miRTarBase - #MIRT537815 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EFNB2   
Synonyms EPLG5, HTKL, Htk-L, LERK5
Description ephrin B2
Transcript NM_004093   
Expression
Putative miRNA Targets on EFNB2
3'UTR of EFNB2
(miRNA target sites are highlighted)
>EFNB2|NM_004093|3'UTR
   1 GAGGGACCCTGGTGGTACCTGTGCTTTCCCAGAGGACACCTAATGTCCCGATGCCTCCCTTGAGGGTTTGAGAGCCCGCG
  81 TGCTGGAGAATTGACTGAAGCACAGCACCGGGGGAGAGGGACACTCCTCCTCGGAAGAGCCCGTCGCGCTGGACAGCTTA
 161 CCTAGTCTTGTAGCATTCGGCCTTGGTGAACACACACGCTCCCTGGAAGCTGGAAGACTGTGCAGAAGACGCCCATTCGG
 241 ACTGCTGTGCCGCGTCCCACGTCTCCTCCTCGAAGCCATGTGCTGCGGTCACTCAGGCCTCTGCAGAAGCCAAGGGAAGA
 321 CAGTGGTTTGTGGACGAGAGGGCTGTGAGCATCCTGGCAGGTGCCCCAGGATGCCACGCCTGGAAGGGCCGGCTTCTGCC
 401 TGGGGTGCATTTCCCCCGCAGTGCATACCGGACTTGTCACACGGACCTCGGGCTAGTTAAGGTGTGCAAAGATCTCTAGA
 481 GTTTAGTCCTTACTGTCTCACTCGTTCTGTTACCCAGGGCTCTGCAGCACCTCACCTGAGACCTCCACTCCACATCTGCA
 561 TCACTCATGGAACACTCATGTCTGGAGTCCCCTCCTCCAGCCGCTGGCAACAACAGCTTCAGTCCATGGGTAATCCGTTC
 641 ATAGAAATTGTGTTTGCTAACAAGGTGCCCTTTAGCCAGATGCTAGGCTGTCTGCGAAGAAGGCTAGGAGTTCATAGAAG
 721 GGAGTGGGGCTGGGGAAAGGGCTGGCTGCAATTGCAGCTCACTGCTGCTGCCTCTGAAACAGAAAGTTGGAAAGGAAAAA
 801 AGAAAAAAGCAATTAGGTAGCACAGCACTTTGGTTTTGCTGAGATCGAAGAGGCCAGTAGGAGACACGACAGCACACACA
 881 GTGGATTCCAGTGCATGGGGAGGCACTCGCTGTTATCAAATAGCGATGTGCAGGAAGAAAAGCCCCTCTTCATTCCGGGG
 961 AACAAAGACGGGTATTGTTGGGAAAGGAACAGGCTTGGAGGGAAGGGAGAAAGTAGGCCGCTGATGATATATTCGGGCAG
1041 GACTGTTGTGGTACTGGCAATAAGATACACAGCTCCGAGCTGTAGGAGAGTCGGTCTGCTTTGGATGATTTTTTAAGCAG
1121 ACTCAGCTGCTATACTTATCACATTTTATTAAACACAGGGAAAGCATTTAGGAGAATAGCAGAGAGCCAAATCTGACCTA
1201 AAAGTTGAAAAGCCAAAGGTCAAACAGGCTGTAATTCCATCATCATCGTTGTTATTAAAGAATCCTTATCTATAAAAGGT
1281 AGGTCAGATCCCCCTCCCCCCAGGTTCCTCCTTCCCCTCCCGATTGAGCCTTACGACACTTTGGTTTATGCGGTGCTGTC
1361 CGGGTGCCAGGGCTGCAGGGTCGGTACTGATGGAGGCTGCAGCGCCCGGTGCTCTGTGTCAAGGTGAAGCACATACGGCA
1441 GACCTCTTAGAGTCCTTAAGACGGAAGTAAATTATGATGTCCAGGGGGAGAAGGAAGATAGGACGTATTTATAATAGGTA
1521 TATAGAACACAAGGGATATAAAATGAAAGATTTTTACTAATATATATTTTAAGGTTGCACACAGTACACACCAGAAGATG
1601 TGAAATTCATTTGTGGCAATTAAGTGGTCCCAATGCTCAGCGCTTAAAAAAACAAATTGGACAGCTACTTCTGGGAAAAA
1681 CAACATCATTCCAAAAAGAACAATAATGAGAGCAAATGCAAAAATAACCAAGTCCTCCGAAGGCATCTCACGGAACCGTA
1761 GACTAGGAAGTACGAGCCCCACAGAGCAGGAAGCCGATGTGACTGCATCATATATTTAACAATGACAAGATGTTCCGGCG
1841 TTTATTTCTGCGTTGGGTTTTCCCTTGCCTTATGGGCTGAAGTGTTCTCTAGAATCCAGCAGGTCACACTGGGGGCTTCA
1921 GGTGACGATTTAGCTGTGGCTCCCTCCTCCTGTCCTCCCCCGCACCCCCTCCCTTCTGGGAAACAAGAAGAGTAAACAGG
2001 AAACCTACTTTTTATGTGCTATGCAAAATAGACATCTTTAACATAGTCCTGTTACTATGGTAACACTTTGCTTTCTGAAT
2081 TGGAAGGGAAAAAAAATGTAGCGACAGCATTTTAAGGTTCTCAGACCTCCAGTGAGTACCTGCAAAAATGAGTTGTCACA
2161 GAAATTATGATCCTCTATTTCCTGAACCTGGAAATGATGTTGGTCCAAAGTGCGTGTGTGTATGTGTGAGTGGGTGCGTG
2241 GTATACATGTGTACATATATGTATAATATATATCTACAATATATATTATATATATCTATATCATATTTCTGTGGAGGGTT
2321 GCCATGGTAACCAGCCACAGTACATATGTAATTCTTTCCATCACCCCAACCTCTCCTTTCTGTGCATTCATGCAAGAGTT
2401 TCTTGTAAGCCATCAGAAGTTACTTTTAGGATGGGGGAGAGGGGCGAGAAGGGGAAAAATGGGAAATAGTCTGATTTTAA
2481 TGAAATCAAATGTATGTATCATCAGTTGGCTACGTTTTGGTTCTATGCTAAACTGTGAAAAATCAGATGAATTGATAAAA
2561 GAGTTCCCTGCAACCAATTGAAAAGTGTTCTGTGCGTCTGTTTTGTGTCTGGTGCAGAATATGACAATCTACCAACTGTC
2641 CCTTTGTTTGAAGTTGGTTTAGCTTTGGAAAGTTACTGTAAATGCCTTGCTTGTATGATCGTCCCTGGTCACCCGACTTT
2721 GGAATTTGCACCATCATGTTTCAGTGAAGATGCTGTAAATAGGTTCAGATTTTACTGTCTATGGATTTGGGGTGTTACAG
2801 TAGCCTTATTCACCTTTTTAATAAAAATACACATGAAAACAAGAAAGAAATGGCTTTTCTTACCCAGATTGTGTACATAG
2881 AGCAATGTTGGTTTTTTATAAAGTCTAAGCAAGATGTTTTGTATAAAATCTGAATTTTGCAATGTATTTAGCTACAGCTT
2961 GTTTAACGGCAGTGTCATTCCCCTTTGCACTGTAATGAGGAAAAAATGGTATAAAAGGTTGCCAAATTGCTGCATATTTG
3041 TGCCGTAATTATGTACCATGAATATTTATTTAAAATTTCGTTGTCCAATTTGTAAGTAACACAGTATTATGCCTGAGTTA
3121 TAAATATTTTTTTCTTTCTTTGTTTTATTTTAATAGCCTGTCATAGGTTTTAAATCTGCTTTAGTTTCACATTGCAGTTA
3201 GCCCCAGAAAATGAAATCCGTGAAGTCACATTCCACATCTGTTTCAAACTGAATTTGTTCTTAAAAAAATAAAATATTTT
3281 TTTCCTATGGAAAAAGTGCCTTCAAAGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             ||:||   |||||||||  
Target 5' tcgAAGCC---ATGTGCTGCgg 3'
270 - 288 144.00 -16.00
2
miRNA  3' guGUU--UGGUAAUACACGACGAu 5'
            |||  :| : |   ||||||| 
Target 5' tgCAATTGCAGCTCACTGCTGCTg 3'
747 - 770 142.00 -12.20
3
miRNA  3' guguuUGGUAAUACACGACGau 5'
               :|||  || ||||||  
Target 5' aggttGCCA-AAT-TGCTGCat 3'
3016 - 3035 127.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31493359 23 COSMIC
COSN30457732 49 COSMIC
COSN30506734 77 COSMIC
COSN26974636 79 COSMIC
COSN30492912 93 COSMIC
COSN13429856 132 COSMIC
COSN30103554 133 COSMIC
COSN30149513 137 COSMIC
COSN30144727 139 COSMIC
COSN25230857 272 COSMIC
COSN31515601 825 COSMIC
COSN31490298 863 COSMIC
COSN31490903 868 COSMIC
COSN31488268 948 COSMIC
COSN30163461 970 COSMIC
COSN26645536 1007 COSMIC
COSN31658148 1076 COSMIC
COSN26583716 1077 COSMIC
COSN31595402 1100 COSMIC
COSN31486957 1102 COSMIC
COSN31513212 1114 COSMIC
COSN27333985 1190 COSMIC
COSN31595922 1252 COSMIC
COSN31611266 1334 COSMIC
COSN5875484 1407 COSMIC
COSN20131253 1422 COSMIC
COSN31545415 1515 COSMIC
COSN31544158 1525 COSMIC
COSN31518579 1641 COSMIC
COSN17037542 1739 COSMIC
COSN31578740 1758 COSMIC
COSN7391853 1790 COSMIC
COSN31552477 1808 COSMIC
COSN31514901 1837 COSMIC
COSN31597225 1876 COSMIC
COSN25951152 1944 COSMIC
COSN26564975 1984 COSMIC
COSN31485989 2012 COSMIC
COSN26671260 2076 COSMIC
COSN20110983 2088 COSMIC
COSN31536135 2107 COSMIC
COSN29172577 2445 COSMIC
COSN5334008 2471 COSMIC
COSN17182053 2554 COSMIC
COSN1599543 2571 COSMIC
COSN22565243 2599 COSMIC
COSN20677250 2716 COSMIC
COSN18913009 2735 COSMIC
COSN28665650 2845 COSMIC
COSN16076754 2861 COSMIC
COSN5875483 2866 COSMIC
COSN5334007 2923 COSMIC
COSN31547281 3073 COSMIC
COSN5722069 3155 COSMIC
COSN32064804 3238 COSMIC
COSN28201757 3257 COSMIC
COSN30538664 3282 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs771389582 1 dbSNP
rs778078295 8 dbSNP
rs756424821 9 dbSNP
rs752849130 14 dbSNP
rs377602354 18 dbSNP
rs1331980309 24 dbSNP
rs1435335783 29 dbSNP
rs755013813 30 dbSNP
rs751647102 33 dbSNP
rs1373720074 36 dbSNP
rs766438398 40 dbSNP
rs758390429 42 dbSNP
rs1165550127 43 dbSNP
rs1410737891 44 dbSNP
rs1472113649 46 dbSNP
rs750286889 47 dbSNP
rs771536266 49 dbSNP
rs945913681 50 dbSNP
rs1345155096 52 dbSNP
rs546052825 53 dbSNP
rs1199477496 72 dbSNP
rs1404358819 75 dbSNP
rs1448406985 77 dbSNP
rs191693363 78 dbSNP
rs558118969 79 dbSNP
rs573369301 80 dbSNP
rs958854366 89 dbSNP
rs927359074 91 dbSNP
rs74444474 93 dbSNP
rs544759056 96 dbSNP
rs537317777 103 dbSNP
rs1422767728 109 dbSNP
rs778447773 110 dbSNP
rs1320242751 111 dbSNP
rs1191408198 115 dbSNP
rs1012769087 119 dbSNP
rs1478925854 124 dbSNP
rs777267114 127 dbSNP
rs894437943 129 dbSNP
rs768156053 132 dbSNP
rs1026640558 133 dbSNP
rs952292858 133 dbSNP
rs1002622544 142 dbSNP
rs903033183 143 dbSNP
rs995121032 145 dbSNP
rs1317855029 146 dbSNP
rs575805487 147 dbSNP
rs571385795 148 dbSNP
rs1039877438 151 dbSNP
rs1225879726 170 dbSNP
rs893787101 178 dbSNP
rs890963211 179 dbSNP
rs551530122 181 dbSNP
rs536066094 191 dbSNP
rs1328932255 193 dbSNP
rs1332812793 195 dbSNP
rs1426978379 196 dbSNP
rs374833315 198 dbSNP
rs1465745394 199 dbSNP
rs1398916359 203 dbSNP
rs945987057 212 dbSNP
rs115514643 219 dbSNP
rs1416080918 222 dbSNP
rs114841344 230 dbSNP
rs977007352 231 dbSNP
rs1335126082 232 dbSNP
rs559557928 238 dbSNP
rs908719358 239 dbSNP
rs1252711539 240 dbSNP
rs1436174190 244 dbSNP
rs1181610469 249 dbSNP
rs981939826 252 dbSNP
rs982541223 253 dbSNP
rs1186235339 254 dbSNP
rs1457420213 256 dbSNP
rs1236394821 259 dbSNP
rs952594339 260 dbSNP
rs1026606481 261 dbSNP
rs1427230365 263 dbSNP
rs550544383 271 dbSNP
rs528623581 272 dbSNP
rs1035546904 279 dbSNP
rs1003216720 281 dbSNP
rs903001743 286 dbSNP
rs1353275441 287 dbSNP
rs1311091008 288 dbSNP
rs900988194 289 dbSNP
rs1163200549 290 dbSNP
rs567823479 292 dbSNP
rs1252977116 294 dbSNP
rs1009649689 296 dbSNP
rs893915680 313 dbSNP
rs1204517645 318 dbSNP
rs1328630022 319 dbSNP
rs1281197504 324 dbSNP
rs1017906824 328 dbSNP
rs1008397575 330 dbSNP
rs1450166171 335 dbSNP
rs547844614 336 dbSNP
rs1175106348 345 dbSNP
rs1429462899 351 dbSNP
rs932597437 356 dbSNP
rs1195836547 358 dbSNP
rs369018837 366 dbSNP
rs559875118 367 dbSNP
rs893085083 373 dbSNP
rs757063001 377 dbSNP
rs1436154324 378 dbSNP
rs908693269 382 dbSNP
rs1382542550 383 dbSNP
rs559479795 390 dbSNP
rs552226217 391 dbSNP
rs1362926311 394 dbSNP
rs370490513 399 dbSNP
rs1183630062 403 dbSNP
rs761071036 405 dbSNP
rs919643135 406 dbSNP
rs1483874043 417 dbSNP
rs937247575 418 dbSNP
rs557923151 422 dbSNP
rs1486356250 426 dbSNP
rs1207251166 427 dbSNP
rs9652138 429 dbSNP
rs958336775 430 dbSNP
rs764018350 442 dbSNP
rs981363095 443 dbSNP
rs967736739 446 dbSNP
rs544622156 449 dbSNP
rs1011788769 450 dbSNP
rs1454045290 453 dbSNP
rs957192257 465 dbSNP
rs866127804 471 dbSNP
rs930829805 472 dbSNP
rs920734255 475 dbSNP
rs1306458652 483 dbSNP
rs1229478016 492 dbSNP
rs1373154471 498 dbSNP
rs1379246527 499 dbSNP
rs549286194 504 dbSNP
rs996949173 527 dbSNP
rs1470833387 528 dbSNP
rs899822560 533 dbSNP
rs1317687223 542 dbSNP
rs1445683790 548 dbSNP
rs1266582573 549 dbSNP
rs1041091735 560 dbSNP
rs1008477645 570 dbSNP
rs1214764350 574 dbSNP
rs1255407288 576 dbSNP
rs1298527405 577 dbSNP
rs1419360475 586 dbSNP
rs1041378602 588 dbSNP
rs887392171 591 dbSNP
rs200760598 596 dbSNP
rs1167163309 602 dbSNP
rs1047318553 603 dbSNP
rs76543190 607 dbSNP
rs1396583559 610 dbSNP
rs542319697 612 dbSNP
rs573391913 613 dbSNP
rs1374188243 621 dbSNP
rs1393311557 623 dbSNP
rs937114294 626 dbSNP
rs955138735 636 dbSNP
rs568992259 637 dbSNP
rs759715166 648 dbSNP
rs1328799188 660 dbSNP
rs1009968466 664 dbSNP
rs556998998 667 dbSNP
rs140087594 673 dbSNP
rs892989488 682 dbSNP
rs1311355531 687 dbSNP
rs1231398597 689 dbSNP
rs967076582 692 dbSNP
rs1480684436 694 dbSNP
rs1032805419 696 dbSNP
rs1001894915 703 dbSNP
rs1472095312 707 dbSNP
rs74761664 714 dbSNP
rs990099266 715 dbSNP
rs957165878 719 dbSNP
rs1046174383 726 dbSNP
rs1278610460 731 dbSNP
rs1028862419 735 dbSNP
rs1306328084 738 dbSNP
rs1399234624 746 dbSNP
rs1415641306 750 dbSNP
rs1295430290 751 dbSNP
rs996917783 755 dbSNP
rs1228200160 765 dbSNP
rs964165584 776 dbSNP
rs549455695 781 dbSNP
rs1271880317 782 dbSNP
rs560945120 782 dbSNP
rs16968757 802 dbSNP
rs1019605112 804 dbSNP
rs115831221 807 dbSNP
rs1162724593 810 dbSNP
rs1479092906 823 dbSNP
rs568395833 825 dbSNP
rs1181110289 826 dbSNP
rs1420139205 831 dbSNP
rs887118276 833 dbSNP
rs577466213 834 dbSNP
rs995743610 841 dbSNP
rs898649378 844 dbSNP
rs186169741 846 dbSNP
rs536660990 847 dbSNP
rs1447719415 851 dbSNP
rs1192613480 852 dbSNP
rs181487537 867 dbSNP
rs1226844124 868 dbSNP
rs529637053 868 dbSNP
rs943653177 878 dbSNP
rs912134996 879 dbSNP
rs1340876488 881 dbSNP
rs986897088 881 dbSNP
rs955043873 882 dbSNP
rs945677550 895 dbSNP
rs1209146299 899 dbSNP
rs1242497839 905 dbSNP
rs191064478 908 dbSNP
rs990462902 909 dbSNP
rs1389579625 911 dbSNP
rs1324522761 917 dbSNP
rs145598940 924 dbSNP
rs1387596562 925 dbSNP
rs150169082 928 dbSNP
rs114922223 930 dbSNP
rs974609274 932 dbSNP
rs965877948 940 dbSNP
rs1020077223 946 dbSNP
rs1391327154 951 dbSNP
rs1433467321 952 dbSNP
rs1320452894 955 dbSNP
rs34376783 955 dbSNP
rs75393274 956 dbSNP
rs1170645722 957 dbSNP
rs1001360565 963 dbSNP
rs905796859 964 dbSNP
rs1379751545 967 dbSNP
rs75769989 969 dbSNP
rs1025668007 972 dbSNP
rs1472376781 974 dbSNP
rs1266155276 975 dbSNP
rs1191358210 978 dbSNP
rs1206642237 980 dbSNP
rs528376185 980 dbSNP
rs1247306843 983 dbSNP
rs1468910343 986 dbSNP
rs1201019551 990 dbSNP
rs995711042 991 dbSNP
rs898783865 993 dbSNP
rs1414532949 1007 dbSNP
rs1047682403 1011 dbSNP
rs1158983828 1013 dbSNP
rs879170827 1019 dbSNP
rs1034571309 1020 dbSNP
rs530650194 1025 dbSNP
rs1001617949 1030 dbSNP
rs746518422 1034 dbSNP
rs1233631335 1041 dbSNP
rs1288564515 1042 dbSNP
rs1311373884 1045 dbSNP
rs550067317 1060 dbSNP
rs9520087 1068 dbSNP
rs1039639370 1071 dbSNP
rs771640436 1076 dbSNP
rs745471747 1077 dbSNP
rs1451087934 1087 dbSNP
rs562045273 1092 dbSNP
rs542383007 1093 dbSNP
rs935897874 1098 dbSNP
rs1465915021 1101 dbSNP
rs1376254365 1103 dbSNP
rs912939471 1103 dbSNP
rs988465781 1105 dbSNP
rs1161997929 1106 dbSNP
rs573283408 1109 dbSNP
rs974661769 1112 dbSNP
rs1404210275 1121 dbSNP
rs925705363 1132 dbSNP
rs1308179564 1139 dbSNP
rs773793785 1148 dbSNP
rs980234533 1157 dbSNP
rs944499329 1174 dbSNP
rs969929165 1176 dbSNP
rs1246781369 1177 dbSNP
rs911743211 1179 dbSNP
rs1024524252 1189 dbSNP
rs756975095 1191 dbSNP
rs987270832 1198 dbSNP
rs1014128453 1199 dbSNP
rs1177399372 1200 dbSNP
rs1276884241 1204 dbSNP
rs951534194 1213 dbSNP
rs1026057811 1220 dbSNP
rs186289912 1231 dbSNP
rs962686222 1236 dbSNP
rs1034538590 1239 dbSNP
rs559538047 1247 dbSNP
rs1001752444 1248 dbSNP
rs1425897184 1254 dbSNP
rs546385499 1254 dbSNP
rs1368394801 1260 dbSNP
rs994786073 1260 dbSNP
rs1482827470 1263 dbSNP
rs1168605374 1265 dbSNP
rs1277896138 1278 dbSNP
rs1371904511 1287 dbSNP
rs907353773 1290 dbSNP
rs1402521126 1291 dbSNP
rs1354632400 1292 dbSNP
rs1332017439 1296 dbSNP
rs1024502373 1298 dbSNP
rs1010401430 1299 dbSNP
rs769143850 1299 dbSNP
rs34814764 1302 dbSNP
rs749148371 1303 dbSNP
rs1054213956 1304 dbSNP
rs899271418 1306 dbSNP
rs777751407 1316 dbSNP
rs999823210 1321 dbSNP
rs756052887 1322 dbSNP
rs752788470 1323 dbSNP
rs1008030007 1324 dbSNP
rs1374051701 1330 dbSNP
rs564573162 1334 dbSNP
rs1038941826 1335 dbSNP
rs944663129 1342 dbSNP
rs1051896795 1351 dbSNP
rs911710243 1352 dbSNP
rs1421146426 1354 dbSNP
rs1047590756 1356 dbSNP
rs1377834536 1358 dbSNP
rs41315946 1361 dbSNP
rs1467274894 1362 dbSNP
rs1170527762 1365 dbSNP
rs1401268541 1368 dbSNP
rs929139146 1374 dbSNP
rs918637153 1379 dbSNP
rs974144296 1382 dbSNP
rs1157623085 1383 dbSNP
rs962655602 1390 dbSNP
rs1046901 1396 dbSNP
rs770930966 1403 dbSNP
rs1362990125 1404 dbSNP
rs927324225 1407 dbSNP
rs541605161 1408 dbSNP
rs1231341080 1412 dbSNP
rs1188218084 1413 dbSNP
rs878892266 1421 dbSNP
rs80180479 1424 dbSNP
rs748677779 1428 dbSNP
rs1246723175 1431 dbSNP
rs1024888585 1435 dbSNP
rs1046903 1436 dbSNP
rs369504427 1437 dbSNP
rs1032738920 1450 dbSNP
rs1434507334 1450 dbSNP
rs999960520 1453 dbSNP
rs1196330095 1458 dbSNP
rs554137017 1462 dbSNP
rs1457542055 1463 dbSNP
rs900156053 1471 dbSNP
rs1386343770 1476 dbSNP
rs1285646782 1479 dbSNP
rs1038757165 1482 dbSNP
rs1294117300 1484 dbSNP
rs917128633 1503 dbSNP
rs1385211592 1504 dbSNP
rs1009221014 1505 dbSNP
rs1351407802 1515 dbSNP
rs890344615 1520 dbSNP
rs992612422 1530 dbSNP
rs1329004668 1543 dbSNP
rs950665116 1544 dbSNP
rs1358625502 1548 dbSNP
rs1265462343 1550 dbSNP
rs181053264 1551 dbSNP
rs1048107540 1559 dbSNP
rs1188986656 1563 dbSNP
rs748147987 1567 dbSNP
rs963425010 1583 dbSNP
rs1184008579 1587 dbSNP
rs1409491802 1589 dbSNP
rs929128658 1601 dbSNP
rs1007647704 1609 dbSNP
rs1351588386 1628 dbSNP
rs751774187 1641 dbSNP
rs1038401736 1642 dbSNP
rs565770147 1652 dbSNP
rs1286808012 1660 dbSNP
rs76921545 1661 dbSNP
rs927296352 1662 dbSNP
rs1315397433 1665 dbSNP
rs766713141 1668 dbSNP
rs538843393 1675 dbSNP
rs1218722395 1678 dbSNP
rs1290415789 1679 dbSNP
rs1483140574 1683 dbSNP
rs1206888264 1686 dbSNP
rs1480170419 1687 dbSNP
rs971814661 1693 dbSNP
rs1415859562 1697 dbSNP
rs569843323 1698 dbSNP
rs1162941483 1699 dbSNP
rs989486405 1701 dbSNP
rs1044450981 1707 dbSNP
rs956205296 1708 dbSNP
rs1370227166 1718 dbSNP
rs948532074 1719 dbSNP
rs763409986 1721 dbSNP
rs147875727 1727 dbSNP
rs929160909 1729 dbSNP
rs964489276 1731 dbSNP
rs1342282510 1733 dbSNP
rs376225757 1738 dbSNP
rs1436923421 1739 dbSNP
rs1210491273 1746 dbSNP
rs530006659 1748 dbSNP
rs568513422 1751 dbSNP
rs773774187 1752 dbSNP
rs1482214000 1754 dbSNP
rs765756312 1757 dbSNP
rs1248623480 1758 dbSNP
rs973303465 1759 dbSNP
rs1008523338 1763 dbSNP
rs779672517 1768 dbSNP
rs1166861348 1770 dbSNP
rs963588622 1773 dbSNP
rs548603368 1774 dbSNP
rs1804788 1779 dbSNP
rs1262178725 1789 dbSNP
rs528431436 1795 dbSNP
rs1321782192 1796 dbSNP
rs1368053528 1798 dbSNP
rs954839446 1799 dbSNP
rs559811122 1815 dbSNP
rs545952193 1818 dbSNP
rs532770826 1823 dbSNP
rs1338272014 1825 dbSNP
rs1453504071 1827 dbSNP
rs993849643 1828 dbSNP
rs898983724 1836 dbSNP
rs1310199755 1837 dbSNP
rs572265905 1837 dbSNP
rs1209259803 1840 dbSNP
rs552653240 1852 dbSNP
rs563525899 1857 dbSNP
rs1001163971 1868 dbSNP
rs1340348798 1879 dbSNP
rs905435605 1882 dbSNP
rs764900154 1892 dbSNP
rs1423384410 1895 dbSNP
rs771422929 1896 dbSNP
rs1160447476 1900 dbSNP
rs948373186 1910 dbSNP
rs1044879935 1914 dbSNP
rs1056824032 1916 dbSNP
rs929026236 1922 dbSNP
rs950057849 1926 dbSNP
rs919096599 1927 dbSNP
rs1323659285 1942 dbSNP
rs917251398 1945 dbSNP
rs989065836 1948 dbSNP
rs1331042135 1952 dbSNP
rs934924596 1954 dbSNP
rs926100941 1961 dbSNP
rs745383419 1962 dbSNP
rs543749525 1963 dbSNP
rs1466033558 1964 dbSNP
rs1418567504 1968 dbSNP
rs1452229335 1969 dbSNP
rs973644893 1971 dbSNP
rs978889393 1973 dbSNP
rs964877877 1983 dbSNP
rs776162786 1987 dbSNP
rs577441530 1990 dbSNP
rs1183263362 1992 dbSNP
rs1414697388 1993 dbSNP
rs1471870284 1997 dbSNP
rs941984755 2005 dbSNP
rs1392136439 2007 dbSNP
rs1467230107 2012 dbSNP
rs1405437885 2015 dbSNP
rs1017341453 2020 dbSNP
rs987638097 2029 dbSNP
rs73586161 2032 dbSNP
rs1363263724 2034 dbSNP
rs1403954361 2035 dbSNP
rs1026421247 2043 dbSNP
rs1199845185 2050 dbSNP
rs1317799543 2057 dbSNP
rs1352119942 2058 dbSNP
rs1271325090 2059 dbSNP
rs554795374 2065 dbSNP
rs1278850418 2066 dbSNP
rs993428214 2073 dbSNP
rs77090299 2086 dbSNP
rs145408481 2089 dbSNP
rs76744684 2096 dbSNP
rs1287821468 2097 dbSNP
rs398024310 2097 dbSNP
rs5806589 2097 dbSNP
rs899123225 2102 dbSNP
rs1346133528 2103 dbSNP
rs541031391 2109 dbSNP
rs1030301814 2113 dbSNP
rs1181629801 2117 dbSNP
rs1275142830 2118 dbSNP
rs988225578 2120 dbSNP
rs1016145142 2123 dbSNP
rs1474065012 2130 dbSNP
rs1001955350 2150 dbSNP
rs905053886 2156 dbSNP
rs1401764600 2157 dbSNP
rs1308238295 2161 dbSNP
rs1044457782 2172 dbSNP
rs1001428699 2177 dbSNP
rs1327953901 2178 dbSNP
rs189418599 2182 dbSNP
rs558641751 2198 dbSNP
rs552380558 2199 dbSNP
rs866409496 2212 dbSNP
rs950208909 2213 dbSNP
rs538337650 2214 dbSNP
rs1358794818 2217 dbSNP
rs1229287271 2220 dbSNP
rs1277035795 2222 dbSNP
rs1340371275 2227 dbSNP
rs1195528912 2230 dbSNP
rs1053562346 2234 dbSNP
rs1444592025 2235 dbSNP
rs542287462 2237 dbSNP
rs371035505 2238 dbSNP
rs1013810232 2247 dbSNP
rs1168752934 2250 dbSNP
rs1179257197 2254 dbSNP
rs1460156086 2261 dbSNP
rs895495974 2266 dbSNP
rs979026901 2279 dbSNP
rs1056688578 2282 dbSNP
rs1397616997 2283 dbSNP
rs1212853008 2287 dbSNP
rs1382034479 2287 dbSNP
rs573317386 2294 dbSNP
rs1280001505 2296 dbSNP
rs897573893 2296 dbSNP
rs1233152645 2297 dbSNP
rs1037562109 2299 dbSNP
rs941874354 2300 dbSNP
rs1256903956 2301 dbSNP
rs1347547486 2302 dbSNP
rs1050778607 2303 dbSNP
rs910355517 2303 dbSNP
rs910737243 2315 dbSNP
rs987219179 2324 dbSNP
rs1310830591 2327 dbSNP
rs954654224 2332 dbSNP
rs770627509 2341 dbSNP
rs971673128 2344 dbSNP
rs1426318105 2350 dbSNP
rs1191999785 2354 dbSNP
rs963021076 2355 dbSNP
rs144654285 2357 dbSNP
rs923304614 2359 dbSNP
rs1371980640 2364 dbSNP
rs1457704850 2365 dbSNP
rs1322590025 2370 dbSNP
rs1382907562 2373 dbSNP
rs1381769527 2374 dbSNP
rs756822941 2375 dbSNP
rs1302207093 2379 dbSNP
rs988132051 2384 dbSNP
rs1333111792 2385 dbSNP
rs184915582 2390 dbSNP
rs140793466 2394 dbSNP
rs1283046979 2406 dbSNP
rs1330378447 2409 dbSNP
rs925341282 2417 dbSNP
rs1259536307 2418 dbSNP
rs979518125 2419 dbSNP
rs1450103428 2423 dbSNP
rs1267600767 2427 dbSNP
rs1359545424 2433 dbSNP
rs969974741 2436 dbSNP
rs1023772427 2438 dbSNP
rs1428371116 2441 dbSNP
rs754437075 2444 dbSNP
rs1433093181 2445 dbSNP
rs563816559 2446 dbSNP
rs1294252833 2450 dbSNP
rs1393074324 2467 dbSNP
rs1403371552 2472 dbSNP
rs556522017 2473 dbSNP
rs1302874959 2475 dbSNP
rs181217647 2476 dbSNP
rs117165407 2487 dbSNP
rs1230669590 2487 dbSNP
rs897469744 2489 dbSNP
rs969181178 2495 dbSNP
rs1025253307 2498 dbSNP
rs116802813 2499 dbSNP
rs563589216 2500 dbSNP
rs1490725773 2504 dbSNP
rs1473389904 2506 dbSNP
rs1267792766 2509 dbSNP
rs1053210393 2511 dbSNP
rs755966411 2513 dbSNP
rs904537766 2514 dbSNP
rs1489468284 2517 dbSNP
rs1405685198 2519 dbSNP
rs372714670 2525 dbSNP
rs1216030983 2528 dbSNP
rs943623946 2529 dbSNP
rs1315866129 2531 dbSNP
rs1281460147 2534 dbSNP
rs1370292972 2535 dbSNP
rs1229987162 2536 dbSNP
rs1163140888 2538 dbSNP
rs200661247 2539 dbSNP
rs879889967 2556 dbSNP
rs910716780 2563 dbSNP
rs1292459413 2566 dbSNP
rs1412765747 2569 dbSNP
rs868724232 2573 dbSNP
rs1373160887 2574 dbSNP
rs1299072586 2576 dbSNP
rs747989071 2577 dbSNP
rs933513550 2578 dbSNP
rs918964638 2582 dbSNP
