734547 2844 dbSNP
rs538843097 2845 dbSNP
rs1379404643 2847 dbSNP
rs1028734596 2849 dbSNP
rs149076549 2850 dbSNP
rs981440920 2857 dbSNP
rs193054132 2859 dbSNP
rs1465577106 2861 dbSNP
rs1183497401 2862 dbSNP
rs542990775 2864 dbSNP
rs1207663263 2866 dbSNP
rs1244525126 2867 dbSNP
rs561258786 2868 dbSNP
rs1174214714 2871 dbSNP
rs1233316773 2872 dbSNP
rs981299957 2877 dbSNP
rs113428873 2883 dbSNP
rs184051349 2885 dbSNP
rs778178883 2885 dbSNP
rs1437021290 2887 dbSNP
rs572430851 2890 dbSNP
rs1320178283 2896 dbSNP
rs991566001 2900 dbSNP
rs914658196 2907 dbSNP
rs947572601 2909 dbSNP
rs1465604711 2912 dbSNP
rs1376435158 2919 dbSNP
rs1041903979 2924 dbSNP
rs991440427 2925 dbSNP
rs1247757241 2928 dbSNP
rs909010538 2930 dbSNP
rs924752679 2931 dbSNP
rs1321775468 2933 dbSNP
rs1257828964 2936 dbSNP
rs573728891 2941 dbSNP
rs944276769 2942 dbSNP
rs1343593527 2945 dbSNP
rs1041284630 2947 dbSNP
rs1230470188 2948 dbSNP
rs1306288770 2964 dbSNP
rs941876860 2965 dbSNP
rs972221982 2967 dbSNP
rs1275846542 2968 dbSNP
rs1335023584 2970 dbSNP
rs1050624241 2971 dbSNP
rs546204275 2971 dbSNP
rs1310424304 2972 dbSNP
rs370256086 2975 dbSNP
rs1287249392 2979 dbSNP
rs373690986 2982 dbSNP
rs188685832 2983 dbSNP
rs181118091 2984 dbSNP
rs1002751717 2986 dbSNP
rs1441366617 2997 dbSNP
rs1254828291 2999 dbSNP
rs1051453854 3002 dbSNP
rs888803835 3003 dbSNP
rs886062368 3005 dbSNP
rs1358131861 3007 dbSNP
rs942920335 3008 dbSNP
rs1447629144 3009 dbSNP
rs562786484 3012 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 9907.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000348624.4 | 3UTR | CAAUAAAUCUUGCUGCUGCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000348624.4 | 3UTR | CAAUAAAUCUUGCUGCUGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000348624.4 | 3UTR | CAAUAAAUCUUGCUGCUGCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000348624.4 | 3UTR | CAAUAAAUCUUGCUGCUGCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000348624.4 | 3UTR | CAAUAAAUCUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis 0.667 4.8e-4 0.489 1.2e-2 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.522 9.1e-3 -0.621 1.7e-3 20 Click to see details
GSE21032 Prostate cancer -0.249 1.2e-2 -0.209 2.9e-2 83 Click to see details
GSE42095 Differentiated embryonic stem cells -0.291 8.9e-2 -0.223 1.5e-1 23 Click to see details
GSE17498 Multiple myeloma -0.189 1.2e-1 0.080 3.1e-1 40 Click to see details
GSE21849 B cell lymphoma -0.192 1.6e-1 -0.262 8.5e-2 29 Click to see details
GSE19536 Breast cancer -0.071 2.4e-1 -0.089 1.9e-1 100 Click to see details
GSE28260 Renal cortex and medulla 0.182 2.8e-1 0.170 2.9e-1 13 Click to see details
GSE17306 Multiple myeloma 0.087 2.8e-1 0.097 2.5e-1 49 Click to see details
GSE19350 CNS germ cell tumors -0.189 2.8e-1 -0.378 1.1e-1 12 Click to see details
GSE28544 Breast cancer -0.117 2.9e-1 -0.364 4.0e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.095 3.3e-1 0.265 1.0e-1 25 Click to see details
GSE19783 ER- ER- breast cancer -0.05 3.3e-1 -0.032 3.9e-1 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.084 3.6e-1 -0.084 3.6e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.066 3.8e-1 -0.004 4.9e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.019 4.6e-1 -0.025 4.5e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.013 4.8e-1 -0.078 3.6e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.005 4.8e-1 -0.015 4.5e-1 64 Click to see details
GSE21687 Ependynoma primary tumors -0.005 4.8e-1 -0.015 4.5e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.255 0.04 0.254 0.04 49 Click to see details
STAD 0.315 0.04 0.393 0.01 32 Click to see details
ESCA 0.471 0.07 0.473 0.07 11 Click to see details
UCEC -0.284 0.12 -0.189 0.22 19 Click to see details
KIRP 0.202 0.13 0.310 0.04 32 Click to see details
BLCA -0.254 0.15 -0.273 0.14 18 Click to see details
COAD 0.386 0.17 0.667 0.04 8 Click to see details
KICH 0.186 0.19 0.142 0.25 25 Click to see details
LUSC -0.134 0.21 -0.214 0.1 38 Click to see details
PRAD -0.093 0.26 0.061 0.34 50 Click to see details
HNSC 0.086 0.29 0.109 0.25 42 Click to see details
KIRC -0.065 0.3 0.058 0.32 68 Click to see details
THCA 0.069 0.3 0.063 0.32 59 Click to see details
PAAD 0.386 0.31 0.800 0.1 4 Click to see details
CHOL 0.192 0.31 0.167 0.33 9 Click to see details
LUAD -0.133 0.34 -0.126 0.35 12 Click to see details
BRCA -0.033 0.38 -0.056 0.31 84 Click to see details
PCPG 0.346 0.39 0.500 0.33 3 Click to see details
PCPG 0.346 0.39 0.500 0.33 3 Click to see details
CESC -1 0.5 -1.000 0.5 3 Click to see details
CESC -1 0.5 -1.000 0.5 3 Click to see details
MiRNA Regulatory Network:
Functional analysis: