miRTarBase - #MIRT534740 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RBM47   
Synonyms NET18
Description RNA binding motif protein 47
Transcript NM_001098634   
Other Transcripts NM_019027   
Putative miRNA Targets on RBM47
3'UTR of RBM47
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            |:||||:   | |||:||| 
1883 - 1902 140.00 -18.10
            || |||||| ||    ||||| | 
2379 - 2403 133.00 -12.90
miRNA  3' guUUGUGGUAACAG---------UGUGAGGu 5'
            || :::||| ||         :|||||| 
321 - 351 132.00 -14.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30460922 1 COSMIC
COSN26991805 2 COSMIC
COSN30455666 17 COSMIC
COSN30479997 24 COSMIC
COSN30587470 49 COSMIC
COSN30104583 59 COSMIC
COSN31562220 87 COSMIC
COSN31595071 97 COSMIC
COSN2028221 132 COSMIC
COSN6580524 229 COSMIC
COSN5060446 255 COSMIC
COSN16747820 410 COSMIC
COSN23048979 597 COSMIC
COSN17506065 611 COSMIC
COSN31590836 659 COSMIC
COSN8490726 685 COSMIC
COSN28735280 696 COSMIC
COSN17078616 726 COSMIC
COSN20099973 913 COSMIC
COSN15992132 1193 COSMIC
COSN6830497 1257 COSMIC
COSN31585000 1437 COSMIC
COSN19657563 1462 COSMIC
COSN9040287 1464 COSMIC
COSN31514085 1557 COSMIC
COSN17125431 1667 COSMIC
COSN31530566 1913 COSMIC
COSN28637470 2051 COSMIC
COSN31606197 2057 COSMIC
COSN26633623 2058 COSMIC
COSN26577331 2152 COSMIC
COSN14515181 2213 COSMIC
COSN26043714 2220 COSMIC
COSN7490346 2247 COSMIC
COSN29008989 2432 COSMIC
COSN27250232 2433 COSMIC
COSN18798238 2493 COSMIC
COSN15668151 2500 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs142516725 5 dbSNP
rs201195667 6 dbSNP
rs1337978378 7 dbSNP
rs754135511 8 dbSNP
rs1305141306 10 dbSNP
rs766335624 13 dbSNP
rs756281770 15 dbSNP
rs750879476 16 dbSNP
rs139448141 17 dbSNP
rs1281362956 20 dbSNP
rs747243554 27 dbSNP
rs1444096408 32 dbSNP
rs183247813 33 dbSNP
rs1184202201 35 dbSNP
rs371818265 35 dbSNP
rs554507131 39 dbSNP
rs1258793610 42 dbSNP
rs1214593071 43 dbSNP
rs764603609 47 dbSNP
rs554684608 49 dbSNP
rs1243064666 50 dbSNP
rs1479351161 51 dbSNP
rs1211270731 63 dbSNP
rs1463056222 74 dbSNP
rs943000525 75 dbSNP
rs1269082937 79 dbSNP
rs910501831 81 dbSNP
rs534663983 82 dbSNP
rs979337691 94 dbSNP
rs371728515 116 dbSNP
rs1020747463 117 dbSNP
rs1199140470 118 dbSNP
rs546544682 130 dbSNP
rs1430789291 134 dbSNP
rs1171674858 135 dbSNP
rs956120408 141 dbSNP
rs1035670389 144 dbSNP
rs147542798 146 dbSNP
rs143298391 150 dbSNP
rs1404154754 153 dbSNP
rs1301043266 157 dbSNP
rs550782622 174 dbSNP
rs139310463 194 dbSNP