rs935337768 2584 dbSNP
rs1453293758 2586 dbSNP
rs1290572097 2588 dbSNP
rs764644883 2590 dbSNP
rs1343543524 2591 dbSNP
rs971808903 2595 dbSNP
rs1230966800 2596 dbSNP
rs761042959 2604 dbSNP
rs543806858 2608 dbSNP
rs908912159 2618 dbSNP
rs948125102 2626 dbSNP
rs1186424896 2627 dbSNP
rs1479033096 2634 dbSNP
rs1390960956 2635 dbSNP
rs980639120 2642 dbSNP
rs1168721621 2657 dbSNP
rs1186768547 2662 dbSNP
rs188440777 2663 dbSNP
rs1258435440 2667 dbSNP
rs1223048418 2671 dbSNP
rs889457773 2676 dbSNP
rs1305074907 2678 dbSNP
rs1334900296 2686 dbSNP
rs960976231 2689 dbSNP
rs1272541768 2690 dbSNP
rs781204585 2693 dbSNP
rs1365388979 2697 dbSNP
rs147699607 2701 dbSNP
rs956584071 2702 dbSNP
rs961694781 2705 dbSNP
rs1295965095 2709 dbSNP
rs1381868661 2710 dbSNP
rs572040062 2714 dbSNP
rs751755894 2727 dbSNP
rs1459933386 2728 dbSNP
rs1295491580 2731 dbSNP
rs1248753576 2733 dbSNP
rs1006421324 2736 dbSNP
rs904503688 2737 dbSNP
rs766699055 2738 dbSNP
rs1043116887 2749 dbSNP
rs1393795874 2753 dbSNP
rs1007806121 2762 dbSNP
rs1467601626 2787 dbSNP
rs1179108472 2789 dbSNP
rs997331878 2790 dbSNP
rs1335443563 2791 dbSNP
rs558257367 2792 dbSNP
rs1170102164 2798 dbSNP
rs1432332719 2802 dbSNP
rs1268039720 2803 dbSNP
rs901653992 2811 dbSNP
rs1427565764 2821 dbSNP
rs1284960189 2854 dbSNP
rs1321279795 2857 dbSNP
rs1259297496 2866 dbSNP
rs750770677 2867 dbSNP
rs767710658 2868 dbSNP
rs545135627 2877 dbSNP
rs369201447 2888 dbSNP
rs56077446 2889 dbSNP
rs1213818752 2920 dbSNP
rs1478487823 2921 dbSNP
rs1201960931 2923 dbSNP
rs1427678104 2929 dbSNP
rs1480342406 2939 dbSNP
rs935202396 2942 dbSNP
rs1410886371 2952 dbSNP
rs1401923207 2955 dbSNP
rs556251042 2964 dbSNP
rs1211763560 2965 dbSNP
rs534822495 2967 dbSNP
rs1036057795 2968 dbSNP
rs1251688999 2973 dbSNP
rs1226499187 2976 dbSNP
rs941808470 2983 dbSNP
rs1343392043 2984 dbSNP
rs1305549801 2988 dbSNP
rs908881020 2992 dbSNP
rs1043732107 2995 dbSNP
rs948172710 3007 dbSNP
rs754227899 3016 dbSNP
rs1303735621 3025 dbSNP
rs1222089384 3026 dbSNP
rs536464062 3031 dbSNP
rs980439841 3034 dbSNP
rs1370372366 3040 dbSNP
rs916659092 3044 dbSNP
rs759032910 3045 dbSNP
rs1183426154 3054 dbSNP
rs1323930481 3060 dbSNP
rs1469054238 3065 dbSNP
rs969083315 3077 dbSNP
rs115055985 3079 dbSNP
rs554061794 3080 dbSNP
rs992102235 3083 dbSNP
rs1165055706 3096 dbSNP
rs1363405946 3108 dbSNP
rs1298088565 3109 dbSNP
rs1329313981 3120 dbSNP
rs773900238 3121 dbSNP
rs918719848 3127 dbSNP
rs1439973470 3130 dbSNP
rs1248347602 3134 dbSNP
rs1278984658 3134 dbSNP
rs1289845017 3134 dbSNP
rs761579300 3134 dbSNP
rs1359010148 3135 dbSNP
rs1479616378 3136 dbSNP
rs956732133 3138 dbSNP
rs1030860752 3142 dbSNP
rs1253137201 3142 dbSNP
rs779757154 3142 dbSNP
rs1436524768 3143 dbSNP
rs1177853224 3146 dbSNP
rs1181689918 3146 dbSNP
rs1454408698 3147 dbSNP
rs533832266 3150 dbSNP
rs977499232 3153 dbSNP
rs566109121 3156 dbSNP
rs1184966445 3157 dbSNP
rs984459800 3158 dbSNP
rs1021727487 3161 dbSNP
rs1168243842 3168 dbSNP
rs552287940 3174 dbSNP
rs889143243 3177 dbSNP
rs1030974510 3195 dbSNP
rs1328095709 3204 dbSNP
rs1383511357 3219 dbSNP
rs184393520 3220 dbSNP
rs1195126470 3222 dbSNP
rs1313014796 3238 dbSNP
rs1030802242 3239 dbSNP
rs1382256561 3241 dbSNP
rs1479566369 3251 dbSNP
rs533317704 3254 dbSNP
rs1337815774 3255 dbSNP
rs903762570 3256 dbSNP
rs1347345419 3259 dbSNP
rs1204946296 3269 dbSNP
rs1240762521 3274 dbSNP
rs1301353101 3277 dbSNP
rs1443582521 3281 dbSNP
rs1193425905 3283 dbSNP
