miRTarBase - #MIRT539902 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPL14   
Synonyms CAG-ISL-7, CTG-B33, L14, RL14, hRL14
Description ribosomal protein L14
Transcript NM_001034996   
Other Transcripts NM_003973   
Expression
Putative miRNA Targets on RPL14
3'UTR of RPL14
(miRNA target sites are highlighted)
>RPL14|NM_001034996|3'UTR
   1 GTGGCAATCATAAAAAGTAATAAAGGTTCTTTTTGACCTGTTGACAAATGTATTTAAGCCTTTGGATTTAAAGCCTGTTG
  81 AGGCTGGAGTTAGGAGGCAGATTGATAGTAGGATTATAATAAACATTAAATAATCAGTTCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUU---GGUAAUAC---ACGACgau 5'
            :|||   :| || ||   ||:||   
Target 5' aaTAAAGGTTCTTTTTGACCTGTTGaca 3'
19 - 46 96.00 -7.20
2
miRNA  3' guGUUUGG-----UAA--UAC--ACGACgau 5'
            :||:||     |||  | |  ||:||   
Target 5' ttTAAGCCTTTGGATTTAAAGCCTGTTGagg 3'
53 - 83 92.00 -8.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30107913 48 COSMIC
COSN15028821 62 COSMIC
COSN28877089 69 COSMIC
COSN20405048 78 COSMIC
COSN20074649 132 COSMIC
COSN25616851 353 COSMIC
COSN29438342 442 COSMIC
COSN1949374 546 COSMIC
COSN25618168 561 COSMIC
COSN7762024 842 COSMIC
COSN7762025 873 COSMIC
COSN17630490 991 COSMIC
COSN20632505 1365 COSMIC
COSN29335488 1587 COSMIC
COSN15670627 1618 COSMIC
COSN27621902 1742 COSMIC
COSN9550825 1848 COSMIC
COSN21349005 2025 COSMIC
COSN19670236 2232 COSMIC
COSN30550573 2236 COSMIC
COSN15671793 2241 COSMIC
COSN9550826 2265 COSMIC
COSN30659805 2340 COSMIC
COSN27065865 2739 COSMIC
COSN24712572 2826 COSMIC
COSN22782658 2869 COSMIC
COSN23743632 3024 COSMIC
COSN22689964 3250 COSMIC
COSN17950922 3389 COSMIC
COSN8366463 3488 COSMIC
COSN2522270 3792 COSMIC
COSN4817489 3975 COSMIC
COSN20870718 4090 COSMIC
COSN32173301 4240 COSMIC
COSN28192254 4497 COSMIC
COSN30027415 4546 COSMIC
COSN30678012 4646 COSMIC
COSN23604797 4755 COSMIC
COSN30609398 4874 COSMIC
COSN30693494 4874 COSMIC
COSN29398369 5073 COSMIC
COSN5535977 5528 COSMIC
COSN5535978 5531 COSMIC
COSN5535979 5570 COSMIC
COSN14914140 6097 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs15367 1 dbSNP
rs15366 2 dbSNP
rs15363 5 dbSNP
rs754000124 6 dbSNP
rs757531130 8 dbSNP
rs779242031 9 dbSNP
rs1490856334 10 dbSNP
rs15368 12 dbSNP
rs10731 25 dbSNP
rs15369 29 dbSNP
rs8127 31 dbSNP
rs746281312 36 dbSNP
rs772432376 37 dbSNP
rs780557976 41 dbSNP
rs943199963 44 dbSNP
rs747480063 45 dbSNP
rs1399267239 46 dbSNP
rs1259729606 55 dbSNP
rs1440629442 61 dbSNP
rs1038917727 63 dbSNP
rs1291434885 64 dbSNP
rs901782708 65 dbSNP
rs1326884387 66 dbSNP
rs1296424512 67 dbSNP
rs115130370 74 dbSNP
rs1051029798 81 dbSNP
rs11539046 87 dbSNP
rs1310930717 88 dbSNP
rs995532971 94 dbSNP
rs1397131816 101 dbSNP
rs576986966 102 dbSNP
rs554565113 103 dbSNP
rs887108439 104 dbSNP
rs1014044248 106 dbSNP
rs1024978218 109 dbSNP
rs1247071599 112 dbSNP
rs1009601454 115 dbSNP
rs1469695025 125 dbSNP
rs545919871 126 dbSNP
rs1208977297 128 dbSNP
rs1340019304 136 dbSNP
rs1202319142 137 dbSNP
rs903985150 138 dbSNP
rs1307312902 141 dbSNP
rs1491322693 141 dbSNP
rs1002795412 142 dbSNP
rs1193994780 142 dbSNP
rs1197968176 142 dbSNP
rs1235058847 142 dbSNP
rs1274024960 142 dbSNP
rs1310806096 142 dbSNP
rs1341305254 142 dbSNP
rs1350347900 142 dbSNP
rs1491417375 142 dbSNP
rs536807878 142 dbSNP
rs749162320 142 dbSNP
rs770381795 142 dbSNP
rs774559721 142 dbSNP
rs1301493707 143 dbSNP
rs1033911061 144 dbSNP
rs1480973644 145 dbSNP
rs1179059740 147 dbSNP
rs1393426683 151 dbSNP
rs1454003904 156 dbSNP
rs1336719353 159 dbSNP
rs1174561108 160 dbSNP
rs35229215 161 dbSNP
rs981033493 161 dbSNP
rs1408607943 162 dbSNP
rs1491071688 162 dbSNP
rs1312983519 163 dbSNP
rs1436018796 163 dbSNP
rs1277417561 164 dbSNP
rs1483417320 165 dbSNP
rs1442219999 166 dbSNP
rs1332811097 167 dbSNP
rs1365341750 168 dbSNP
rs868173923 169 dbSNP
rs1179320397 171 dbSNP
rs1482703788 174 dbSNP
rs960928024 176 dbSNP
rs992438605 177 dbSNP
rs1368228698 180 dbSNP
rs1233108307 185 dbSNP
rs1486675266 192 dbSNP
rs1025977005 193 dbSNP
rs143691987 194 dbSNP
rs958215721 201 dbSNP
rs1281643290 202 dbSNP
rs984518476 206 dbSNP
rs148119589 207 dbSNP
rs1294413427 208 dbSNP
rs1308008166 210 dbSNP
rs1373084311 210 dbSNP
rs964549198 212 dbSNP
rs548194125 214 dbSNP
rs1400938774 215 dbSNP
rs1386635780 217 dbSNP
rs989901268 219 dbSNP
rs562226825 221 dbSNP
rs1468144561 222 dbSNP
rs913004400 223 dbSNP
rs1189975465 227 dbSNP
rs1476260768 230 dbSNP
rs933227629 231 dbSNP
rs528002359 233 dbSNP
rs1209426068 234 dbSNP
rs1447822369 236 dbSNP
rs547555867 238 dbSNP
rs1207272835 239 dbSNP
rs913904742 246 dbSNP
rs1274416342 250 dbSNP
rs945375267 267 dbSNP
rs1474601929 268 dbSNP
rs1235696442 269 dbSNP
rs1167726645 270 dbSNP
rs1420777885 271 dbSNP
rs945727412 273 dbSNP
rs1412122257 275 dbSNP
rs371501425 279 dbSNP
rs1163490003 282 dbSNP
rs1456568696 284 dbSNP
rs986829945 287 dbSNP
rs570713322 289 dbSNP
rs527991189 290 dbSNP
rs539505770 294 dbSNP
rs1002314769 295 dbSNP
rs549853745 296 dbSNP
rs1326107959 297 dbSNP
rs376593341 300 dbSNP
rs779736789 301 dbSNP
rs1274206167 302 dbSNP
rs896689528 303 dbSNP
rs1039622305 306 dbSNP
rs1320468752 308 dbSNP
rs1013842351 310 dbSNP
rs1214684073 311 dbSNP
rs1428304338 313 dbSNP
rs1340851774 314 dbSNP
rs1295019458 321 dbSNP
rs1433919499 324 dbSNP
rs931174165 327 dbSNP
rs1269390944 330 dbSNP
rs1026570645 335 dbSNP
rs568232595 336 dbSNP
rs1006313563 339 dbSNP
rs1220385884 343 dbSNP
rs1271235670 345 dbSNP
rs1171056120 346 dbSNP
rs1334219024 347 dbSNP
rs1015993130 354 dbSNP
rs1214418349 359 dbSNP
rs1292240997 360 dbSNP
rs887152187 362 dbSNP
rs1253815546 363 dbSNP
rs964799539 366 dbSNP
rs1487689837 367 dbSNP
rs974549621 368 dbSNP
rs1047487566 376 dbSNP
rs190786605 380 dbSNP
rs1192823181 381 dbSNP
rs574612673 387 dbSNP
rs1271863754 388 dbSNP
rs1226975932 391 dbSNP
rs1476619008 392 dbSNP
rs988651982 394 dbSNP
rs913161759 396 dbSNP
rs534118468 397 dbSNP
rs1460432995 402 dbSNP
rs1165017950 408 dbSNP
rs1044098327 411 dbSNP
rs1392359241 412 dbSNP
rs553964792 419 dbSNP
rs1317281323 422 dbSNP
rs374293832 423 dbSNP
rs1444301885 430 dbSNP
rs577123370 431 dbSNP
rs1401662996 432 dbSNP
rs368976855 434 dbSNP
rs745769550 435 dbSNP
rs1013795029 436 dbSNP
rs756115932 437 dbSNP
rs1233902005 439 dbSNP
rs1250185323 440 dbSNP
rs886713362 448 dbSNP
rs1348720233 454 dbSNP
rs546064590 461 dbSNP
rs1285284013 466 dbSNP
rs1489447634 467 dbSNP
rs986587514 468 dbSNP
rs1006491044 471 dbSNP
rs1307485520 473 dbSNP
rs564954233 477 dbSNP
rs1475829424 479 dbSNP
rs181180839 480 dbSNP
rs1190287601 487 dbSNP
rs963710875 499 dbSNP
rs1376128465 503 dbSNP
rs1369688348 514 dbSNP
rs185615176 518 dbSNP
rs964415482 520 dbSNP
rs1304604168 522 dbSNP
rs1468190705 524 dbSNP
rs1358762441 525 dbSNP
rs541424095 528 dbSNP
rs975294885 529 dbSNP
rs995841681 533 dbSNP
rs1182070119 537 dbSNP
rs1475786853 540 dbSNP
rs1385244963 541 dbSNP
rs1259009696 543 dbSNP
rs1421243488 551 dbSNP
rs919883266 552 dbSNP
rs1482735249 554 dbSNP
rs1030075398 555 dbSNP
rs954534622 561 dbSNP
rs988630740 562 dbSNP
rs1215757000 564 dbSNP
rs1374688935 584 dbSNP
rs931249947 586 dbSNP
rs1357219036 594 dbSNP
rs1314981055 603 dbSNP
rs13073003 604 dbSNP
rs1378783224 607 dbSNP
rs1314822992 614 dbSNP
rs1459208081 615 dbSNP
rs748885181 616 dbSNP
rs1462454399 617 dbSNP
rs1334038365 618 dbSNP
rs949474805 622 dbSNP
rs1422693958 631 dbSNP
rs1046539624 632 dbSNP
rs905180739 640 dbSNP
rs1002237483 642 dbSNP
rs1247190509 646 dbSNP
rs969013703 650 dbSNP
rs1336888410 654 dbSNP
rs978710448 658 dbSNP
rs771285467 659 dbSNP
rs1242752843 661 dbSNP
rs774637343 665 dbSNP
rs938065660 667 dbSNP
rs1232478851 669 dbSNP
rs990894712 678 dbSNP
rs1393562210 680 dbSNP
rs1442064766 680 dbSNP
rs918035557 681 dbSNP
rs527931942 685 dbSNP
rs1373168591 686 dbSNP
rs1169869854 690 dbSNP
rs1447319662 693 dbSNP
rs1202667746 694 dbSNP
rs1047901126 698 dbSNP
rs1231657755 698 dbSNP
rs1265252125 698 dbSNP
rs1389120452 698 dbSNP
rs575353391 698 dbSNP
rs201919580 701 dbSNP
rs13068097 702 dbSNP
rs942241040 703 dbSNP
rs1037957744 706 dbSNP
rs900161756 707 dbSNP
rs1333181295 711 dbSNP
rs1380457430 716 dbSNP
rs1386713498 716 dbSNP
rs975010732 719 dbSNP
rs770733595 720 dbSNP
rs1427237354 722 dbSNP
rs995830326 723 dbSNP
rs1030021234 728 dbSNP
rs1369604859 737 dbSNP
rs919602096 740 dbSNP
rs1478773282 745 dbSNP
rs1441172372 753 dbSNP
rs759772919 756 dbSNP
rs1419621375 759 dbSNP
rs1253854479 760 dbSNP
rs773993760 763 dbSNP
rs1171443432 767 dbSNP
rs141312796 768 dbSNP
rs1274258317 771 dbSNP
rs1435161095 773 dbSNP
rs145100662 775 dbSNP
rs1009955742 779 dbSNP
rs530820476 780 dbSNP
rs1394288364 781 dbSNP
rs1336923829 782 dbSNP
rs1290723696 785 dbSNP
rs1390827965 787 dbSNP
rs1312883159 791 dbSNP
rs1415849962 795 dbSNP
rs866352437 802 dbSNP
rs1171831472 804 dbSNP
rs1454090428 812 dbSNP
rs908352416 821 dbSNP
rs1179904180 823 dbSNP
rs771312051 830 dbSNP
rs949276212 831 dbSNP
rs138983976 832 dbSNP
rs1188289203 835 dbSNP
rs1438976614 842 dbSNP
rs1444369612 844 dbSNP
rs34023670 850 dbSNP
rs1200282883 853 dbSNP
rs1302999648 853 dbSNP
rs959623324 862 dbSNP
rs1227096774 864 dbSNP
rs535961420 869 dbSNP
rs1235917897 870 dbSNP
rs1284298706 872 dbSNP
rs1449552414 873 dbSNP
rs1338374427 874 dbSNP
rs777031473 881 dbSNP
rs1382625473 885 dbSNP
rs562850731 887 dbSNP
rs945603767 902 dbSNP
rs1456672978 906 dbSNP
rs1238249033 911 dbSNP
rs142242521 914 dbSNP
rs566070419 915 dbSNP
rs534041856 921 dbSNP
rs942249863 922 dbSNP
rs1433515274 924 dbSNP
rs1009060292 928 dbSNP
rs1207159957 930 dbSNP
rs529896898 931 dbSNP
rs900779564 933 dbSNP
rs1461410906 937 dbSNP
rs1229599254 940 dbSNP
rs1353624264 942 dbSNP
rs996565881 943 dbSNP
rs28707772 944 dbSNP
rs952435910 964 dbSNP
rs1051345735 969 dbSNP
rs1015544579 976 dbSNP
rs1395180864 977 dbSNP
rs1438864181 977 dbSNP
rs1407210148 985 dbSNP
rs572821231 985 dbSNP
rs560078906 988 dbSNP
rs1411738088 990 dbSNP
rs1162698372 991 dbSNP
rs1392229482 997 dbSNP
rs1450347803 997 dbSNP
rs764346185 1001 dbSNP
rs1187108787 1002 dbSNP
rs751851747 1004 dbSNP
rs1009903710 1007 dbSNP
rs970963133 1012 dbSNP
rs757602838 1013 dbSNP
rs1450319111 1021 dbSNP
rs150483445 1029 dbSNP
rs1228435916 1035 dbSNP
rs1343923952 1036 dbSNP
rs137860478 1038 dbSNP
rs556337358 1039 dbSNP
rs1276334791 1042 dbSNP
rs1368028243 1042 dbSNP
rs1326268929 1052 dbSNP
rs576026581 1053 dbSNP
rs190418162 1054 dbSNP
rs1430450788 1056 dbSNP
rs1372709848 1057 dbSNP
rs1319329111 1069 dbSNP
