miRTarBase - #MIRT535471 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PARVB   
Synonyms CGI-56
Description parvin beta
Transcript NM_001003828   
Other Transcripts NM_013327   
Putative miRNA Targets on PARVB
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             :||  ||| |  ||||||  
226 - 248 131.00 -8.80
            |:|||| |    :||:||: 
Target 5' agAGCACCCT----GCATTCTg 3'
359 - 376 106.00 -9.90
miRNA  3' guuugugguaacaguGUGAGgu 5'
Target 5' tttgaagcctcgcgtCACTCag 3'
256 - 277 100.00 -9.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30112517 2 COSMIC
COSN31505137 9 COSMIC
COSN30509797 33 COSMIC
COSN31493862 44 COSMIC
COSN31518055 46 COSMIC
COSN28201249 64 COSMIC
COSN30626989 110 COSMIC
COSN6423283 128 COSMIC
COSN31959852 440 COSMIC
COSN1899960 632 COSMIC
COSN14665438 1092 COSMIC
COSN14664802 1119 COSMIC
COSN5993427 1197 COSMIC
COSN5456236 1198 COSMIC
COSN5456238 1215 COSMIC
COSN28957269 1345 COSMIC
COSN25473453 1436 COSMIC
COSN15986884 1630 COSMIC
COSN20710861 1798 COSMIC
COSN8019788 1798 COSMIC
COSN5771576 1984 COSMIC
COSN16880410 2344 COSMIC
COSN25643323 2547 COSMIC
COSN20210641 2597 COSMIC
COSN16662714 2616 COSMIC
COSN8019789 2965 COSMIC
COSN27542688 3039 COSMIC
COSN24328492 3180 COSMIC
COSN15680242 3201 COSMIC
COSN8011131 3314 COSMIC
COSN20127969 3639 COSMIC
COSN28101310 3642 COSMIC
COSN8997486 3831 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778390496 1 dbSNP
rs202107553 2 dbSNP
rs771080850 3 dbSNP
rs1331173417 5 dbSNP
rs1438245869 6 dbSNP
rs774498501 7 dbSNP
rs1365982838 10 dbSNP
rs771864329 17 dbSNP
rs746006153 28 dbSNP
rs1320554494 33 dbSNP
rs368402280 37 dbSNP
rs1196836694 39 dbSNP
rs1272466835 41 dbSNP
rs918566518 42 dbSNP
rs775626083 43 dbSNP
rs1220980888 46 dbSNP
rs761639539 46 dbSNP
rs765049585 47 dbSNP
rs544472319 53 dbSNP
rs183589736 54 dbSNP
rs1465095639 57 dbSNP
rs1289441258 60 dbSNP
rs952816579 62 dbSNP
rs984152459 64 dbSNP
rs112947583 77 dbSNP
rs943197244 80 dbSNP
rs1293420326 86 dbSNP
rs940199149 87 dbSNP
rs1274437028 88 dbSNP
rs546363766 90 dbSNP
rs1166388778 101 dbSNP
rs1455378922 122 dbSNP
rs1410754757 123 dbSNP
rs566335744 125 dbSNP
rs1256300665 127 dbSNP
rs960893289 128 dbSNP
rs1264954135 129 dbSNP
rs992110541 133 dbSNP
rs1002398322 135 dbSNP
rs1206897545 137 dbSNP
rs1275129908 137 dbSNP
rs1465289936 137 dbSNP
rs916227170 138 dbSNP
rs1054823248 140 dbSNP
rs1241671290 141 dbSNP
rs1450179862 142 dbSNP
rs1198654294 144 dbSNP
rs1267691462 145 dbSNP
rs532431244 146 dbSNP
rs1387869461 148 dbSNP
rs1200946268 149 dbSNP
rs1420765455 150 dbSNP
rs1461051760 155 dbSNP
rs923184766 157 dbSNP
rs1168386139 160 dbSNP
rs893483769 160 dbSNP
rs1398575903 161 dbSNP
rs1403369807 164 dbSNP
rs1322698593 165 dbSNP
rs147372761 166 dbSNP
rs569233308 171 dbSNP
rs1175007048 172 dbSNP
rs537881706 174 dbSNP
rs947735910 178 dbSNP
rs1228267800 184 dbSNP
rs1186806250 185 dbSNP
rs1464473135 186 dbSNP
rs1042814848 190 dbSNP
rs1207138370 192 dbSNP
rs906064474 196 dbSNP
rs1234408936 197 dbSNP
rs1296009670 198 dbSNP
rs1228260831 210 dbSNP
rs1008773131 211 dbSNP
rs1318341564 213 dbSNP
rs1018780235 216 dbSNP
rs964650177 218 dbSNP
rs377564723 219 dbSNP
rs1293033784 227 dbSNP
rs1490947738 232 dbSNP
rs763225340 244 dbSNP
rs920499254 245 dbSNP
rs1166670998 246 dbSNP
rs1260636058 246 dbSNP
rs760502897 247 dbSNP
rs896068752 248 dbSNP
rs1374696730 250 dbSNP
rs376115801 250 dbSNP
rs1255711264 255 dbSNP
rs994406279 256 dbSNP
rs1486877026 267 dbSNP
rs80138948 268 dbSNP
rs1046576428 269 dbSNP
rs938172249 270 dbSNP
rs952698914 270 dbSNP
rs1385559397 276 dbSNP
rs984201824 280 dbSNP
rs113398890 281 dbSNP
rs1296522215 282 dbSNP
rs964120576 283 dbSNP
rs1414973683 298 dbSNP
rs974991361 298 dbSNP
rs923100887 299 dbSNP
rs534498799 309 dbSNP
rs1397113027 317 dbSNP
rs988726854 318 dbSNP
rs1018811270 325 dbSNP
rs189504571 328 dbSNP
rs1188950069 333 dbSNP
rs1316361894 334 dbSNP
rs995994580 337 dbSNP
rs369857788 346 dbSNP
rs1483700440 348 dbSNP
rs1275692285 350 dbSNP
rs1197076489 356 dbSNP
rs1353680957 371 dbSNP
rs79210357 371 dbSNP
rs951956888 372 dbSNP
rs753631815 378 dbSNP
rs1205203845 379 dbSNP
rs905614582 380 dbSNP
rs1263147000 391 dbSNP
rs1408971654 395 dbSNP
rs558395609 396 dbSNP
rs937076270 397 dbSNP
rs1015536170 414 dbSNP
rs1390126534 415 dbSNP
rs1057487796 416 dbSNP
rs139097 418 dbSNP
rs567537774 419 dbSNP
rs1470698408 420 dbSNP
rs766245124 421 dbSNP
rs1197396859 429 dbSNP
rs1451475979 436 dbSNP
rs888485954 437 dbSNP
rs1213761524 438 dbSNP
rs1220865696 440 dbSNP
rs764895676 441 dbSNP
rs990966133 442 dbSNP
rs1351163489 445 dbSNP
rs114970265 448 dbSNP
rs964489676 449 dbSNP
rs1326730640 454 dbSNP
rs181809005 455 dbSNP
rs1160529860 456 dbSNP
rs1158741176 459 dbSNP
rs1401451769 464 dbSNP
rs1400075316 465 dbSNP
rs540149740 466 dbSNP
rs1478023059 471 dbSNP
rs559908682 472 dbSNP
rs954558845 473 dbSNP
rs1042102787 474 dbSNP
rs1444991657 477 dbSNP
rs988764029 481 dbSNP
rs757889812 484 dbSNP
rs968586024 497 dbSNP
rs1317909899 498 dbSNP
rs978435906 501 dbSNP
rs1217250458 506 dbSNP
rs150916975 509 dbSNP
rs1236353067 510 dbSNP
rs900213733 511 dbSNP
rs139412394 527 dbSNP
rs1342193473 530 dbSNP
rs1056867871 537 dbSNP
rs1347174816 542 dbSNP
rs41278877 554 dbSNP
rs930156602 568 dbSNP
rs531848353 569 dbSNP
rs1376407956 579 dbSNP
rs1243644623 582 dbSNP
rs1176104716 591 dbSNP
rs1448141234 593 dbSNP
rs1462649333 601 dbSNP
rs1387790465 602 dbSNP
rs1185428484 604 dbSNP
rs1475570074 611 dbSNP
rs1047177421 612 dbSNP
rs888705782 621 dbSNP
rs1005731367 622 dbSNP
rs1280713295 628 dbSNP
rs548242027 629 dbSNP
rs899813558 630 dbSNP
rs998705624 631 dbSNP
rs1295025758 632 dbSNP
rs2235575 652 dbSNP
rs1364403365 688 dbSNP
rs144464970 689 dbSNP
rs1376154714 692 dbSNP
rs1010077865 694 dbSNP
rs1014771810 696 dbSNP
rs879798981 706 dbSNP
rs1469339323 707 dbSNP
rs1177301012 728 dbSNP
rs548155254 736 dbSNP
rs571032883 738 dbSNP
rs961374213 739 dbSNP
rs1420978296 740 dbSNP
rs1408940429 752 dbSNP
rs1179778280 758 dbSNP
rs982046762 759 dbSNP
rs1464575240 761 dbSNP
rs1020097406 765 dbSNP
rs1298106191 769 dbSNP
rs1374456238 772 dbSNP
rs1393520175 773 dbSNP
rs9614356 777 dbSNP
rs1035071446 781 dbSNP
rs1205088297 785 dbSNP
rs771254360 789 dbSNP
rs774753421 800 dbSNP
rs1287745853 807 dbSNP
rs1232905804 822 dbSNP
rs1356334743 831 dbSNP
rs1295563594 832 dbSNP
rs16991609 836 dbSNP
rs1299273379 839 dbSNP
rs1488536411 847 dbSNP
rs1325087428 851 dbSNP
rs1460654955 854 dbSNP
rs915397697 856 dbSNP
rs1166883239 872 dbSNP
rs1471507098 873 dbSNP
rs1249502224 874 dbSNP
rs993025838 876 dbSNP
rs917007686 877 dbSNP
rs35254339 885 dbSNP
rs1480809109 902 dbSNP
rs1047233568 907 dbSNP
rs1213131397 909 dbSNP
rs910030744 913 dbSNP
rs1275247526 921 dbSNP
rs537952065 929 dbSNP
rs941640964 934 dbSNP
rs1039919516 935 dbSNP
rs899868170 937 dbSNP
rs1200220581 938 dbSNP
rs1393647954 941 dbSNP
rs998196188 943 dbSNP
rs1323375286 945 dbSNP
rs1439489497 948 dbSNP
rs554230431 953 dbSNP
rs9614357 954 dbSNP
rs1009630341 964 dbSNP
rs1020151512 965 dbSNP
rs1159559114 971 dbSNP
rs931737717 972 dbSNP
rs968524056 980 dbSNP
rs1193128702 981 dbSNP
rs1000145977 983 dbSNP
rs1468987862 987 dbSNP
rs887637536 991 dbSNP
rs570123793 1007 dbSNP
rs1403888996 1008 dbSNP
rs1004644849 1009 dbSNP
rs1034267463 1010 dbSNP
rs141160794 1012 dbSNP
rs1346805229 1014 dbSNP
rs1212316763 1015 dbSNP
rs1311003572 1016 dbSNP
rs1303359307 1018 dbSNP
rs1294744093 1020 dbSNP
rs371845825 1022 dbSNP
rs1371114645 1023 dbSNP
rs9614358 1035 dbSNP
rs1206358884 1040 dbSNP
rs1036246955 1047 dbSNP
rs1263520092 1053 dbSNP
rs992514113 1055 dbSNP
rs1003541288 1057 dbSNP
rs1172959953 1060 dbSNP
rs1024360740 1061 dbSNP
rs959748200 1064 dbSNP
rs1271344512 1069 dbSNP
rs1186747572 1082 dbSNP
rs1428196923 1086 dbSNP
rs1487334813 1092 dbSNP
rs181533246 1097 dbSNP
rs1022775910 1100 dbSNP
rs982479285 1104 dbSNP
rs1420843176 1110 dbSNP
rs1430866812 1119 dbSNP
rs910083032 1121 dbSNP
rs1305067992 1124 dbSNP
rs770266019 1131 dbSNP
rs1163307609 1132 dbSNP
rs1384926856 1139 dbSNP
rs1425724772 1142 dbSNP
rs867135901 1142 dbSNP
rs941524931 1154 dbSNP
rs1303332098 1168 dbSNP
rs1367105797 1171 dbSNP
rs1428004476 1172 dbSNP
rs1435335804 1176 dbSNP
rs900104600 1177 dbSNP
rs1377179257 1191 dbSNP
rs1287854554 1201 dbSNP
rs976112179 1203 dbSNP
rs1166275960 1211 dbSNP
rs921532556 1212 dbSNP
rs934204834 1213 dbSNP
rs1051117337 1217 dbSNP
rs892452848 1218 dbSNP
rs1216200731 1220 dbSNP
rs186556964 1221 dbSNP
rs1011495220 1222 dbSNP
rs1312843215 1227 dbSNP
rs978220197 1229 dbSNP
rs924192682 1232 dbSNP
rs1043822646 1239 dbSNP
rs966280842 1241 dbSNP
rs545645369 1243 dbSNP
rs200103980 1248 dbSNP
rs1294177210 1251 dbSNP
rs975774853 1252 dbSNP
rs1195692775 1256 dbSNP
rs562725089 1263 dbSNP
rs1215140015 1283 dbSNP
rs921596513 1286 dbSNP
rs368282804 1291 dbSNP
rs1292506502 1302 dbSNP
rs1180583791 1305 dbSNP
rs1357330395 1306 dbSNP
rs1326805665 1309 dbSNP
rs867699269 1313 dbSNP
rs1390694627 1325 dbSNP
rs1048817581 1326 dbSNP
rs1243096260 1326 dbSNP
rs1445597006 1327 dbSNP
rs1438830868 1328 dbSNP
rs1460129218 1328 dbSNP
rs35824884 1328 dbSNP
rs398037303 1328 dbSNP
rs751728651 1328 dbSNP
rs758350806 1328 dbSNP
rs80353476 1328 dbSNP
rs62227758 1329 dbSNP
rs1250697497 1331 dbSNP
rs1165908442 1339 dbSNP
rs1197015313 1344 dbSNP
rs1332284335 1345 dbSNP
rs1386708275 1345 dbSNP
rs1253296087 1346 dbSNP
rs1336693897 1349 dbSNP
rs1238329842 1352 dbSNP
rs1157936358 1356 dbSNP
rs1336269593 1358 dbSNP
rs908923869 1361 dbSNP
rs1438766305 1364 dbSNP
rs1393779949 1370 dbSNP
rs531671753 1371 dbSNP
rs1326855964 1373 dbSNP
rs1345200725 1378 dbSNP
rs1432311606 1380 dbSNP
rs1406244741 1382 dbSNP
rs1334576833 1388 dbSNP
rs1381991454 1395 dbSNP
rs1453088929 1405 dbSNP
rs1316968611 1410 dbSNP
rs548704876 1412 dbSNP
rs1034562402 1416 dbSNP
rs1223363093 1424 dbSNP
rs894404266 1428 dbSNP
rs1036154007 1437 dbSNP
rs1469533713 1438 dbSNP
rs1285255686 1443 dbSNP
rs1281966025 1447 dbSNP
rs1014565325 1449 dbSNP
rs1351361817 1451 dbSNP
rs1023998197 1455 dbSNP
rs907165288 1456 dbSNP
rs1370354279 1466 dbSNP
rs1002730441 1469 dbSNP
rs1201906210 1471 dbSNP
rs951038828 1475 dbSNP
rs1263029629 1478 dbSNP
rs1343640170 1487 dbSNP
rs760460869 1495 dbSNP
rs895164980 1497 dbSNP
rs1387543622 1498 dbSNP
rs1157470743 1499 dbSNP
rs1394023966 1500 dbSNP
rs562059116 1510 dbSNP
rs1236673185 1511 dbSNP
rs2744986 1512 dbSNP
rs1176231318 1513 dbSNP
rs1239976829 1516 dbSNP
rs568311073 1524 dbSNP
rs1022385273 1528 dbSNP
rs975617159 1534 dbSNP
rs74429453 1535 dbSNP
rs776364396 1538 dbSNP
rs934282529 1543 dbSNP
rs1401903102 1548 dbSNP
rs548091128 1554 dbSNP
rs749655781 1555 dbSNP
rs1281197555 1559 dbSNP
rs987444580 1562 dbSNP
rs571120888 1569 dbSNP
rs913936560 1570 dbSNP
rs999733893 1575 dbSNP
rs1470203185 1579 dbSNP
rs1311438920 1584 dbSNP
rs1031166130 1591 dbSNP
rs1338626911 1592 dbSNP
rs1173762464 1594 dbSNP
rs1415718140 1602 dbSNP
rs1416713676 1603 dbSNP
rs1333725115 1606 dbSNP
rs374373348 1609 dbSNP
rs535373740 1610 dbSNP
rs1043707906 1614 dbSNP
rs1185508415 1618 dbSNP
rs386821688 1625 dbSNP
rs190076866 1626 dbSNP
rs139098 1627 dbSNP
rs1221761242 1637 dbSNP
rs1055649750 1638 dbSNP
rs984825890 1649 dbSNP
rs4823198 1650 dbSNP
rs1341721099 1656 dbSNP
rs1387680264 1663 dbSNP
rs143729374 1665 dbSNP
rs1414518429 1666 dbSNP
rs139099 1669 dbSNP
rs1437585703 1670 dbSNP
rs1440576976 1679 dbSNP
rs886815112 1691 dbSNP
rs1003838996 1700 dbSNP
rs1410236569 1701 dbSNP
rs1205706969 1703 dbSNP
rs1162572485 1706 dbSNP
rs1474776196 1707 dbSNP
rs1016523365 1712 dbSNP
rs962449819 1715 dbSNP
rs1232434156 1716 dbSNP
rs139100 1716 dbSNP
rs1196852698 1718 dbSNP
rs1427907800 1720 dbSNP
rs1480494815 1721 dbSNP
rs1459292003 1724 dbSNP
rs1178438257 1725 dbSNP
rs756539672 1727 dbSNP
rs1055726996 1732 dbSNP
rs1222632603 1743 dbSNP
rs894347334 1746 dbSNP
rs1297148460 1755 dbSNP
rs1442255897 1763 dbSNP
rs1401792035 1766 dbSNP
rs1323507771 1775 dbSNP
rs1460539859 1779 dbSNP
rs1394309917 1784 dbSNP
rs1166634867 1789 dbSNP
rs1417298559 1791 dbSNP
rs372149638 1794 dbSNP
rs373290697 1799 dbSNP
rs987107971 1802 dbSNP
rs903972913 1805 dbSNP
rs1251161148 1809 dbSNP
rs1213307585 1812 dbSNP
rs1469074333 1814 dbSNP
rs1356481577 1815 dbSNP
rs145754661 1818 dbSNP
rs966917042 1820 dbSNP
rs979440844 1823 dbSNP
rs546081888 1827 dbSNP
rs1346188880 1830 dbSNP
rs1242888254 1837 dbSNP
rs1378488239 1846 dbSNP
rs1300541535 1859 dbSNP
rs1031068335 1863 dbSNP
rs749639118 1872 dbSNP
rs1295111621 1875 dbSNP
rs757762465 1876 dbSNP
rs9614359 1877 dbSNP
rs1159768869 1891 dbSNP
rs561915734 1893 dbSNP
rs866721948 1896 dbSNP
rs1421373495 1906 dbSNP
rs998059565 1910 dbSNP
rs576232934 1911 dbSNP
rs915780557 1914 dbSNP
rs1029251388 1916 dbSNP
rs1489963114 1917 dbSNP
rs1219745496 1921 dbSNP
rs779261183 1928 dbSNP
rs1269696677 1932 dbSNP
rs1485758735 1935 dbSNP
rs953757353 1935 dbSNP
rs949921527 1947 dbSNP
rs1045503178 1948 dbSNP
rs984510347 1972 dbSNP
rs887036095 1976 dbSNP
rs1200426004 1977 dbSNP
rs541936354 1983 dbSNP
rs1361022273 1985 dbSNP
rs928358025 1990 dbSNP
rs1421504467 1991 dbSNP
rs1168442550 1992 dbSNP
rs562195602 1997 dbSNP
rs1422550104 1998 dbSNP
rs1379391354 1999 dbSNP
rs752492248 1999 dbSNP
rs991691296 1999 dbSNP
rs1428073214 2000 dbSNP
rs915868692 2001 dbSNP
rs898140296 2002 dbSNP
rs1485001256 2004 dbSNP
rs1257473042 2005 dbSNP
rs386821689 2005 dbSNP
rs1491025466 2006 dbSNP
rs59935732 2006 dbSNP
rs67996385 2007 dbSNP
rs758563624 2007 dbSNP
rs996641559 2007 dbSNP
rs1406838316 2008 dbSNP
rs370009985 2027 dbSNP
rs947284429 2037 dbSNP
rs955109927 2038 dbSNP
rs1008820099 2043 dbSNP
rs1357676771 2045 dbSNP
rs1021104976 2047 dbSNP
rs966969180 2050 dbSNP
rs1424567894 2051 dbSNP
rs1173047446 2055 dbSNP
rs541407864 2057 dbSNP
rs1290545886 2067 dbSNP
rs1359795964 2071 dbSNP
rs925304333 2073 dbSNP
rs772341202 2093 dbSNP
rs990959532 2095 dbSNP
rs917997677 2096 dbSNP
rs1480127811 2102 dbSNP
rs544574342 2103 dbSNP
rs1220033948 2112 dbSNP
rs1029568979 2116 dbSNP
rs1211094833 2119 dbSNP
rs1258987794 2130 dbSNP
rs1445924688 2131 dbSNP
rs1193765109 2135 dbSNP
rs1292375840 2136 dbSNP
rs1045557223 2142 dbSNP
rs1437364309 2145 dbSNP
rs889406293 2150 dbSNP
rs1342179463 2151 dbSNP
rs1326986581 2155 dbSNP
rs775389023 2159 dbSNP
rs908360603 2161 dbSNP
rs939966261 2162 dbSNP
rs564472755 2168 dbSNP
rs1016444828 2169 dbSNP
rs563136877 2172 dbSNP
rs550493059 2179 dbSNP
rs570149743 2181 dbSNP
rs1162764025 2188 dbSNP
rs960055535 2200 dbSNP
rs1438562797 2201 dbSNP
rs991370413 2202 dbSNP
rs1049368409 2203 dbSNP
rs915717034 2210 dbSNP
rs1272379491 2217 dbSNP
rs1157049979 2219 dbSNP
rs1210188120 2230 dbSNP
rs185236986 2240 dbSNP
rs1007956917 2241 dbSNP
rs1320822303 2249 dbSNP
rs1377751644 2250 dbSNP
rs1311556347 2252 dbSNP
rs191182044 2257 dbSNP
rs979099600 2258 dbSNP
rs1021155838 2268 dbSNP
rs902669875 2271 dbSNP
rs768562210 2280 dbSNP
rs1033003890 2284 dbSNP
rs1385455047 2285 dbSNP
rs923386099 2289 dbSNP
rs959611762 2296 dbSNP
rs991238445 2298 dbSNP
rs1179958203 2303 dbSNP
rs1452237690 2309 dbSNP
rs933390395 2310 dbSNP
rs1050641656 2313 dbSNP
rs1024948901 2314 dbSNP
rs889299415 2331 dbSNP
rs1288316110 2332 dbSNP
rs547273300 2332 dbSNP
rs1232144373 2337 dbSNP
rs1347196146 2339 dbSNP
rs776595213 2342 dbSNP
rs761595963 2343 dbSNP
rs184120116 2344 dbSNP
rs908415996 2346 dbSNP
rs139101 2349 dbSNP
rs973835578 2354 dbSNP
rs919843387 2359 dbSNP
rs1432353357 2362 dbSNP
rs868686671 2383 dbSNP
rs865959676 2395 dbSNP
rs9614206 2399 dbSNP
rs932555736 2400 dbSNP
rs1022684566 2407 dbSNP
rs767125243 2410 dbSNP
rs1265290628 2412 dbSNP
rs978553636 2416 dbSNP
rs1279337443 2419 dbSNP
rs749951246 2420 dbSNP
rs1269934939 2421 dbSNP
rs1459968418 2422 dbSNP
rs4823199 2428 dbSNP
rs1243453698 2429 dbSNP
rs890777643 2430 dbSNP
rs1311607406 2431 dbSNP
rs1179858972 2436 dbSNP
rs943797255 2437 dbSNP
rs570466716 2447 dbSNP
rs1415872192 2448 dbSNP
rs1454346868 2454 dbSNP
rs1416912759 2457 dbSNP
rs1161548310 2460 dbSNP
rs1478040691 2466 dbSNP
rs1425425170 2469 dbSNP
rs902723888 2472 dbSNP
rs1482882369 2486 dbSNP
rs923248514 2508 dbSNP
rs780459353 2512 dbSNP
rs1050953984 2521 dbSNP
rs1257701334 2526 dbSNP
rs1199444340 2528 dbSNP
rs1320452215 2533 dbSNP
rs539347728 2534 dbSNP
rs895402245 2536 dbSNP
rs375687276 2539 dbSNP
rs1012478929 2541 dbSNP
rs1390053309 2547 dbSNP
rs1025421471 2556 dbSNP
rs749617137 2557 dbSNP
rs762449179 2573 dbSNP
rs1037830523 2575 dbSNP
rs983537540 2587 dbSNP
rs1352215212 2594 dbSNP
rs1014963416 2604 dbSNP
rs1465753962 2606 dbSNP
rs1334849345 2614 dbSNP
rs556449713 2616 dbSNP
rs973888092 2617 dbSNP
rs1183485986 2626 dbSNP
rs1468686160 2635 dbSNP
rs1237574918 2643 dbSNP
rs1199581630 2646 dbSNP
rs148888049 2647 dbSNP
rs1056747846 2650 dbSNP
rs1202911486 2652 dbSNP
rs1221260565 2654 dbSNP
rs1263701782 2657 dbSNP
rs1299754193 2666 dbSNP
rs1484099262 2672 dbSNP
rs932584039 2677 dbSNP
rs1307887025 2678 dbSNP
rs73163818 2679 dbSNP
rs751010090 2680 dbSNP
rs1378623496 2687 dbSNP
rs912247984 2692 dbSNP
rs1457243634 2699 dbSNP
rs1350202914 2702 dbSNP
rs1166838355 2704 dbSNP
rs1012551176 2705 dbSNP
rs1023140464 2708 dbSNP
rs1250077468 2710 dbSNP
rs943683045 2724 dbSNP
rs1441821182 2726 dbSNP
rs968496317 2738 dbSNP
rs759155019 2740 dbSNP
rs1042038197 2741 dbSNP
rs1419959563 2746 dbSNP
rs1489021043 2757 dbSNP
rs902272078 2759 dbSNP
rs779315352 2765 dbSNP
rs1214357692 2768 dbSNP
rs1353597587 2773 dbSNP
rs1000066302 2774 dbSNP
rs1355173459 2779 dbSNP
rs1298769626 2782 dbSNP
rs374105398 2799 dbSNP
rs569283225 2799 dbSNP
rs955966384 2800 dbSNP
rs748356429 2801 dbSNP
rs1295056984 2804 dbSNP
rs555618664 2805 dbSNP
rs976687370 2807 dbSNP
rs1460762739 2814 dbSNP
rs1444602164 2816 dbSNP
rs112562506 2817 dbSNP
rs1219364372 2817 dbSNP
rs1264567227 2817 dbSNP
rs1308578655 2817 dbSNP
rs1298020533 2818 dbSNP
rs922513156 2819 dbSNP
rs1488991968 2821 dbSNP
rs1253674791 2825 dbSNP
rs1312389578 2826 dbSNP
rs1397668976 2826 dbSNP
rs1303189818 2827 dbSNP
rs1339546889 2828 dbSNP
rs1491047899 2828 dbSNP
rs755618510 2828 dbSNP
rs1409983091 2829 dbSNP
rs61575710 2829 dbSNP
rs1309503492 2830 dbSNP
rs760834206 2830 dbSNP
rs767442594 2831 dbSNP
rs1302318370 2832 dbSNP
rs1466785849 2834 dbSNP
rs572524618 2835 dbSNP
rs1222421400 2836 dbSNP
rs986108080 2836 dbSNP
rs910665274 2841 dbSNP
rs1313946489 2852 dbSNP
rs1196475030 2859 dbSNP
rs942111065 2862 dbSNP
rs1224951173 2865 dbSNP
rs973570437 2870 dbSNP
rs1054383981 2873 dbSNP
rs9614207 2878 dbSNP
rs929452294 2879 dbSNP
rs1207514032 2892 dbSNP
rs754453212 2896 dbSNP
rs138119071 2903 dbSNP
rs906753244 2910 dbSNP
rs1004845777 2912 dbSNP
rs1278608121 2914 dbSNP
rs1220453097 2919 dbSNP
rs1014847191 2921 dbSNP
rs533412579 2922 dbSNP
rs963448612 2923 dbSNP
rs1329576574 2929 dbSNP
rs567943487 2932 dbSNP
rs1427193674 2938 dbSNP
rs1027260838 2951 dbSNP
rs953894555 2954 dbSNP
rs1173243552 2961 dbSNP
rs543740051 2965 dbSNP
rs912486292 2966 dbSNP
rs965256088 2971 dbSNP
rs977767113 2994 dbSNP
rs564046788 3007 dbSNP
rs112531523 3010 dbSNP
rs187079448 3012 dbSNP
rs1053530471 3013 dbSNP
rs535789826 3014 dbSNP
rs916770687 3018 dbSNP
rs527345525 3023 dbSNP
rs747085699 3035 dbSNP
rs1293667923 3036 dbSNP
rs1369119946 3038 dbSNP
rs547136674 3039 dbSNP
rs1294810617 3054 dbSNP
rs1353941467 3056 dbSNP
rs1264813986 3060 dbSNP
rs750827819 3069 dbSNP
rs570330645 3078 dbSNP
rs891649669 3079 dbSNP
rs139102 3087 dbSNP
rs1307172117 3088 dbSNP
rs1446384711 3090 dbSNP
rs549524664 3099 dbSNP
rs775300763 3106 dbSNP
rs1403978542 3112 dbSNP
rs1390399295 3115 dbSNP
rs1005065759 3116 dbSNP
rs375131698 3137 dbSNP
rs1239557119 3138 dbSNP
rs1311759874 3138 dbSNP
rs1330958147 3138 dbSNP
rs1354445817 3138 dbSNP
rs1434500733 3138 dbSNP
rs1491222793 3138 dbSNP
rs766430471 3138 dbSNP
rs79839058 3138 dbSNP
rs986570069 3138 dbSNP
rs1324607170 3139 dbSNP
rs1491481554 3139 dbSNP
rs74616239 3140 dbSNP
rs79316133 3159 dbSNP
rs1484950430 3160 dbSNP
rs1186392041 3163 dbSNP
rs569901100 3167 dbSNP
rs1451681282 3169 dbSNP
rs1380312809 3171 dbSNP
rs148022849 3176 dbSNP
rs995365172 3177 dbSNP
rs555558923 3180 dbSNP
rs6006689 3183 dbSNP
rs1490768092 3195 dbSNP
rs1006732667 3196 dbSNP
rs919314560 3199 dbSNP
rs1488662312 3202 dbSNP
rs1288244301 3204 dbSNP
rs1451024348 3208 dbSNP
rs1019430700 3219 dbSNP
rs993010147 3220 dbSNP
rs1338841747 3222 dbSNP
rs965309441 3228 dbSNP
rs1401073346 3231 dbSNP
rs1360685007 3232 dbSNP
rs1319702891 3240 dbSNP
rs977986212 3247 dbSNP
rs374337390 3264 dbSNP
rs535120791 3269 dbSNP
rs747032248 3281 dbSNP
rs1437007229 3296 dbSNP
rs1127721 3297 dbSNP
rs369914728 3303 dbSNP
rs200349574 3313 dbSNP
rs867102275 3314 dbSNP
rs1315176408 3318 dbSNP
rs774350484 3320 dbSNP
rs947765766 3340 dbSNP
rs1269314622 3345 dbSNP
rs111231301 3356 dbSNP
rs928117250 3365 dbSNP
rs1242846712 3369 dbSNP
rs998056548 3374 dbSNP
rs940974493 3376 dbSNP
rs1036564493 3392 dbSNP
rs899211441 3395 dbSNP
rs1342914472 3402 dbSNP
rs1282901490 3403 dbSNP
rs889729168 3404 dbSNP
rs930663777 3405 dbSNP
rs1017240281 3410 dbSNP
rs1050823986 3413 dbSNP
rs889220216 3414 dbSNP
rs1415575634 3415 dbSNP
rs1169663719 3422 dbSNP
rs1416763029 3423 dbSNP
rs1009374861 3424 dbSNP
rs748021401 3437 dbSNP
rs1157824102 3439 dbSNP
rs1389276667 3444 dbSNP
rs1180000373 3453 dbSNP
rs769728046 3458 dbSNP
rs1238060272 3459 dbSNP
rs1334643982 3462 dbSNP
rs900994879 3463 dbSNP
rs1405017795 3465 dbSNP
rs772844701 3476 dbSNP
rs762830946 3479 dbSNP
rs1257876492 3482 dbSNP
rs770458160 3483 dbSNP
rs1026396988 3486 dbSNP
rs1288363909 3487 dbSNP
rs563553990 3490 dbSNP
rs574229122 3493 dbSNP
rs1223279950 3494 dbSNP
rs950795153 3510 dbSNP
rs9614208 3521 dbSNP
rs1030922827 3525 dbSNP
rs1330226484 3528 dbSNP
rs1447280368 3536 dbSNP
rs1356005381 3549 dbSNP
rs958158589 3555 dbSNP
rs989171584 3558 dbSNP
rs1023696930 3560 dbSNP
rs767117593 3564 dbSNP
rs969186672 3568 dbSNP
rs1404692627 3570 dbSNP
rs1414699658 3574 dbSNP
rs1165524426 3577 dbSNP
rs559516816 3578 dbSNP
rs528686900 3579 dbSNP
rs928169484 3581 dbSNP
rs375135832 3582 dbSNP
rs191887731 3584 dbSNP
rs980395852 3591 dbSNP
rs532904610 3598 dbSNP
rs926161104 3609 dbSNP
rs935653409 3612 dbSNP
rs1350805595 3625 dbSNP
rs1479489499 3626 dbSNP
rs555777942 3629 dbSNP
rs1375346775 3631 dbSNP
rs930861234 3636 dbSNP
rs573615688 3638 dbSNP
rs889097827 3639 dbSNP
rs933740975 3644 dbSNP
rs944840310 3646 dbSNP
rs1040477119 3647 dbSNP
rs1414819553 3656 dbSNP
rs1007106290 3660 dbSNP
rs1352557089 3664 dbSNP
rs1423567550 3677 dbSNP
rs1190940176 3678 dbSNP
rs901047207 3679 dbSNP
rs755603203 3681 dbSNP
rs1271715505 3682 dbSNP
rs898415986 3684 dbSNP
rs1030808821 3685 dbSNP
rs1487026511 3688 dbSNP
rs368388201 3692 dbSNP
rs370313510 3704 dbSNP
rs1011219903 3707 dbSNP
rs994832821 3713 dbSNP
rs573942136 3722 dbSNP
rs1026260857 3729 dbSNP
rs969451411 3736 dbSNP
rs140890778 3737 dbSNP
rs1034734407 3740 dbSNP
rs1289499066 3768 dbSNP
rs549346598 3771 dbSNP
rs1221286584 3774 dbSNP
rs146091663 3780 dbSNP
rs868857189 3781 dbSNP
rs534988833 3784 dbSNP
rs752255839 3785 dbSNP
rs930934646 3788 dbSNP
rs1192211265 3792 dbSNP
rs1477775118 3793 dbSNP
rs1437641823 3796 dbSNP
rs1261902261 3800 dbSNP
rs1205174611 3802 dbSNP
rs986777399 3807 dbSNP
rs1252149132 3810 dbSNP
rs553107426 3812 dbSNP
rs1253904276 3814 dbSNP
rs980635333 3816 dbSNP
rs1483730797 3817 dbSNP
rs1196737303 3828 dbSNP
rs1339716254 3830 dbSNP
rs534851915 3831 dbSNP
rs1478281711 3832 dbSNP
rs1376996486 3833 dbSNP
rs944689108 3834 dbSNP
rs557686459 3841 dbSNP
rs1253056937 3842 dbSNP
rs578025010 3843 dbSNP
rs1470424704 3863 dbSNP
rs537152111 3864 dbSNP
rs1174251917 3866 dbSNP
rs183260893 3867 dbSNP
rs1465599955 3888 dbSNP
rs1417077794 3889 dbSNP
rs1195895004 3892 dbSNP
rs924700859 3892 dbSNP
rs1429778192 3894 dbSNP
rs374067468 3904 dbSNP
rs1253458404 3910 dbSNP
rs544897131 3912 dbSNP
rs893616192 3913 dbSNP
rs933627219 3914 dbSNP
rs1403179597 3921 dbSNP
rs1010856754 3928 dbSNP
rs367791874 3930 dbSNP
rs573739063 3932 dbSNP
rs1050878554 3935 dbSNP
rs562995587 3936 dbSNP
rs762807699 3937 dbSNP
rs559652908 3944 dbSNP
rs942588074 3952 dbSNP
rs1038159175 3960 dbSNP
rs905070167 3978 dbSNP
rs1339111156 3984 dbSNP
rs898445585 3985 dbSNP
rs1229652549 3993 dbSNP
rs1397587947 3997 dbSNP
rs1274902052 4000 dbSNP
rs1003170551 4003 dbSNP
rs1162340644 4007 dbSNP
rs1034619983 4012 dbSNP
rs1244616785 4023 dbSNP
rs367599960 4024 dbSNP
rs1457160936 4025 dbSNP
rs1250971373 4031 dbSNP
rs758839712 4034 dbSNP
rs780139549 4048 dbSNP
rs1027852918 4050 dbSNP
rs1024393071 4060 dbSNP
rs1361618551 4074 dbSNP
rs751840175 4076 dbSNP
rs187169615 4077 dbSNP
rs1448615729 4086 dbSNP
rs1336784762 4087 dbSNP
rs1331263847 4097 dbSNP
rs970546888 4099 dbSNP
rs1189053097 4119 dbSNP
rs1390679297 4122 dbSNP
rs1304228762 4134 dbSNP
rs1001746853 4137 dbSNP
rs1392244665 4141 dbSNP
rs1033167230 4142 dbSNP
rs1156533853 4143 dbSNP
rs957633567 4155 dbSNP
rs986440320 4162 dbSNP
rs1162899137 4167 dbSNP
rs910799295 4168 dbSNP
rs1449616604 4169 dbSNP
rs1266617417 4174 dbSNP
rs571365427 4178 dbSNP
rs2294539 4181 dbSNP
rs1223058114 4183 dbSNP
rs966253428 4185 dbSNP
rs138684097 4186 dbSNP
rs142689231 4187 dbSNP
rs924586743 4196 dbSNP
rs575640587 4197 dbSNP
rs533003364 4205 dbSNP
rs934759327 4207 dbSNP
rs942430764 4212 dbSNP
rs147388945 4213 dbSNP
rs915117831 4215 dbSNP
rs563294222 4216 dbSNP
rs919777194 4219 dbSNP
rs533371515 4227 dbSNP
rs1385262739 4230 dbSNP
rs191663351 4232 dbSNP
rs1046972370 4237 dbSNP
rs77048779 4242 dbSNP
rs1044870808 4245 dbSNP
rs905132416 4255 dbSNP
rs754584939 4256 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 29780.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
               :||| |   :|||||| 
Target 5' -----GCCACU---GCACUCCa 3'
1 - 14
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 29780.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
                ||| |   :|||||| 
Target 5' ------CCACU---GCACUCCa 3'
1 - 13
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM714643
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000338758.7 | 3UTR | GCCACUGCACUCCAGCCUGAGCAACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000338758.7 | 3UTR | CCACUGCACUCCAGCCUGAGCAACAGAGUGAGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.7 7.0e-5 -0.690 9.5e-5 24 Click to see details
GSE28260 Renal cortex and medulla -0.761 1.3e-3 -0.670 6.1e-3 13 Click to see details
GSE42095 Differentiated embryonic stem cells -0.511 6.4e-3 -0.393 3.2e-2 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.448 2.4e-2 -0.346 6.8e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.353 4.2e-2 0.272 9.4e-2 25 Click to see details
GSE32688 Pancreatic cancer 0.26 7.5e-2 0.262 7.4e-2 32 Click to see details
GSE21849 B cell lymphoma 0.259 8.7e-2 0.314 4.9e-2 29 Click to see details
GSE38226 Liver fibrosis -0.279 1.1e-1 -0.269 1.2e-1 21 Click to see details
GSE19350 CNS germ cell tumors 0.377 1.1e-1 0.528 3.9e-2 12 Click to see details
GSE21687 Ependynoma primary tumors -0.143 1.3e-1 -0.054 3.4e-1 64 Click to see details
GSE17306 Multiple myeloma -0.131 1.8e-1 -0.062 3.4e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells 0.188 1.9e-1 0.140 2.6e-1 24 Click to see details