rs1044137500 3287 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacaCGACGAu 5'
                         |||||| 
Target 5' ----------acucaGCUGCUa 3'
1 - 12
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine, RNase T1 ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacaCGACGAu 5'
                         |||||| 
Target 5' ----------acucaGCUGCUa 3'
1 - 12
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000245323.4 | 3UTR | ACUCAGCUGCUAUACUUAUCACAUUUUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000245323.4 | 3UTR | ACUCAGCUGCUAUACUUAUCACAUUUUAUUAAACACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer -0.304 1.1e-3 -0.329 4.2e-4 100 Click to see details
GSE32688 Pancreatic cancer 0.491 2.2e-3 0.220 1.1e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.548 2.8e-3 0.468 1.1e-2 24 Click to see details
GSE19783 ER- ER- breast cancer -0.309 2.8e-3 -0.330 1.5e-3 79 Click to see details
GSE42095 Differentiated embryonic stem cells -0.423 2.2e-2 -0.318 7.0e-2 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.278 8.9e-2 0.140 2.5e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.167 9.4e-2 -0.150 1.2e-1 64 Click to see details
GSE21849 B cell lymphoma 0.234 1.1e-1 0.445 7.8e-3 29 Click to see details
GSE27834 Pluripotent stem cells 0.289 1.4e-1 0.229 2.0e-1 16 Click to see details
GSE21032 Prostate cancer -0.118 1.4e-1 -0.041 3.6e-1 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.211 1.9e-1 -0.173 2.3e-1 20 Click to see details
GSE17306 Multiple myeloma 0.119 2.1e-1 0.094 2.6e-1 49 Click to see details
GSE28544 Breast cancer 0.171 2.1e-1 0.583 1.4e-3 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.142 2.8e-1 0.253 1.4e-1 20 Click to see details
GSE17498 Multiple myeloma 0.086 3.0e-1 0.088 2.9e-1 40 Click to see details
GSE14794 Lymphoblastoid cells -0.03 3.9e-1 -0.001 5.0e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.05 4.1e-1 -0.107 3.1e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.072 4.1e-1 0.175 2.9e-1 12 Click to see details
GSE28260 Renal cortex and medulla 0.049 4.4e-1 0.159 3.0e-1 13 Click to see details
GSE38226 Liver fibrosis 0.032 4.5e-1 -0.041 4.3e-1 21 Click to see details
GSE38226 Liver fibrosis 0.032 4.5e-1 -0.041 4.3e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.386 0 -0.356 0.01 49 Click to see details
BLCA 0.541 0.01 0.571 0.01 18 Click to see details
BRCA 0.207 0.03 0.076 0.25 84 Click to see details
KIRP -0.301 0.05 -0.324 0.04 32 Click to see details
KICH 0.341 0.05 0.210 0.16 25 Click to see details
THCA 0.156 0.12 0.187 0.08 59 Click to see details
KIRC 0.125 0.15 0.123 0.16 68 Click to see details
CHOL -0.336 0.19 -0.483 0.09 9 Click to see details
STAD 0.126 0.25 0.139 0.22 32 Click to see details
PRAD 0.096 0.25 0.033 0.41 50 Click to see details
HNSC 0.09 0.29 0.084 0.3 42 Click to see details
PAAD -0.429 0.29 -0.600 0.2 4 Click to see details
COAD 0.225 0.3 0.119 0.39 8 Click to see details
ESCA 0.136 0.35 -0.173 0.31 11 Click to see details
LUAD -0.118 0.36 -0.301 0.17 12 Click to see details
LUSC 0.053 0.38 0.018 0.46 38 Click to see details
UCEC -0.033 0.45 -0.132 0.3 19 Click to see details
CESC -0.083 0.47 -0.500 0.33 3 Click to see details
PCPG -0.067 0.48 -0.500 0.33 3 Click to see details
PCPG -0.067 0.48 -0.500 0.33 3 Click to see details
PCPG -0.067 0.48 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*