rs1211318721 1073 dbSNP
rs1014192118 1074 dbSNP
rs945432265 1077 dbSNP
rs1449025913 1078 dbSNP
rs1426313262 1079 dbSNP
rs1272072946 1082 dbSNP
rs1043031815 1090 dbSNP
rs555879014 1092 dbSNP
rs1246617531 1095 dbSNP
rs1488611865 1104 dbSNP
rs890674875 1115 dbSNP
rs1483748608 1127 dbSNP
rs1024945676 1131 dbSNP
rs149461206 1132 dbSNP
rs1194265480 1134 dbSNP
rs1366868218 1137 dbSNP
rs1039149952 1144 dbSNP
rs1410575274 1149 dbSNP
rs983937262 1149 dbSNP
rs571997155 1164 dbSNP
rs373071304 1166 dbSNP
rs1461697584 1167 dbSNP
rs907984873 1176 dbSNP
rs888101724 1180 dbSNP
rs1413094455 1181 dbSNP
rs1350626641 1184 dbSNP
rs1473826033 1190 dbSNP
rs753785501 1192 dbSNP
rs973575812 1194 dbSNP
rs1287378716 1195 dbSNP
rs1384674675 1201 dbSNP
rs1257363836 1206 dbSNP
rs1207838199 1208 dbSNP
rs1311373537 1209 dbSNP
rs544551154 1215 dbSNP
rs1230151671 1216 dbSNP
rs922110008 1221 dbSNP
rs182794130 1222 dbSNP
rs1390872104 1233 dbSNP
rs970598596 1234 dbSNP
rs1304808616 1237 dbSNP
rs143933270 1241 dbSNP
rs564418657 1242 dbSNP
rs1292122307 1245 dbSNP
rs1321870032 1250 dbSNP
rs1160281419 1256 dbSNP
rs372324890 1257 dbSNP
rs1459314782 1260 dbSNP
rs1157780409 1263 dbSNP
rs911557133 1263 dbSNP
rs1423884006 1266 dbSNP
rs140387824 1270 dbSNP
rs538472272 1271 dbSNP
rs1482684242 1279 dbSNP
rs1248441885 1286 dbSNP
rs757151859 1287 dbSNP
rs1210305415 1293 dbSNP
rs1463529769 1306 dbSNP
rs1041846361 1308 dbSNP
rs1267395168 1310 dbSNP
rs543577044 1313 dbSNP
rs1322394799 1319 dbSNP
rs945456984 1322 dbSNP
rs1226826998 1329 dbSNP
rs6801185 1338 dbSNP
rs1000371085 1340 dbSNP
rs1321672088 1349 dbSNP
rs1055602962 1351 dbSNP
rs911894849 1351 dbSNP
rs74599818 1352 dbSNP
rs1288782605 1353 dbSNP
rs1217101861 1357 dbSNP
rs549468443 1359 dbSNP
rs1039285219 1360 dbSNP
rs1390383196 1363 dbSNP
rs922089858 1364 dbSNP
rs1024264989 1367 dbSNP
rs1187205043 1371 dbSNP
rs930846183 1373 dbSNP
rs970706910 1375 dbSNP
rs1489384858 1377 dbSNP
rs1267336880 1381 dbSNP
rs1219401885 1382 dbSNP
rs1359043747 1384 dbSNP
rs566083916 1385 dbSNP
rs1004911678 1402 dbSNP
rs1048615791 1403 dbSNP
rs776856019 1407 dbSNP
rs1157131918 1408 dbSNP
rs1015360081 1410 dbSNP
rs963467942 1411 dbSNP
rs1004375811 1413 dbSNP
rs973905652 1414 dbSNP
rs1300452429 1418 dbSNP
rs114466612 1420 dbSNP
rs953587872 1422 dbSNP
rs770143609 1426 dbSNP
rs1423425802 1439 dbSNP
rs776071020 1441 dbSNP
rs551830937 1444 dbSNP
rs945685595 1446 dbSNP
rs1199257760 1448 dbSNP
rs1303976456 1453 dbSNP
rs1265159430 1454 dbSNP
rs75444710 1459 dbSNP
rs925622578 1463 dbSNP
rs935729687 1467 dbSNP
rs1229556519 1468 dbSNP
rs1490202701 1469 dbSNP
rs74398326 1475 dbSNP
rs1207564520 1484 dbSNP
rs1340248703 1489 dbSNP
rs894309885 1490 dbSNP
rs1014129661 1498 dbSNP
rs61653672 1506 dbSNP
rs966792099 1512 dbSNP
rs887044680 1523 dbSNP
rs1004553353 1525 dbSNP
rs911874721 1531 dbSNP
rs1210048873 1533 dbSNP
rs536123084 1533 dbSNP
rs569841129 1541 dbSNP
rs1309247886 1543 dbSNP
rs1395261641 1545 dbSNP
rs1427456937 1545 dbSNP
rs966045091 1546 dbSNP
rs1467385280 1548 dbSNP
rs1375915084 1553 dbSNP
rs974958186 1554 dbSNP
rs1472838936 1558 dbSNP
rs922225878 1560 dbSNP
rs535330214 1564 dbSNP
rs1184371756 1567 dbSNP
rs758158959 1572 dbSNP
rs1014895008 1573 dbSNP
rs369424496 1574 dbSNP
rs1250040622 1576 dbSNP
rs763766246 1578 dbSNP
rs899165443 1585 dbSNP
rs1201454918 1586 dbSNP
rs372716199 1591 dbSNP
rs994930311 1592 dbSNP
rs1049193187 1599 dbSNP
rs1175561537 1599 dbSNP
rs555436670 1600 dbSNP
rs1330378422 1610 dbSNP
rs908047554 1613 dbSNP
rs1160751682 1614 dbSNP
rs1393627807 1616 dbSNP
rs1434538239 1618 dbSNP
rs953535549 1621 dbSNP
rs987623266 1622 dbSNP
rs1019089779 1629 dbSNP
rs1175393742 1630 dbSNP
rs1457720981 1646 dbSNP
rs571835718 1647 dbSNP
rs967626520 1656 dbSNP
rs1361434367 1657 dbSNP
rs540609712 1660 dbSNP
rs1363502439 1662 dbSNP
rs1449495607 1663 dbSNP
rs557348494 1680 dbSNP
rs779894631 1681 dbSNP
rs1203382725 1682 dbSNP
rs1465785932 1686 dbSNP
rs925601646 1687 dbSNP
rs1221632236 1698 dbSNP
rs935704449 1699 dbSNP
rs1037210128 1704 dbSNP
rs1284205711 1705 dbSNP
rs1375591208 1706 dbSNP
rs1447055207 1707 dbSNP
rs906193484 1713 dbSNP
rs1311049382 1716 dbSNP
rs1335893126 1724 dbSNP
rs1435501293 1728 dbSNP
rs1003250631 1734 dbSNP
rs1390826830 1734 dbSNP
rs1218463176 1740 dbSNP
rs115029556 1741 dbSNP
rs1183410576 1742 dbSNP
rs1250223698 1742 dbSNP
rs1450477889 1742 dbSNP
rs34838105 1742 dbSNP
rs397730091 1742 dbSNP
rs1214279676 1748 dbSNP
rs1313895884 1755 dbSNP
rs1202430696 1759 dbSNP
rs1232372526 1763 dbSNP
rs1356871407 1764 dbSNP
rs1313916527 1767 dbSNP
rs577889917 1768 dbSNP
rs1011254246 1769 dbSNP
rs1022105429 1771 dbSNP
rs1268132665 1771 dbSNP
rs1350350087 1778 dbSNP
rs949844752 1781 dbSNP
rs1407124645 1787 dbSNP
rs1045563638 1795 dbSNP
rs886951351 1801 dbSNP
rs1163189541 1807 dbSNP
rs1430567063 1808 dbSNP
rs966969781 1810 dbSNP
rs1185092523 1811 dbSNP
rs142774681 1817 dbSNP
rs1454076246 1818 dbSNP
rs144887444 1821 dbSNP
rs899158009 1826 dbSNP
rs966013853 1830 dbSNP
rs1205437955 1832 dbSNP
rs1343811592 1837 dbSNP
rs1270656066 1839 dbSNP
rs376866867 1840 dbSNP
rs1368267348 1846 dbSNP
rs1276542964 1847 dbSNP
rs750122722 1850 dbSNP
rs921942574 1854 dbSNP