rs1294686267 215 dbSNP
rs561766327 218 dbSNP
rs887944569 221 dbSNP
rs887420757 225 dbSNP
rs1047864673 228 dbSNP
rs1049034353 229 dbSNP
rs1358243995 255 dbSNP
rs1222275432 262 dbSNP
rs931866273 266 dbSNP
rs548306117 275 dbSNP
rs1211164721 277 dbSNP
rs1334889804 281 dbSNP
rs1386152222 289 dbSNP
rs1257107211 292 dbSNP
rs73231732 295 dbSNP
rs1161865333 296 dbSNP
rs559313643 296 dbSNP
rs1272248541 298 dbSNP
rs1432134398 306 dbSNP
rs1288275438 307 dbSNP
rs1359778575 320 dbSNP
rs149602123 321 dbSNP
rs1331082357 329 dbSNP
rs944503361 345 dbSNP
rs1315108023 346 dbSNP
rs1381340008 351 dbSNP
rs943051286 361 dbSNP
rs1285829349 376 dbSNP
rs192123521 378 dbSNP
rs1216934986 387 dbSNP
rs912649243 389 dbSNP
rs563672674 392 dbSNP
rs1463139027 394 dbSNP
rs977452430 399 dbSNP
rs1206073680 405 dbSNP
rs370556488 406 dbSNP
rs778521338 410 dbSNP
rs1181992483 413 dbSNP
rs946619702 416 dbSNP
rs1419525182 419 dbSNP
rs754978233 419 dbSNP
rs867697807 424 dbSNP
rs1421432095 426 dbSNP
rs867336915 427 dbSNP
rs958985879 432 dbSNP
rs987967975 436 dbSNP
rs960803924 439 dbSNP
rs1034966276 443 dbSNP
rs552263913 445 dbSNP
rs1404728919 447 dbSNP
rs1003053582 448 dbSNP
rs1035763268 458 dbSNP
rs543599766 464 dbSNP
rs1373598795 468 dbSNP
rs971934267 474 dbSNP
rs1014703486 476 dbSNP
rs1244952696 481 dbSNP
rs1225894875 492 dbSNP
rs1264242037 494 dbSNP
rs1460974044 513 dbSNP
rs981481998 545 dbSNP
rs1481070802 548 dbSNP
rs970069439 552 dbSNP
rs1022879593 566 dbSNP
rs1468580082 572 dbSNP
rs1006899861 575 dbSNP
rs1481257362 577 dbSNP
rs1177080289 581 dbSNP
rs574737626 582 dbSNP
rs1467832453 583 dbSNP
rs868225624 587 dbSNP
rs554603157 590 dbSNP
rs1330272475 591 dbSNP
rs996128006 597 dbSNP
rs1407669817 598 dbSNP
rs900422859 603 dbSNP
rs1349035996 608 dbSNP
rs535135094 611 dbSNP
rs1040655047 615 dbSNP
rs944573205 622 dbSNP
rs923741474 627 dbSNP
rs1323414834 633 dbSNP
rs1217596041 634 dbSNP
rs1041812578 638 dbSNP
rs572323834 643 dbSNP
rs1204096659 644 dbSNP
rs914615317 645 dbSNP
rs1490794975 646 dbSNP
rs749114106 648 dbSNP
rs902005656 649 dbSNP
rs958924616 657 dbSNP
rs867736768 658 dbSNP
rs1169540115 662 dbSNP
rs558890517 663 dbSNP
rs538693171 664 dbSNP
rs73231731 671 dbSNP
rs1367048237 682 dbSNP
rs1249447975 690 dbSNP
rs1407189278 695 dbSNP
rs1304110415 700 dbSNP
rs1345221029 704 dbSNP
rs888792365 706 dbSNP
rs1015080611 713 dbSNP
rs1434984245 713 dbSNP
rs1362766098 714 dbSNP
rs1214044386 715 dbSNP
rs1371827751 716 dbSNP
rs1272832371 717 dbSNP
rs1361816881 719 dbSNP
rs1330722081 720 dbSNP
rs1444873415 727 dbSNP
rs1004672063 728 dbSNP
rs1290805122 738 dbSNP
rs1449593466 743 dbSNP
rs1195258391 744 dbSNP
rs1043383182 746 dbSNP
rs1474833961 751 dbSNP
rs1027371330 753 dbSNP
rs995858580 754 dbSNP
rs946643398 762 dbSNP
rs550943726 764 dbSNP
rs1365344435 774 dbSNP
rs913841873 776 dbSNP
rs1052768332 778 dbSNP
rs1422784951 780 dbSNP
rs939231383 784 dbSNP
rs537199843 787 dbSNP
rs1327522574 791 dbSNP
rs187160260 797 dbSNP
rs1295462407 800 dbSNP
rs1385018507 801 dbSNP
rs1246998469 802 dbSNP
rs902369233 804 dbSNP
rs1042200444 805 dbSNP
rs1314564688 805 dbSNP
rs1379179695 829 dbSNP
rs547940344 830 dbSNP
rs1446334692 837 dbSNP
rs1206689891 848 dbSNP
rs893231417 849 dbSNP
rs1054432317 857 dbSNP
rs1182611127 870 dbSNP
rs1233165016 878 dbSNP
rs970079505 884 dbSNP
rs757420286 886 dbSNP
rs915932419 889 dbSNP
rs981748185 892 dbSNP
rs984834612 895 dbSNP
rs182194041 901 dbSNP
rs983626465 902 dbSNP
rs1240985134 903 dbSNP
rs200966597 912 dbSNP
rs1026603818 913 dbSNP
rs1349635587 913 dbSNP
rs1264861317 914 dbSNP
rs994153975 916 dbSNP
rs1202474979 918 dbSNP
rs966204497 919 dbSNP
rs1278546233 920 dbSNP
rs199991649 923 dbSNP
rs1164747111 924 dbSNP
rs1439170421 924 dbSNP
rs1472436667 924 dbSNP
rs3832277 924 dbSNP
rs397993070 924 dbSNP
rs80189921 924 dbSNP
rs1019089481 928 dbSNP
rs1432078173 928 dbSNP
rs1470367616 928 dbSNP
rs1007328863 929 dbSNP
rs1334960228 940 dbSNP
rs1238111436 943 dbSNP
rs1375618097 944 dbSNP
rs1285183059 948 dbSNP
rs1299017194 951 dbSNP
rs888844465 952 dbSNP
rs74741526 954 dbSNP
rs1196033475 957 dbSNP
rs1249366544 961 dbSNP
rs1482972622 966 dbSNP
rs369156760 985 dbSNP
rs1010599701 993 dbSNP
rs902432579 1000 dbSNP
rs1481065496 1001 dbSNP
rs892115868 1003 dbSNP
rs189909201 1004 dbSNP
rs1314435403 1009 dbSNP
rs755001609 1015 dbSNP
rs1052399725 1016 dbSNP
rs939230634 1023 dbSNP
rs1427619845 1025 dbSNP
rs532050146 1035 dbSNP
rs1435078528 1036 dbSNP
rs1359866285 1039 dbSNP
rs1345856836 1043 dbSNP
rs1156764044 1048 dbSNP
rs563636481 1050 dbSNP
rs927807842 1061 dbSNP
rs543716633 1071 dbSNP
rs1386169568 1079 dbSNP
rs1299019875 1081 dbSNP
rs569974206 1084 dbSNP
rs1227515193 1091 dbSNP
rs1250454227 1093 dbSNP
rs1339608787 1095 dbSNP
rs947873907 1096 dbSNP
rs916027229 1099 dbSNP
rs138224364 1109 dbSNP
rs1490597422 1113 dbSNP
rs1191140684 1114 dbSNP
rs1265866180 1115 dbSNP
rs1471584632 1116 dbSNP
rs1255880828 1120 dbSNP
rs1430442756 1122 dbSNP
rs1193948736 1123 dbSNP
rs1389831402 1126 dbSNP
rs1198340270 1127 dbSNP
rs1447912694 1143 dbSNP
rs1165662400 1145 dbSNP
rs1365965272 1146 dbSNP
rs1457207915 1149 dbSNP
rs1054561511 1164 dbSNP
rs561169714 1175 dbSNP
rs1382346614 1176 dbSNP
rs1296262750 1185 dbSNP
rs1362352886 1186 dbSNP
rs1247727529 1191 dbSNP
rs905900338 1192 dbSNP
rs1286013967 1196 dbSNP
rs1214260869 1203 dbSNP
rs919212431 1204 dbSNP
rs1487121642 1211 dbSNP
rs1206186042 1213 dbSNP
rs541293480 1216 dbSNP
rs1247526233 1218 dbSNP
rs1307711074 1230 dbSNP
rs150426578 1236 dbSNP
rs966256668 1242 dbSNP
rs278982 1244 dbSNP
rs1423070680 1248 dbSNP
rs1007754356 1249 dbSNP
rs983679377 1254 dbSNP
rs1454279293 1256 dbSNP
rs1319735962 1263 dbSNP
rs930811118 1264 dbSNP
rs1454109091 1267 dbSNP
rs796576377 1270 dbSNP
rs530691455 1272 dbSNP
rs1339578642 1282 dbSNP
rs1377946366 1282 dbSNP
rs974541710 1283 dbSNP
rs1311053296 1295 dbSNP
rs568771964 1308 dbSNP
rs1018646867 1309 dbSNP
rs1345299538 1309 dbSNP
rs1163408410 1313 dbSNP
rs987552840 1324 dbSNP
rs1403077879 1329 dbSNP
rs1244028591 1336 dbSNP
rs1483061391 1342 dbSNP
rs1180299097 1344 dbSNP
rs185840715 1349 dbSNP
rs892131175 1352 dbSNP
rs1419393973 1354 dbSNP
rs576510369 1355 dbSNP
rs140561416 1362 dbSNP
rs867875722 1366 dbSNP
rs1003426370 1373 dbSNP
rs906485837 1383 dbSNP
rs1409651283 1386 dbSNP
rs1470691449 1387 dbSNP
rs1010751081 1388 dbSNP
rs537356741 1389 dbSNP
rs957897512 1391 dbSNP
rs1033914733 1392 dbSNP
rs1445398504 1395 dbSNP
rs1001658732 1414 dbSNP
rs1044949399 1416 dbSNP
rs75361409 1421 dbSNP
rs1288315436 1426 dbSNP
rs554726152 1433 dbSNP
rs888276223 1441 dbSNP
rs1225838958 1445 dbSNP
rs181156538 1450 dbSNP
rs1311613849 1451 dbSNP
rs1208304612 1453 dbSNP
rs1487107892 1486 dbSNP
rs1014280573 1491 dbSNP
rs1049148056 1528 dbSNP
rs1261803703 1529 dbSNP
rs775844596 1530 dbSNP
rs930687894 1540 dbSNP
rs1181148390 1542 dbSNP
rs1275342603 1544 dbSNP
rs919279062 1547 dbSNP
rs930863530 1552 dbSNP
rs1412210362 1557 dbSNP
rs565757525 1558 dbSNP
rs552032249 1563 dbSNP
rs1039603887 1564 dbSNP
rs1430856280 1565 dbSNP
rs1348974343 1567 dbSNP
rs943516785 1567 dbSNP
rs911634952 1568 dbSNP
rs944670854 1570 dbSNP
rs1293122545 1582 dbSNP
rs138801206 1585 dbSNP
rs112597102 1590 dbSNP
rs1217546973 1591 dbSNP
rs1362638523 1592 dbSNP
rs1343107699 1593 dbSNP
rs1292844455 1596 dbSNP
rs1204636075 1601 dbSNP
rs569326174 1607 dbSNP
rs1396017476 1619 dbSNP
rs1165212868 1623 dbSNP
rs913559560 1630 dbSNP
rs1222236072 1635 dbSNP
rs989382562 1637 dbSNP
rs953563828 1638 dbSNP
rs1022844328 1641 dbSNP
rs188290404 1645 dbSNP
rs1187743203 1646 dbSNP
rs957938613 1650 dbSNP
rs1166257559 1653 dbSNP
rs989251547 1654 dbSNP
rs530308321 1657 dbSNP
rs956629200 1658 dbSNP
rs1369116242 1659 dbSNP
rs1033565942 1663 dbSNP
rs183624687 1670 dbSNP
rs1263129337 1672 dbSNP
rs1434458334 1676 dbSNP
rs1003193429 1687 dbSNP
rs192269890 1688 dbSNP
rs906203995 1699 dbSNP
rs1295601178 1700 dbSNP
rs1361402044 1704 dbSNP
rs565073192 1705 dbSNP
rs190823694 1706 dbSNP
rs1254891298 1708 dbSNP
rs886462583 1712 dbSNP
rs1217810968 1727 dbSNP
rs1012080794 1730 dbSNP
rs1464005807 1735 dbSNP
rs565336202 1737 dbSNP
rs995121654 1744 dbSNP
rs370894029 1774 dbSNP
rs888294854 1783 dbSNP
rs1474003073 1787 dbSNP
rs528183445 1789 dbSNP
rs1249817168 1792 dbSNP
rs1413461248 1795 dbSNP
rs536369010 1796 dbSNP
rs899422004 1797 dbSNP
rs148765896 1800 dbSNP
rs1307859703 1823 dbSNP
rs943553099 1827 dbSNP
rs1318861051 1848 dbSNP
rs1231919039 1849 dbSNP
rs912037243 1862 dbSNP
rs1245734248 1870 dbSNP
rs1283414630 1873 dbSNP
rs545184234 1881 dbSNP
rs1051490053 1888 dbSNP
rs1225406585 1888 dbSNP
rs368196627 1890 dbSNP
rs185467184 1891 dbSNP
rs11660 1892 dbSNP
rs1393927671 1894 dbSNP
rs913611981 1905 dbSNP
rs1036433460 1907 dbSNP
rs1186346330 1913 dbSNP
rs1237266834 1920 dbSNP
rs1471979479 1925 dbSNP
rs957660442 1926 dbSNP
rs1413334627 1928 dbSNP
rs1456816110 1936 dbSNP
rs1463903162 1941 dbSNP
rs926550141 1943 dbSNP
rs944723296 1951 dbSNP
rs145599320 1953 dbSNP
rs574767929 1957 dbSNP
rs1333689898 1958 dbSNP
rs1338546898 1969 dbSNP
rs1444108434 1971 dbSNP
rs1288958758 1973 dbSNP
rs368667381 1975 dbSNP
rs1226444298 1976 dbSNP
rs1396988074 1978 dbSNP
rs1345021134 1979 dbSNP
rs1199535751 1980 dbSNP
rs915423922 1994 dbSNP
rs1441112360 1996 dbSNP
rs754513080 1999 dbSNP
rs1024790037 2001 dbSNP
rs373960073 2003 dbSNP
rs992951705 2011 dbSNP
rs1379461409 2012 dbSNP
rs1466605984 2018 dbSNP
rs747766276 2019 dbSNP
rs575311508 2021 dbSNP
rs767993190 2028 dbSNP
rs994842890 2029 dbSNP
rs140421653 2031 dbSNP
rs970372119 2034 dbSNP
rs552452485 2038 dbSNP
rs375352610 2041 dbSNP
rs1007798689 2057 dbSNP
rs73231729 2058 dbSNP
rs1272757776 2065 dbSNP
rs1051879350 2073 dbSNP
rs1238877557 2074 dbSNP
rs1205366206 2080 dbSNP
rs945511894 2081 dbSNP
rs892216052 2082 dbSNP
rs888339331 2084 dbSNP
rs936346295 2087 dbSNP
rs926294774 2091 dbSNP
rs1198227614 2097 dbSNP
rs558586985 2104 dbSNP
rs1026885926 2105 dbSNP
rs1169387211 2107 dbSNP
rs981119134 2110 dbSNP
rs1391538094 2112 dbSNP
rs994434612 2116 dbSNP