GSE17498 Multiple myeloma -0.072 3.3e-1 -0.080 3.1e-1 40 Click to see details
GSE14794 Lymphoblastoid cells -0.042 3.5e-1 -0.009 4.7e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.08 3.8e-1 -0.056 4.2e-1 16 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.125 4.1e-1 0.257 3.1e-1 6 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.03 4.4e-1 -0.014 4.7e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.792 0.01 -0.857 0 8 Click to see details
CHOL 0.462 0.11 0.167 0.33 9 Click to see details
LIHC -0.176 0.11 -0.066 0.33 49 Click to see details
KIRP 0.438 0.12 0.500 0.09 9 Click to see details
HNSC 0.757 0.23 0.500 0.33 3 Click to see details
ESCA 0.431 0.23 0.900 0.02 5 Click to see details
KIRC -0.063 0.37 -0.048 0.4 29 Click to see details
KICH 0.097 0.41 0.048 0.46 8 Click to see details
THCA 0.074 0.45 0.600 0.14 5 Click to see details
THCA 0.074 0.45 0.600 0.14 5 Click to see details
THCA 0.074 0.45 0.600 0.14 5 Click to see details
THCA 0.074 0.45 0.600 0.14 5 Click to see details
THCA 0.074 0.45 0.600 0.14 5 Click to see details
THCA 0.074 0.45 0.600 0.14 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627420 THAP2 THAP domain containing 2 2 2
MIRT627441 TAS2R5 taste 2 receptor member 5 2 2
MIRT628078 KAT7 lysine acetyltransferase 7 2 4
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629094 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629286 UNC13A unc-13 homolog A 2 2
MIRT629407 ADM2 adrenomedullin 2 2 2
MIRT629584 RFC2 replication factor C subunit 2 2 2
MIRT629635 WDR31 WD repeat domain 31 2 2
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629984 NARS asparaginyl-tRNA synthetase 2 2
MIRT630043 TERF2 telomeric repeat binding factor 2 2 2
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630252 SMTNL2 smoothelin like 2 2 2
MIRT630278 PSMB5 proteasome subunit beta 5 2 2
MIRT630347 NKAP NFKB activating protein 2 2
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT631264 CENPM centromere protein M 2 2
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632470 RPS15A ribosomal protein S15a 2 2
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632994 DUSP18 dual specificity phosphatase 18 2 2
MIRT633082 CXorf21 chromosome X open reading frame 21 2 2
MIRT633239 ZNF573 zinc finger protein 573 2 2
MIRT633286 SLC1A5 solute carrier family 1 member 5 2 2
MIRT633536 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634338 SGOL1 shugoshin 1 2 2
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635050 MYH11 myosin heavy chain 11 2 2
MIRT635236 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636268 RNF157 ring finger protein 157 2 2
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636516 FMN1 formin 1 2 2
MIRT636755 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637188 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637693 CEP89 centrosomal protein 89 2 2
MIRT637788 OLA1 Obg like ATPase 1 2 2
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638449 PLXDC2 plexin domain containing 2 2 2
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT642643 PTGR2 prostaglandin reductase 2 2 2
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644236 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645092 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646508 FAM217B family with sequence similarity 217 member B 2 2
MIRT647013 ADCY2 adenylate cyclase 2 2 2
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648040 FADS6 fatty acid desaturase 6 2 2
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649182 DNPEP aspartyl aminopeptidase 2 2
MIRT649660 TEP1 telomerase associated protein 1 2 2
MIRT651465 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652398 TMEM40 transmembrane protein 40 2 2
MIRT653691 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654577 PXMP4 peroxisomal membrane protein 4 2 2
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658905 DPY19L4 dpy-19 like 4 2 2
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 2 4
MIRT661101 SPIB Spi-B transcription factor 2 2
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662235 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662544 MTAP methylthioadenosine phosphorylase 2 2
MIRT662736 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662844 OMD osteomodulin 2 2
MIRT662907 MED18 mediator complex subunit 18 2 2
MIRT662956 JPH2 junctophilin 2 2 2
MIRT663340 ZNF74 zinc finger protein 74 2 2