rs952299774 1860 dbSNP
rs1302582569 1867 dbSNP
rs750959059 1867 dbSNP
rs1029015554 1868 dbSNP
rs868189370 1870 dbSNP
rs1168822910 1871 dbSNP
rs1409741209 1872 dbSNP
rs985462856 1876 dbSNP
rs908015881 1879 dbSNP
rs139669662 1880 dbSNP
rs1008949156 1881 dbSNP
rs559779499 1883 dbSNP
rs967952009 1890 dbSNP
rs1203644420 1891 dbSNP
rs762841787 1894 dbSNP
rs939092748 1896 dbSNP
rs1280389429 1897 dbSNP
rs1221643328 1901 dbSNP
rs1054767608 1906 dbSNP
rs188446836 1907 dbSNP
rs766184110 1912 dbSNP
rs1033712072 1917 dbSNP
rs1368341591 1931 dbSNP
rs12633446 1939 dbSNP
rs1441669607 1942 dbSNP
rs13095055 1944 dbSNP
rs902336501 1949 dbSNP
rs915596377 1952 dbSNP
rs1429178190 1956 dbSNP
rs1159310453 1959 dbSNP
rs1369551437 1963 dbSNP
rs1405416714 1963 dbSNP
rs1176283564 1970 dbSNP
rs142650458 1971 dbSNP
rs151014426 1975 dbSNP
rs981193796 1976 dbSNP
rs908370849 1988 dbSNP
rs1268685489 1989 dbSNP
rs1318826187 1992 dbSNP
rs1436696621 1996 dbSNP
rs1018735846 1999 dbSNP
rs939884238 2007 dbSNP
rs1317670642 2008 dbSNP
rs1257401125 2009 dbSNP
rs1406086564 2013 dbSNP
rs901900767 2015 dbSNP
rs12633431 2018 dbSNP
rs1200632099 2019 dbSNP
rs535635384 2028 dbSNP
rs1271428317 2029 dbSNP
rs1386670378 2038 dbSNP
rs1181597154 2040 dbSNP
rs76420949 2048 dbSNP
rs1248348576 2056 dbSNP
rs1210516129 2058 dbSNP
rs779278509 2062 dbSNP
rs1050358233 2063 dbSNP
rs1259063345 2067 dbSNP
rs565395065 2073 dbSNP
rs74793792 2079 dbSNP
rs1040474605 2085 dbSNP
rs1474653344 2087 dbSNP
rs1015633442 2089 dbSNP
rs1298712251 2097 dbSNP
rs1384441489 2105 dbSNP
rs962324855 2106 dbSNP
rs1287820702 2113 dbSNP
rs981575939 2114 dbSNP
rs928801807 2117 dbSNP
rs1161297086 2125 dbSNP
rs758033805 2125 dbSNP
rs939059909 2126 dbSNP
rs1195004692 2132 dbSNP
rs903342487 2133 dbSNP
rs1260921388 2135 dbSNP
rs868226820 2137 dbSNP
rs1172210575 2148 dbSNP
rs1293972804 2149 dbSNP
rs1391723213 2151 dbSNP
rs1033244471 2152 dbSNP
rs777495579 2153 dbSNP
rs1358933742 2154 dbSNP
rs1275856545 2163 dbSNP
rs11129881 2164 dbSNP
rs1351387636 2166 dbSNP
rs140351214 2174 dbSNP
rs538820681 2175 dbSNP
rs139239287 2176 dbSNP
rs981182459 2177 dbSNP
rs908317898 2184 dbSNP
rs1372495509 2188 dbSNP
rs1176726435 2189 dbSNP
rs780330679 2191 dbSNP
rs79964401 2196 dbSNP
rs919783480 2198 dbSNP
rs114429323 2199 dbSNP
rs749781956 2201 dbSNP
rs769352957 2207 dbSNP
rs768158342 2214 dbSNP
rs1439974382 2217 dbSNP
rs1157663597 2219 dbSNP
rs1049635366 2220 dbSNP
rs543168969 2221 dbSNP
rs192125520 2222 dbSNP
rs901699623 2223 dbSNP
rs996197316 2224 dbSNP
rs1234641990 2225 dbSNP
rs1312257653 2225 dbSNP
rs114885572 2227 dbSNP
rs562930814 2228 dbSNP
rs138323159 2229 dbSNP
rs370667080 2229 dbSNP
rs887784659 2229 dbSNP
rs944742552 2232 dbSNP
rs1308929515 2235 dbSNP
rs761556384 2238 dbSNP
rs1239764882 2239 dbSNP
rs1307339582 2241 dbSNP
rs1040444648 2242 dbSNP
rs903288795 2244 dbSNP
rs962581863 2248 dbSNP
rs1444583124 2262 dbSNP
rs981709877 2263 dbSNP
rs1265404763 2265 dbSNP
rs1427072580 2265 dbSNP
rs1487817177 2268 dbSNP
rs769612893 2274 dbSNP
rs1035842169 2278 dbSNP
rs998965103 2279 dbSNP
rs1364397208 2282 dbSNP
rs1184254278 2287 dbSNP
rs773121395 2288 dbSNP
rs1378038460 2289 dbSNP
rs1425059123 2295 dbSNP
rs958891031 2298 dbSNP
rs1367346180 2302 dbSNP
rs545535860 2304 dbSNP
rs796333583 2305 dbSNP
rs1400845400 2309 dbSNP
rs1445677655 2310 dbSNP
rs1329591257 2313 dbSNP
rs1385217386 2315 dbSNP
rs1396798980 2317 dbSNP
rs565414239 2319 dbSNP
rs149977818 2326 dbSNP
rs1334758074 2327 dbSNP
rs1313206873 2331 dbSNP
rs1454370579 2334 dbSNP
rs1403887069 2338 dbSNP
rs1360990427 2339 dbSNP
rs550744732 2340 dbSNP
rs1385802866 2341 dbSNP
rs971040567 2343 dbSNP
rs1160321215 2346 dbSNP
rs923642866 2354 dbSNP
rs935223242 2354 dbSNP
rs1339921743 2355 dbSNP
rs866892365 2357 dbSNP
rs1241626154 2362 dbSNP
rs1203595582 2365 dbSNP
rs1002564514 2369 dbSNP
rs1245639223 2370 dbSNP
rs563590006 2371 dbSNP
rs961389279 2376 dbSNP
rs371101749 2377 dbSNP
rs541691592 2384 dbSNP
rs953919777 2385 dbSNP
rs146557563 2388 dbSNP
rs1287188225 2390 dbSNP
rs1489500684 2399 dbSNP
rs985334414 2401 dbSNP
rs1431419422 2402 dbSNP
rs183890889 2403 dbSNP
rs912507396 2405 dbSNP
rs1320415580 2407 dbSNP
rs887826963 2408 dbSNP
rs1209331790 2421 dbSNP
rs1164468305 2422 dbSNP
rs1426717107 2426 dbSNP
rs1256100866 2427 dbSNP
rs944690098 2431 dbSNP
rs1187641385 2434 dbSNP
rs1040752509 2436 dbSNP
rs1238785383 2442 dbSNP
rs75337936 2444 dbSNP
rs1157742070 2450 dbSNP
rs760342281 2451 dbSNP
rs1190467671 2453 dbSNP
rs145080197 2454 dbSNP
rs1171625677 2456 dbSNP
rs115506358 2457 dbSNP
rs1224289551 2458 dbSNP
rs1356764484 2462 dbSNP
rs893302665 2473 dbSNP
rs958857238 2477 dbSNP
rs1013049299 2482 dbSNP
rs775632017 2486 dbSNP
rs1021803007 2488 dbSNP
rs1339944320 2495 dbSNP
rs537043809 2507 dbSNP
rs1363924352 2512 dbSNP
rs1407022277 2512 dbSNP
rs1334129079 2513 dbSNP
rs1163415268 2516 dbSNP
rs187859099 2519 dbSNP
rs907431537 2522 dbSNP
rs1003140279 2531 dbSNP
rs1356241129 2533 dbSNP
rs574231014 2547 dbSNP
rs1475350331 2550 dbSNP
rs1269003501 2551 dbSNP
rs1232597931 2552 dbSNP
rs896820864 2559 dbSNP
rs923581950 2559 dbSNP
rs995661498 2561 dbSNP
rs766177065 2566 dbSNP
rs953866341 2569 dbSNP