rs1397689574 2117 dbSNP
rs949327661 2125 dbSNP
rs748253534 2147 dbSNP
rs917789628 2153 dbSNP
rs896978781 2154 dbSNP
rs1385780922 2159 dbSNP
rs1036487720 2162 dbSNP
rs1232478415 2166 dbSNP
rs1008944894 2167 dbSNP
rs1377843918 2170 dbSNP
rs1366658330 2174 dbSNP
rs151215159 2176 dbSNP
rs569440702 2179 dbSNP
rs368469839 2180 dbSNP
rs1174811641 2187 dbSNP
rs932268224 2188 dbSNP
rs1226614516 2189 dbSNP
rs201298966 2190 dbSNP
rs1209728957 2191 dbSNP
rs1447475663 2191 dbSNP
rs1489108660 2191 dbSNP
rs200814411 2191 dbSNP
rs67486138 2191 dbSNP
rs1368780367 2192 dbSNP
rs1435182291 2192 dbSNP
rs1457373488 2192 dbSNP
rs36086958 2192 dbSNP
rs66940499 2192 dbSNP
rs1290731835 2193 dbSNP
rs1319524551 2193 dbSNP
rs1362556238 2193 dbSNP
rs796256141 2193 dbSNP
rs1362076359 2194 dbSNP
rs1322628419 2195 dbSNP
rs1244712115 2196 dbSNP
rs1264187091 2196 dbSNP
rs1331390824 2196 dbSNP
rs398051153 2196 dbSNP
rs1209402197 2197 dbSNP
rs1184254611 2198 dbSNP
rs1183775922 2199 dbSNP
rs1374237478 2199 dbSNP
rs1423015547 2199 dbSNP
rs1463729824 2199 dbSNP
rs1157804166 2200 dbSNP
rs1162680081 2200 dbSNP
rs376284136 2200 dbSNP
rs746854160 2200 dbSNP
rs756855912 2200 dbSNP
rs1303003320 2203 dbSNP
rs1380417137 2203 dbSNP
rs1385761865 2203 dbSNP
rs1467268238 2203 dbSNP
rs1229497193 2204 dbSNP
rs1352843724 2204 dbSNP
rs1395801409 2204 dbSNP
rs201057532 2204 dbSNP
rs371378298 2204 dbSNP
rs758291487 2204 dbSNP
rs1256806229 2205 dbSNP
rs1419855564 2205 dbSNP
rs764790955 2205 dbSNP
rs1255244366 2206 dbSNP
rs1491009202 2206 dbSNP
rs982620706 2206 dbSNP
rs1181284025 2207 dbSNP
rs1253648567 2207 dbSNP
rs1409141631 2207 dbSNP
rs1472897640 2207 dbSNP
rs1311464976 2208 dbSNP
rs1358183625 2208 dbSNP
rs1415666437 2208 dbSNP
rs1465896561 2208 dbSNP
rs764032997 2208 dbSNP
rs1372755620 2210 dbSNP
rs1208512268 2211 dbSNP
rs1288256554 2211 dbSNP
rs1371366274 2211 dbSNP
rs1410977995 2211 dbSNP
rs1208954362 2212 dbSNP
rs1276520131 2212 dbSNP
rs1302306085 2212 dbSNP
rs1311852761 2212 dbSNP
rs879676218 2212 dbSNP
rs1486526188 2213 dbSNP
rs915509438 2213 dbSNP
rs771869588 2214 dbSNP
rs1249520941 2215 dbSNP
rs1281024982 2215 dbSNP
rs1054034039 2216 dbSNP
rs1191243920 2216 dbSNP
rs1431124706 2216 dbSNP
rs1478746170 2216 dbSNP
rs1215732514 2217 dbSNP
rs1392433638 2217 dbSNP
rs935539434 2217 dbSNP
rs1430800501 2218 dbSNP
rs1308006209 2219 dbSNP
rs1347925168 2219 dbSNP
rs1353248383 2219 dbSNP
rs1261925346 2220 dbSNP
rs1300073939 2220 dbSNP
rs924074656 2220 dbSNP
rs1342688743 2222 dbSNP