MIRT663496 IYD iodotyrosine deiodinase 2 2
MIRT663523 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663542 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663973 ZNF786 zinc finger protein 786 2 2
MIRT664350 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664417 TIGD6 tigger transposable element derived 6 2 2
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664970 TDRD1 tudor domain containing 1 2 2
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665359 XKR4 XK related 4 2 2
MIRT665454 WDR17 WD repeat domain 17 2 2
MIRT665486 VPS53 VPS53, GARP complex subunit 2 2
MIRT666078 SSTR2 somatostatin receptor 2 2 2
MIRT666258 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666324 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666486 SBNO1 strawberry notch homolog 1 2 2
MIRT666696 RBM23 RNA binding motif protein 23 2 2
MIRT666712 RBL1 RB transcriptional corepressor like 1 2 2
MIRT666762 RAB10 RAB10, member RAS oncogene family 2 2
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667474 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667558 LRAT lecithin retinol acyltransferase 2 2
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668119 GK5 glycerol kinase 5 (putative) 2 2
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668346 STXBP2 syntaxin binding protein 2 2 2
MIRT668509 ESYT2 extended synaptotagmin 2 2 2
MIRT669291 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669778 CNDP1 carnosine dipeptidase 1 2 2
MIRT669858 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670177 CCDC142 coiled-coil domain containing 142 2 2
MIRT671107 ZNF841 zinc finger protein 841 2 2
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671476 FLYWCH2 FLYWCH family member 2 2 2
MIRT671492 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672196 F2 coagulation factor II, thrombin 2 2
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672252 SIK2 salt inducible kinase 2 2 2
MIRT672290 GP2 glycoprotein 2 2 2
MIRT672430 POLR2D RNA polymerase II subunit D 2 2
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672901 KRBA2 KRAB-A domain containing 2 2 2
MIRT672958 ZNF655 zinc finger protein 655 2 2
MIRT673096 SYNPO2L synaptopodin 2 like 2 2
MIRT673171 TMEM56 transmembrane protein 56 2 2
MIRT673251 INO80 INO80 complex subunit 2 2
MIRT673296 RNF19B ring finger protein 19B 2 2
MIRT673574 KDELC2 KDEL motif containing 2 2 2
MIRT673586 KIF1C kinesin family member 1C 2 2
MIRT673737 TCF23 transcription factor 23 2 2
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674283 NAGK N-acetylglucosamine kinase 2 2
MIRT674338 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674517 PRR23A proline rich 23A 2 2
MIRT675100 SNTB2 syntrophin beta 2 2 2
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675223 CLK4 CDC like kinase 4 2 2
MIRT675263 ZNF431 zinc finger protein 431 2 2
MIRT675577 WWC1 WW and C2 domain containing 1 2 2
MIRT676025 C9orf69 transmembrane protein 250 2 2
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678576 TMEM168 transmembrane protein 168 2 2
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680344 ZNF281 zinc finger protein 281 2 2
MIRT680467 C3 complement C3 2 2
MIRT682826 FLG2 filaggrin family member 2 2 2
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685275 KIAA1143 KIAA1143 2 2
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT687526 NASP nuclear autoantigenic sperm protein 2 2
MIRT691760 BCL2L15 BCL2 like 15 2 2
MIRT693890 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699342 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699909 RUNDC1 RUN domain containing 1 2 2
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702174 LYRM4 LYR motif containing 4 2 2
MIRT706205 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706659 RNF216 ring finger protein 216 2 2
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706705 GPR155 G protein-coupled receptor 155 2 2
MIRT706777 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706863 MAFF MAF bZIP transcription factor F 2 2
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706916 THAP6 THAP domain containing 6 2 2
MIRT706962 FANCC Fanconi anemia complementation group C 2 2
MIRT706980 XPO5 exportin 5 2 2
MIRT707015 RRP36 ribosomal RNA processing 36 2 2
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707072 MED29 mediator complex subunit 29 2 2
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT724198 MED7 mediator complex subunit 7