rs1270541307 2574 dbSNP
rs1346340795 2576 dbSNP
rs985281917 2579 dbSNP
rs1202760791 2582 dbSNP
rs956400734 2584 dbSNP
rs1019423447 2590 dbSNP
rs1280116931 2607 dbSNP
rs965235567 2612 dbSNP
rs975962310 2615 dbSNP
rs760947305 2620 dbSNP
rs1177600168 2626 dbSNP
rs755042642 2627 dbSNP
rs1443114202 2631 dbSNP
rs978040518 2634 dbSNP
rs1356671600 2635 dbSNP
rs1327211949 2642 dbSNP
rs924606929 2644 dbSNP
rs1196499223 2646 dbSNP
rs1479163396 2647 dbSNP
rs1427920465 2652 dbSNP
rs1177429258 2653 dbSNP
rs73080120 2654 dbSNP
rs1376917239 2656 dbSNP
rs1203534163 2661 dbSNP
rs1461746322 2665 dbSNP
rs1264909192 2668 dbSNP
rs1466485183 2669 dbSNP
rs909066908 2673 dbSNP
rs990628312 2675 dbSNP
rs914685329 2678 dbSNP
rs1375773117 2681 dbSNP
rs948801548 2685 dbSNP
rs1446501188 2686 dbSNP
rs536568276 2690 dbSNP
rs1174288515 2695 dbSNP
rs1044555248 2708 dbSNP
rs1394401495 2712 dbSNP
rs1339287091 2716 dbSNP
rs1468639578 2718 dbSNP
rs1358103725 2725 dbSNP
rs1159138189 2732 dbSNP
rs1402139366 2736 dbSNP
rs1405309711 2738 dbSNP
rs1176478192 2741 dbSNP
rs1445029838 2743 dbSNP
rs1465191570 2744 dbSNP
rs114550366 2745 dbSNP
rs1379405079 2750 dbSNP
rs753620257 2757 dbSNP
rs1037324430 2758 dbSNP
rs573460644 2760 dbSNP
rs1002915063 2768 dbSNP
rs1332102248 2775 dbSNP
rs1236026284 2779 dbSNP
rs1250175468 2780 dbSNP
rs1057155530 2785 dbSNP
rs1383993611 2787 dbSNP
rs894694671 2798 dbSNP
rs1451125926 2801 dbSNP
rs191589419 2804 dbSNP
rs896805329 2811 dbSNP
rs1288987397 2815 dbSNP
rs1454893834 2816 dbSNP
rs796162459 2820 dbSNP
rs1022187526 2821 dbSNP
rs376606519 2825 dbSNP
rs6771527 2826 dbSNP
rs1424855319 2832 dbSNP
rs1026673302 2835 dbSNP
rs889507126 2836 dbSNP
rs1006606112 2838 dbSNP
rs1161416783 2841 dbSNP
rs1019371467 2842 dbSNP
rs1001007226 2850 dbSNP
rs550491611 2851 dbSNP
rs978407864 2852 dbSNP
rs1266373507 2857 dbSNP
rs1030948891 2866 dbSNP
rs1187243402 2878 dbSNP
rs975688669 2880 dbSNP
rs956219073 2885 dbSNP
rs1200856469 2895 dbSNP
rs575690370 2902 dbSNP
rs1360381734 2910 dbSNP
rs1294470746 2912 dbSNP
rs544554191 2914 dbSNP
rs561128467 2915 dbSNP
rs1244202713 2916 dbSNP
rs1321719536 2918 dbSNP
rs529158169 2919 dbSNP
rs1296907507 2920 dbSNP
rs142887692 2925 dbSNP
rs1359288034 2930 dbSNP
rs548880183 2933 dbSNP
rs1367016415 2934 dbSNP
rs1405227971 2934 dbSNP
rs1301132387 2940 dbSNP
rs1373375501 2941 dbSNP
rs948750803 2941 dbSNP
rs980186166 2942 dbSNP
rs909026921 2943 dbSNP
rs1293197569 2944 dbSNP
rs941909323 2945 dbSNP
rs373694415 2950 dbSNP
rs1193014721 2962 dbSNP
rs1490587195 2964 dbSNP
rs146832826 2976 dbSNP
rs919302648 2983 dbSNP
rs1488359749 2985 dbSNP
rs1388909936 3005 dbSNP
rs757909329 3008 dbSNP
rs545782782 3013 dbSNP
rs1037676414 3018 dbSNP
rs1230287293 3018 dbSNP
rs564649428 3024 dbSNP
rs918868895 3037 dbSNP
rs1223584843 3040 dbSNP
rs931572960 3041 dbSNP
rs1278276418 3043 dbSNP
rs1300919267 3044 dbSNP
rs1385809720 3046 dbSNP
rs1396986820 3053 dbSNP
rs528247651 3054 dbSNP
rs1048019827 3057 dbSNP
rs1242134002 3058 dbSNP
rs1460448470 3059 dbSNP
rs1264518961 3062 dbSNP
rs1170149649 3069 dbSNP
rs1431470850 3070 dbSNP
rs1197060259 3073 dbSNP
rs868552945 3078 dbSNP
rs9846431 3079 dbSNP
rs796440048 3084 dbSNP
rs1197889640 3086 dbSNP
rs1456874603 3088 dbSNP
rs1211425077 3096 dbSNP
rs1260868650 3100 dbSNP
rs1204801937 3101 dbSNP
rs570998275 3110 dbSNP
rs79588538 3112 dbSNP
rs900990470 3114 dbSNP
rs1425828579 3117 dbSNP
rs904679904 3121 dbSNP
rs1389460369 3123 dbSNP
rs999071129 3124 dbSNP
rs1337331952 3125 dbSNP
rs1031810778 3132 dbSNP
rs1408412539 3136 dbSNP
rs1459709110 3141 dbSNP
rs1465763818 3143 dbSNP
rs1296751019 3144 dbSNP
rs1184492593 3146 dbSNP
rs1438238262 3149 dbSNP
rs1360366834 3152 dbSNP
rs1401111295 3155 dbSNP
rs999391725 3155 dbSNP
rs184102353 3160 dbSNP
rs892188236 3161 dbSNP
rs1275954489 3162 dbSNP
rs148982974 3165 dbSNP
rs957952771 3166 dbSNP
rs1010835943 3173 dbSNP
rs1237439854 3179 dbSNP
rs765229145 3181 dbSNP
rs1315411094 3187 dbSNP
rs1454556620 3188 dbSNP
rs910951972 3190 dbSNP
rs1332349327 3193 dbSNP
rs1321967507 3199 dbSNP
rs970086674 3208 dbSNP
rs1385685668 3209 dbSNP
rs1160517555 3215 dbSNP
rs1418053924 3220 dbSNP
rs1016222429 3221 dbSNP
rs536281536 3225 dbSNP
rs928731645 3229 dbSNP
rs750358498 3236 dbSNP
rs1265274516 3244 dbSNP
rs1186300890 3255 dbSNP
rs963628624 3256 dbSNP
rs971887923 3264 dbSNP
rs960465778 3269 dbSNP
rs143798625 3273 dbSNP
rs187265990 3283 dbSNP
rs931545826 3286 dbSNP
rs992935571 3288 dbSNP
rs1354231370 3290 dbSNP
rs1048628370 3293 dbSNP
rs148172130 3301 dbSNP
rs142022127 3304 dbSNP
rs1227982181 3314 dbSNP
rs1380055000 3316 dbSNP
rs1040754533 3318 dbSNP
rs900899066 3320 dbSNP
rs1304204254 3329 dbSNP
rs934921819 3336 dbSNP
rs1412005558 3341 dbSNP
rs999695532 3343 dbSNP
rs1163196868 3351 dbSNP
rs1052241269 3353 dbSNP
rs1374341723 3360 dbSNP
rs893634343 3363 dbSNP
rs901375580 3367 dbSNP
rs550365856 3368 dbSNP
rs1023589817 3369 dbSNP
rs888778540 3377 dbSNP
rs1454215617 3378 dbSNP
rs1306689333 3379 dbSNP
rs1341361097 3397 dbSNP
rs1459469273 3398 dbSNP
rs1280221388 3401 dbSNP
rs1216872153 3411 dbSNP
rs1340197582 3414 dbSNP
rs970032655 3415 dbSNP
rs1438798315 3420 dbSNP
rs751017806 3427 dbSNP