rs1227352962 2223 dbSNP
rs1222162705 2224 dbSNP
rs1270852967 2224 dbSNP
rs1453277013 2224 dbSNP
rs1466705313 2224 dbSNP
rs981834164 2224 dbSNP
rs1190184210 2226 dbSNP
rs1390371869 2227 dbSNP
rs1166039094 2228 dbSNP
rs1168377436 2228 dbSNP
rs1417767183 2228 dbSNP
rs1450536822 2228 dbSNP
rs970422799 2228 dbSNP
rs1239342097 2229 dbSNP
rs759237817 2230 dbSNP
rs1339553242 2231 dbSNP
rs1268228847 2232 dbSNP
rs1322849017 2232 dbSNP
rs1434580474 2232 dbSNP
rs1438792291 2232 dbSNP
rs781120340 2232 dbSNP
rs916267548 2233 dbSNP
rs1228832120 2234 dbSNP
rs1413396867 2234 dbSNP
rs770053547 2234 dbSNP
rs1210033382 2235 dbSNP
rs1240736442 2236 dbSNP
rs1248052468 2236 dbSNP
rs1464186901 2236 dbSNP
rs753499865 2236 dbSNP
rs1473973527 2238 dbSNP
rs748750338 2238 dbSNP
rs990916284 2238 dbSNP
rs1357750050 2240 dbSNP
rs760429769 2240 dbSNP
rs769141458 2240 dbSNP
rs952398717 2240 dbSNP
rs1389416160 2241 dbSNP
rs1027348848 2242 dbSNP
rs1314039446 2242 dbSNP
rs1342102080 2242 dbSNP
rs1456917720 2242 dbSNP
rs1283576145 2243 dbSNP
rs1400568468 2243 dbSNP
rs1203066663 2244 dbSNP
rs1230112431 2244 dbSNP
rs1268217508 2244 dbSNP
rs1184885404 2246 dbSNP
rs1188657209 2246 dbSNP
rs1257198487 2246 dbSNP
rs1280285632 2246 dbSNP
rs1474531997 2246 dbSNP
rs951155543 2246 dbSNP
rs1382922816 2247 dbSNP
rs1412813768 2247 dbSNP
rs1469680650 2247 dbSNP
rs1157116458 2248 dbSNP
rs1404589768 2248 dbSNP
rs1415206328 2248 dbSNP
rs745683379 2248 dbSNP
rs1199490392 2250 dbSNP
rs1236220034 2250 dbSNP
rs1276303688 2250 dbSNP
rs1288891746 2250 dbSNP
rs1345311305 2250 dbSNP
rs1349407644 2250 dbSNP
rs1373318758 2250 dbSNP
rs1411598130 2250 dbSNP
rs200152202 2250 dbSNP
rs1160518798 2252 dbSNP
rs1179776228 2252 dbSNP
rs1207995520 2252 dbSNP
rs1247400465 2252 dbSNP
rs1253162263 2252 dbSNP
rs1324992772 2252 dbSNP
rs143561234 2252 dbSNP
rs1437367013 2252 dbSNP
rs1478481021 2252 dbSNP
rs1484863123 2252 dbSNP
rs549063764 2252 dbSNP
rs56334700 2252 dbSNP
rs762281934 2252 dbSNP
rs868506839 2252 dbSNP
rs961505024 2253 dbSNP
rs1193309051 2254 dbSNP
rs1194514216 2254 dbSNP
rs1231031813 2254 dbSNP
rs1232095233 2254 dbSNP
rs1269573522 2254 dbSNP
rs1275734520 2254 dbSNP
rs1339340957 2254 dbSNP
rs1346250030 2254 dbSNP
rs1458567585 2254 dbSNP
rs567948161 2254 dbSNP
rs547780721 2255 dbSNP
rs1169015916 2256 dbSNP
rs1372250641 2256 dbSNP
rs1460410805 2256 dbSNP
rs1164869040 2258 dbSNP
rs1454356226 2262 dbSNP
rs1323528440 2264 dbSNP
rs973457235 2264 dbSNP
rs1366944800 2265 dbSNP
rs1435312861 2265 dbSNP
rs890520114 2265 dbSNP
rs1050480789 2266 dbSNP
rs71600746 2267 dbSNP
rs1476072691 2269 dbSNP
rs527848260 2271 dbSNP
rs1213117235 2275 dbSNP
rs565351221 2275 dbSNP
rs67388577 2275 dbSNP
rs757475046 2282 dbSNP
rs1257881811 2290 dbSNP
rs1008266888 2292 dbSNP
rs142168676 2308 dbSNP
rs1426506784 2309 dbSNP
rs149075742 2310 dbSNP
rs935564831 2314 dbSNP
rs563004187 2315 dbSNP
rs1162208653 2316 dbSNP
rs924125407 2318 dbSNP
rs1030499215 2327 dbSNP
rs1046525709 2329 dbSNP
rs751723249 2333 dbSNP
rs916360934 2335 dbSNP
rs577648090 2337 dbSNP
rs1205244986 2339 dbSNP
rs952524449 2341 dbSNP
rs1380852699 2344 dbSNP
rs1315492245 2352 dbSNP
rs193188024 2357 dbSNP
rs1234688592 2360 dbSNP
rs973066018 2361 dbSNP
rs1209661907 2364 dbSNP
rs1260360167 2371 dbSNP
rs574128049 2371 dbSNP
rs554801720 2375 dbSNP
rs557411710 2376 dbSNP
rs1474841997 2386 dbSNP
rs936414304 2410 dbSNP
rs1294249531 2411 dbSNP
rs143001261 2413 dbSNP
rs200546729 2413 dbSNP
rs34841534 2413 dbSNP
rs1157967027 2415 dbSNP
rs1343046593 2419 dbSNP
rs1325251581 2424 dbSNP
rs1008086114 2427 dbSNP
rs1467215050 2443 dbSNP
rs1258978132 2446 dbSNP
rs1414728787 2446 dbSNP
rs760688662 2446 dbSNP
rs1320842939 2447 dbSNP
rs1382903607 2449 dbSNP
rs1352480534 2464 dbSNP
rs1393755401 2466 dbSNP
rs1163057897 2468 dbSNP
rs1306621089 2470 dbSNP
rs1463170727 2470 dbSNP
rs1418329598 2471 dbSNP
rs1167157348 2472 dbSNP
rs540976729 2473 dbSNP
rs753284950 2474 dbSNP
rs1280798125 2477 dbSNP
rs1208722144 2482 dbSNP
rs1485213347 2482 dbSNP
rs534175752 2482 dbSNP
rs917843405 2482 dbSNP
rs929808557 2487 dbSNP
rs1193796882 2506 dbSNP
rs188233593 2514 dbSNP
rs368311715 2529 dbSNP
rs1467653086 2530 dbSNP
rs996238558 2532 dbSNP
rs893809434 2538 dbSNP
rs1434551540 2540 dbSNP
rs1032315737 2548 dbSNP
rs1215210128 2550 dbSNP
rs1468604268 2551 dbSNP
rs1434484297 2553 dbSNP
rs1311639887 2557 dbSNP
rs1257005055 2560 dbSNP
rs1214392480 2562 dbSNP
rs919746485 2563 dbSNP
rs1000205764 2569 dbSNP
rs973920455 2571 dbSNP
rs902798292 2576 dbSNP
rs1337838720 2596 dbSNP
rs1046620695 2611 dbSNP
rs963493190 2614 dbSNP
rs9998092 2618 dbSNP
rs1308036177 2624 dbSNP
rs1228706358 2625 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine, RNase T1 ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
            |||    || | :|||||| 
Target 5' uuAAC----UUCU-GCACUCCa 3'
9 - 25
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000319592.4 | 3UTR | UUAUUUUCUUAACUUCUGCACUCCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*