rs1348537485 3436 dbSNP
rs113571970 3439 dbSNP
rs963296835 3447 dbSNP
rs1399248797 3456 dbSNP
rs1167986768 3459 dbSNP
rs993432343 3463 dbSNP
rs1429295434 3466 dbSNP
rs1201173441 3474 dbSNP
rs1036117901 3476 dbSNP
rs1476809101 3481 dbSNP
rs1240637439 3490 dbSNP
rs1204920262 3500 dbSNP
rs1439560565 3501 dbSNP
rs1256067505 3504 dbSNP
rs1026133340 3527 dbSNP
rs960120942 3536 dbSNP
rs973234265 3539 dbSNP
rs762893597 3542 dbSNP
rs150086092 3545 dbSNP
rs992902710 3552 dbSNP
rs1209404776 3556 dbSNP
rs1256633638 3557 dbSNP
rs952919351 3558 dbSNP
rs1379500432 3560 dbSNP
rs984326051 3564 dbSNP
rs1329912021 3572 dbSNP
rs1465525693 3581 dbSNP
rs554913822 3583 dbSNP
rs191852336 3584 dbSNP
rs916034970 3587 dbSNP
rs970548476 3600 dbSNP
rs781024583 3601 dbSNP
rs1424026222 3605 dbSNP
rs540256469 3606 dbSNP
rs1471048472 3609 dbSNP
rs7628796 3610 dbSNP
rs528407975 3611 dbSNP
rs529489151 3615 dbSNP
rs976361230 3616 dbSNP
rs751172133 3626 dbSNP
rs748196115 3633 dbSNP
rs935056301 3634 dbSNP
rs1310720568 3638 dbSNP
rs1278199841 3643 dbSNP
rs1414393358 3647 dbSNP
rs1053331409 3649 dbSNP
rs1356329490 3664 dbSNP
rs1307466352 3665 dbSNP
rs1359211458 3669 dbSNP
rs1446758507 3669 dbSNP
rs922765560 3670 dbSNP
rs1304146246 3671 dbSNP
rs1470681283 3674 dbSNP
rs1358016017 3676 dbSNP
rs1328819593 3679 dbSNP
rs1159388467 3681 dbSNP
rs1052654172 3682 dbSNP
rs200017136 3688 dbSNP
rs1378280115 3695 dbSNP
rs1157791620 3697 dbSNP
rs1049887909 3716 dbSNP
rs893633341 3718 dbSNP
rs888838817 3720 dbSNP
rs1179981975 3725 dbSNP
rs1281057733 3730 dbSNP
rs1365278457 3731 dbSNP
rs946560922 3733 dbSNP
rs113048902 3734 dbSNP
rs905087263 3735 dbSNP
rs1196836708 3743 dbSNP
rs772212670 3744 dbSNP
rs1360876610 3749 dbSNP
rs1315440433 3753 dbSNP
rs1227046058 3755 dbSNP
rs1377835203 3756 dbSNP
rs564957226 3757 dbSNP
rs780586454 3758 dbSNP
rs1358204569 3762 dbSNP
rs895805598 3773 dbSNP
rs368498045 3784 dbSNP
rs28489421 3786 dbSNP
rs1026181190 3788 dbSNP
rs1369924576 3789 dbSNP
rs1162627645 3790 dbSNP
rs1245311549 3794 dbSNP
rs952865408 3800 dbSNP
rs984232741 3802 dbSNP
rs1026266945 3805 dbSNP
rs1018413309 3808 dbSNP
rs1490619011 3812 dbSNP
rs750550176 3812 dbSNP
rs964230599 3813 dbSNP
rs970145281 3818 dbSNP
rs1295729779 3819 dbSNP
rs147381528 3821 dbSNP
rs868355403 3826 dbSNP
rs1337685498 3828 dbSNP
rs1481093504 3829 dbSNP
rs567384998 3833 dbSNP
rs1405128825 3835 dbSNP
rs1392660425 3837 dbSNP
rs1457390336 3842 dbSNP
rs755588932 3842 dbSNP
rs922290722 3843 dbSNP
rs1355024738 3844 dbSNP
rs1171560216 3858 dbSNP
rs935026036 3865 dbSNP
rs1398991602 3866 dbSNP
rs1193243697 3867 dbSNP
rs529654718 3874 dbSNP
rs1189816896 3875 dbSNP
rs1330532279 3875 dbSNP
rs1201014858 3876 dbSNP
rs779443799 3889 dbSNP
rs1435541064 3892 dbSNP
rs946467679 3893 dbSNP
rs771128929 3903 dbSNP
rs1044891242 3906 dbSNP
rs1332443299 3913 dbSNP
rs1298999364 3914 dbSNP
rs1386004462 3916 dbSNP
rs1241761407 3917 dbSNP
rs533307377 3921 dbSNP
rs776401529 3938 dbSNP
rs939208836 3939 dbSNP
rs1056822813 3941 dbSNP
rs541832469 3950 dbSNP
rs759341289 3951 dbSNP
rs1174145850 3953 dbSNP
rs1318740497 3953 dbSNP
rs1379571629 3953 dbSNP
rs570311590 3954 dbSNP
rs139629536 3955 dbSNP
rs564591237 3959 dbSNP
rs911397649 3959 dbSNP
rs1200521538 3977 dbSNP
rs888504035 3980 dbSNP
rs539344363 3982 dbSNP
rs762322641 3983 dbSNP
rs1248901582 3988 dbSNP
rs1005602297 3991 dbSNP
rs1487586521 4004 dbSNP
rs1317319383 4011 dbSNP
rs943114481 4012 dbSNP
rs559166173 4015 dbSNP
rs964220633 4020 dbSNP
rs569366282 4025 dbSNP
rs369306121 4026 dbSNP
rs1404379159 4034 dbSNP
rs554742923 4034 dbSNP
rs998441271 4035 dbSNP
rs1465699202 4047 dbSNP
rs184400483 4057 dbSNP
rs956379212 4065 dbSNP
rs1160804675 4066 dbSNP
rs114982810 4069 dbSNP
rs553757220 4077 dbSNP
rs1022780980 4078 dbSNP
rs77385036 4085 dbSNP
rs1253399750 4089 dbSNP
rs1367294054 4092 dbSNP
rs1000280579 4093 dbSNP
rs967756462 4098 dbSNP
rs1287953287 4104 dbSNP
rs1237666912 4112 dbSNP
rs566369015 4117 dbSNP
rs1341153749 4121 dbSNP
rs1433014282 4122 dbSNP
rs1284727600 4128 dbSNP
rs1342377877 4134 dbSNP
rs926438921 4134 dbSNP
rs988740207 4135 dbSNP
rs939214416 4143 dbSNP
rs1056369009 4148 dbSNP
rs1418259407 4149 dbSNP
rs1360223880 4156 dbSNP
rs1164364164 4159 dbSNP
rs1366244816 4160 dbSNP
rs746359728 4169 dbSNP
rs1477975185 4173 dbSNP
rs373484641 4177 dbSNP
rs1047474354 4178 dbSNP
rs544920609 4185 dbSNP
rs1290282541 4186 dbSNP
rs1352013423 4187 dbSNP
rs1211609219 4189 dbSNP
rs1354145967 4192 dbSNP
rs888450072 4199 dbSNP
rs1216462167 4202 dbSNP
rs986139509 4206 dbSNP
rs1264570474 4218 dbSNP
rs1398330637 4223 dbSNP
rs911380645 4229 dbSNP
rs1005590706 4233 dbSNP
rs1437412736 4234 dbSNP
rs1194714552 4235 dbSNP
rs772492487 4247 dbSNP
rs1162195244 4265 dbSNP
rs1465690818 4266 dbSNP
rs899998582 4267 dbSNP
rs1425094117 4270 dbSNP
rs1472260243 4274 dbSNP
rs1163526090 4276 dbSNP
rs1190316378 4277 dbSNP
rs369566990 4283 dbSNP
rs1325837153 4284 dbSNP
rs1329641700 4284 dbSNP
rs1361500832 4284 dbSNP
rs1439043577 4284 dbSNP
rs1448121336 4284 dbSNP
rs1491041783 4284 dbSNP
rs201347537 4284 dbSNP
rs377428247 4284 dbSNP
rs386396427 4284 dbSNP
rs998784007 4285 dbSNP
rs1417651823 4286 dbSNP
rs1157931065 4290 dbSNP
rs1361091390 4291 dbSNP
rs941559114 4291 dbSNP
rs973172812 4299 dbSNP
rs1425428973 4303 dbSNP
rs35423614 4303 dbSNP
rs200495846 4304 dbSNP
rs1415249307 4305 dbSNP
rs565220771 4306 dbSNP
rs1476926777 4307 dbSNP
rs1332257513 4310 dbSNP
rs1245865860 4312 dbSNP
rs1459008780 4316 dbSNP
rs1340015628 4325 dbSNP
rs920297253 4327 dbSNP
rs957147294 4348 dbSNP
rs1009830262 4357 dbSNP
rs1221094246 4358 dbSNP
rs1343355416 4360 dbSNP
rs1303094944 4363 dbSNP
rs536509117 4364 dbSNP
rs1379748809 4365 dbSNP
rs1375095648 4366 dbSNP
rs1440846367 4376 dbSNP
rs533820300 4382 dbSNP
rs1021926777 4388 dbSNP
rs1239885560 4406 dbSNP
rs569706395 4409 dbSNP
rs1412360020 4410 dbSNP
rs1474186506 4417 dbSNP
rs149516234 4417 dbSNP
rs1199316242 4418 dbSNP
rs980507843 4424 dbSNP
rs1480354367 4426 dbSNP
rs926388530 4427 dbSNP
rs905696445 4438 dbSNP
rs767977715 4459 dbSNP
rs78576905 4464 dbSNP
rs1280144503 4466 dbSNP
rs558222620 4468 dbSNP
rs1241326144 4473 dbSNP
rs1356216976 4478 dbSNP
rs992374386 4478 dbSNP
rs1223670881 4484 dbSNP
rs1032853245 4486 dbSNP
rs539290788 4501 dbSNP
rs548950873 4504 dbSNP
rs891853855 4508 dbSNP
rs1437515261 4514 dbSNP
rs929177070 4521 dbSNP
rs529823900 4540 dbSNP
rs35080793 4550 dbSNP
rs1049007272 4556 dbSNP
rs114156109 4557 dbSNP
rs1380743721 4558 dbSNP
rs1471116338 4575 dbSNP
rs1158317173 4579 dbSNP
rs1170788097 4582 dbSNP
rs941394612 4586 dbSNP
rs780398982 4604 dbSNP
rs1401556942 4610 dbSNP
rs1415140040 4621 dbSNP
rs1414691432 4624 dbSNP
rs955402129 4624 dbSNP
rs1471973218 4631 dbSNP
rs1338869984 4632 dbSNP
rs560211788 4635 dbSNP
rs1446398433 4636 dbSNP
rs1257084075 4640 dbSNP
rs1217546620 4642 dbSNP
rs985722640 4642 dbSNP
rs1018978736 4643 dbSNP
rs532819176 4646 dbSNP
rs1231685462 4654 dbSNP
rs190015301 4655 dbSNP
rs918770309 4661 dbSNP
rs747210322 4670 dbSNP
rs1278450961 4680 dbSNP
rs1343616257 4684 dbSNP
rs1203756781 4691 dbSNP
rs144068833 4696 dbSNP
rs1458400623 4696 dbSNP
rs983229700 4705 dbSNP
rs11285176 4726 dbSNP
rs1162523521 4726 dbSNP
rs1194696952 4726 dbSNP
rs1408988495 4726 dbSNP
rs397763579 4726 dbSNP
rs77775340 4726 dbSNP
rs75196417 4727 dbSNP
rs1478908411 4732 dbSNP
rs949796647 4737 dbSNP
rs1197695032 4741 dbSNP
rs1186279003 4744 dbSNP
rs892638325 4746 dbSNP
rs1010228182 4753 dbSNP
rs1250932018 4754 dbSNP
rs538050159 4758 dbSNP
rs767085368 4774 dbSNP
rs1420704842 4775 dbSNP
rs754183663 4786 dbSNP
rs755422951 4788 dbSNP
rs1333549314 4791 dbSNP
rs1258094945 4792 dbSNP
rs1044070406 4793 dbSNP
rs1315672621 4808 dbSNP
rs537506246 4818 dbSNP
rs1377004667 4830 dbSNP
rs935946822 4834 dbSNP
rs1054674271 4835 dbSNP
rs548801788 4847 dbSNP
rs1421662704 4850 dbSNP
rs1467432276 4851 dbSNP
rs1001892189 4854 dbSNP
rs1434128349 4856 dbSNP
rs568418392 4866 dbSNP
rs1332360141 4878 dbSNP
rs1269847101 4889 dbSNP
rs1317183383 4890 dbSNP
rs1468402202 4893 dbSNP
rs867104999 4894 dbSNP
rs1199981431 4902 dbSNP
rs1033360855 4903 dbSNP
rs534052534 4906 dbSNP
rs565571093 4912 dbSNP
rs1051156637 4915 dbSNP
rs148686619 4925 dbSNP
rs1225949125 4930 dbSNP
rs950614215 4931 dbSNP
rs1449095541 4933 dbSNP
rs1394349435 4934 dbSNP
rs1297839177 4941 dbSNP
rs779004042 4950 dbSNP
rs984659886 4953 dbSNP
rs1284638348 4961 dbSNP
rs576812834 4962 dbSNP
rs539478846 4971 dbSNP
rs963257817 4972 dbSNP
rs1180992668 4977 dbSNP
rs975355408 4986 dbSNP
rs1481454861 4987 dbSNP
rs1200717344 4993 dbSNP
rs921282619 5007 dbSNP
rs934029682 5011 dbSNP
rs1025805308 5014 dbSNP
rs558573334 5015 dbSNP
rs983196948 5031 dbSNP
rs1311389706 5034 dbSNP
rs1207855818 5040 dbSNP
rs1237803461 5042 dbSNP
rs1334085971 5043 dbSNP
rs1306340517 5056 dbSNP
rs1396875514 5071 dbSNP
rs916963029 5075 dbSNP
rs971181142 5080 dbSNP
rs1490492608 5084 dbSNP
rs1434507758 5090 dbSNP
rs892617638 5091 dbSNP
rs1161008778 5093 dbSNP
rs1469027327 5094 dbSNP
rs945554179 5104 dbSNP
rs796848442 5106 dbSNP
rs142241898 5113 dbSNP
rs544036652 5116 dbSNP
rs1054327859 5122 dbSNP
rs1254964360 5132 dbSNP
rs1002466381 5135 dbSNP
rs561139945 5136 dbSNP
rs1488507160 5139 dbSNP
rs1456656696 5140 dbSNP
rs1203356510 5147 dbSNP
rs1163024353 5153 dbSNP
rs201488365 5155 dbSNP
rs1245620614 5160 dbSNP
rs1357385887 5165 dbSNP
rs1366650588 5166 dbSNP
rs193204415 5169 dbSNP
rs1341566941 5188 dbSNP
rs762026709 5193 dbSNP
rs1296940144 5194 dbSNP
rs540345627 5197 dbSNP
rs1050887579 5205 dbSNP
rs747120202 5210 dbSNP
rs578007131 5211 dbSNP
rs371969867 5223 dbSNP
rs771127371 5233 dbSNP
rs1013745131 5243 dbSNP
rs1477923891 5244 dbSNP
rs1026093502 5248 dbSNP
rs950589071 5250 dbSNP
rs1025942404 5256 dbSNP
rs984566625 5257 dbSNP
rs1016063221 5258 dbSNP
rs964564374 5261 dbSNP
rs1025163399 5262 dbSNP
rs1264603148 5264 dbSNP
rs1359946038 5273 dbSNP
rs1272356947 5279 dbSNP
rs377472351 5283 dbSNP
rs560323000 5286 dbSNP
rs921261179 5287 dbSNP
rs776843227 5291 dbSNP
rs1324807221 5292 dbSNP
rs1487968098 5294 dbSNP
rs1391694811 5295 dbSNP
rs1163550682 5296 dbSNP
rs1465866896 5297 dbSNP
rs987274170 5300 dbSNP
rs1425333943 5305 dbSNP
rs914011453 5310 dbSNP
rs1422282787 5314 dbSNP
rs979901435 5315 dbSNP
rs532122575 5317 dbSNP
rs1200962155 5321 dbSNP
rs1467068639 5331 dbSNP
rs957093051 5334 dbSNP
rs990020960 5336 dbSNP
rs913109322 5337 dbSNP
rs1275396188 5339 dbSNP
rs1187156928 5350 dbSNP
rs1212976703 5350 dbSNP
rs1339173308 5353 dbSNP
rs1275775462 5354 dbSNP
rs1386228583 5354 dbSNP
rs1237203553 5355 dbSNP
rs537197871 5358 dbSNP
rs1369409016 5359 dbSNP
rs552194795 5360 dbSNP
rs374989632 5362 dbSNP
rs1355727572 5367 dbSNP
rs1050856277 5377 dbSNP
rs1360465343 5380 dbSNP
rs146545785 5387 dbSNP
rs942760031 5393 dbSNP
rs140025530 5399 dbSNP
rs898488387 5400 dbSNP
rs1179112367 5411 dbSNP
rs553689983 5412 dbSNP
rs1440422089 5414 dbSNP
rs896127948 5426 dbSNP
rs73080126 5431 dbSNP
rs1047102224 5441 dbSNP
rs1279848041 5447 dbSNP
rs1047870551 5450 dbSNP
rs534160804 5453 dbSNP
rs1213456764 5464 dbSNP
rs758559861 5469 dbSNP
rs887331209 5472 dbSNP
rs886159141 5478 dbSNP
rs547466308 5484 dbSNP
rs1311595150 5487 dbSNP
rs1374938850 5488 dbSNP
rs1277244528 5500 dbSNP
rs1441099215 5501 dbSNP
rs1359379177 5502 dbSNP
rs1314259458 5509 dbSNP
rs1383199330 5513 dbSNP
rs1374571228 5517 dbSNP
rs1247899525 5524 dbSNP
rs570659889 5526 dbSNP
rs144689421 5528 dbSNP
rs368005182 5528 dbSNP
rs1410314933 5533 dbSNP
rs1469876394 5534 dbSNP
rs905390617 5534 dbSNP
rs185734649 5535 dbSNP
rs964554490 5543 dbSNP
rs751316557 5544 dbSNP
rs1280026817 5551 dbSNP
rs1218054166 5554 dbSNP
rs996038331 5555 dbSNP
rs556531642 5565 dbSNP
rs77908780 5567 dbSNP
rs1379191181 5568 dbSNP
rs989740133 5568 dbSNP
rs76678608 5569 dbSNP
rs1446762221 5574 dbSNP
rs1294768305 5577 dbSNP
rs1412490164 5577 dbSNP
rs1298555925 5579 dbSNP
rs143650095 5579 dbSNP
rs538164084 5581 dbSNP
rs767236093 5584 dbSNP
rs912377370 5585 dbSNP
rs1418616063 5589 dbSNP
rs1194845181 5591 dbSNP
rs1257334347 5591 dbSNP
rs1474336506 5591 dbSNP
rs1487017664 5591 dbSNP
rs79376881 5591 dbSNP
rs942589512 5591 dbSNP
rs1256576741 5592 dbSNP
rs368780830 5592 dbSNP
rs377250363 5592 dbSNP
rs28450231 5593 dbSNP
rs60517442 5594 dbSNP
rs34796686 5595 dbSNP
rs78276982 5596 dbSNP
rs560284334 5597 dbSNP
rs577050964 5599 dbSNP
rs1406384227 5600 dbSNP
rs76047335 5605 dbSNP
rs75843282 5606 dbSNP
rs545439139 5610 dbSNP
rs185168796 5611 dbSNP
rs1395378472 5613 dbSNP
rs1460137093 5614 dbSNP
rs1165776735 5623 dbSNP
rs1306807534 5624 dbSNP
rs913900479 5625 dbSNP
rs919988682 5628 dbSNP
rs1430689153 5630 dbSNP
rs1417759625 5631 dbSNP
rs1186482415 5635 dbSNP
rs1469284040 5640 dbSNP
rs1254393880 5654 dbSNP
rs531879500 5656 dbSNP
rs562198362 5658 dbSNP
rs979552148 5665 dbSNP
rs1309089171 5672 dbSNP
rs9857976 5683 dbSNP
rs188424561 5704 dbSNP
rs1229094548 5706 dbSNP
rs181240608 5708 dbSNP
rs949604439 5711 dbSNP
rs925433904 5713 dbSNP
rs1373096385 5720 dbSNP
rs570572488 5733 dbSNP
rs1301081505 5735 dbSNP
rs1462820672 5742 dbSNP
rs1438823177 5746 dbSNP
rs1197027713 5748 dbSNP
rs938192719 5752 dbSNP
rs1237930784 5753 dbSNP
rs1002335789 5755 dbSNP
rs1179419097 5756 dbSNP
rs1032929507 5765 dbSNP
rs1423687674 5765 dbSNP
rs1397434022 5770 dbSNP
rs1192239458 5776 dbSNP
rs1453289017 5777 dbSNP
rs1055769187 5778 dbSNP
rs750933586 5780 dbSNP
rs1479447412 5781 dbSNP
rs1250615605 5789 dbSNP
rs1210569049 5791 dbSNP
rs949683697 5795 dbSNP
rs1349718158 5797 dbSNP
rs1301191038 5800 dbSNP
rs7627564 5810 dbSNP
rs549879120 5811 dbSNP
rs755877348 5813 dbSNP
rs1393413545 5819 dbSNP
rs886106893 5821 dbSNP
rs116741544 5824 dbSNP
rs535515952 5825 dbSNP
rs1435742821 5830 dbSNP
rs1470735582 5834 dbSNP
rs900330273 5840 dbSNP
rs377258935 5842 dbSNP
rs1328935317 5844 dbSNP
rs1353659212 5847 dbSNP
rs145369776 5848 dbSNP
rs1416728074 5856 dbSNP
rs765668373 5860 dbSNP
rs1030596713 5866 dbSNP
rs964314094 5870 dbSNP
rs753073804 5873 dbSNP
rs919774902 5875 dbSNP
rs1351289984 5886 dbSNP
rs1222898416 5889 dbSNP
rs149218418 5890 dbSNP
rs758933411 5892 dbSNP
rs1306585659 5894 dbSNP
rs778160507 5896 dbSNP
rs1325811339 5898 dbSNP
rs533964212 5899 dbSNP
rs377662454 5903 dbSNP
rs1160743431 5912 dbSNP
rs186780113 5928 dbSNP
rs1362672931 5931 dbSNP
rs1165249727 5934 dbSNP
rs1046831754 5936 dbSNP
rs926857609 5937 dbSNP
rs1245407206 5948 dbSNP
rs1488439912 5949 dbSNP
rs938275242 5951 dbSNP
rs1053934187 5954 dbSNP
rs979498392 5956 dbSNP
rs758844878 5958 dbSNP
rs1234195045 5959 dbSNP
rs576962514 5959 dbSNP
rs780306060 5962 dbSNP
rs1291597964 5965 dbSNP
rs191775368 5968 dbSNP
rs990976049 5969 dbSNP
rs745637329 5970 dbSNP
rs1410267721 5971 dbSNP
rs1327345498 5972 dbSNP
rs1172264270 5974 dbSNP
rs1347943590 5978 dbSNP
rs1041488540 5988 dbSNP
rs918085953 5989 dbSNP
rs1303711365 5999 dbSNP
rs1475631528 6003 dbSNP
rs1374540619 6004 dbSNP
rs902944073 6012 dbSNP
rs184019733 6014 dbSNP
rs1007860604 6022 dbSNP
rs1347424322 6024 dbSNP
rs556022971 6028 dbSNP
rs1048488589 6029 dbSNP
rs1019711453 6030 dbSNP
rs1469835360 6033 dbSNP
rs1271533179 6034 dbSNP
rs1209429511 6040 dbSNP
rs1340552407 6043 dbSNP
rs1362899870 6048 dbSNP
rs907538290 6057 dbSNP
rs1365091512 6063 dbSNP
rs1304716847 6066 dbSNP
rs575973206 6073 dbSNP
rs146905776 6074 dbSNP
rs1324839255 6076 dbSNP
rs781344888 6079 dbSNP
rs552610163 6082 dbSNP
rs900237239 6102 dbSNP
rs1359239134 6104 dbSNP
rs1223818313 6110 dbSNP
rs1294627513 6113 dbSNP
rs1490678299 6118 dbSNP
rs1474923071 6122 dbSNP
rs931736373 6124 dbSNP
rs1395626529 6125 dbSNP
rs1051567775 6126 dbSNP