miRTarBase - #MIRT531913 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC4A1   
Synonyms AE1, BND3, CD233, CHC, DI, EMPB3, EPB3, FR, RTA1A, SAO, SPH4, SW, WD, WD1, WR
Description solute carrier family 4 member 1 (Diego blood group)
Transcript NM_000342   
Putative miRNA Targets on SLC4A1
3'UTR of SLC4A1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             :||||| |   :|||||| 
Target 5' attGCACCACT---GCACTCCa 3'
1533 - 1551 140.00 -17.90
                |::||| ||||||:: 
Target 5' tccctcCTGTTGCCACACTTTc 3'
236 - 257 132.00 -13.40
            ||:|   | |||| | ||||| 
483 - 505 125.00 -13.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
891768 5 ClinVar
255901 18 ClinVar
891521 54 ClinVar
323500 135 ClinVar
891520 265 ClinVar
323499 270 ClinVar
323498 333 ClinVar
323497 335 ClinVar
323496 349 ClinVar
323495 351 ClinVar
889271 353 ClinVar
891697 356 ClinVar
323494 408 ClinVar
891439 431 ClinVar
891438 544 ClinVar
891437 624 ClinVar
889893 649 ClinVar
889892 701 ClinVar
889212 745 ClinVar
889211 753 ClinVar
323493 795 ClinVar
323492 872 ClinVar
323491 897 ClinVar
891629 936 ClinVar
323490 947 ClinVar
323489 977 ClinVar
891378 984 ClinVar
889829 1032 ClinVar
889828 1047 ClinVar
323488 1104 ClinVar
323487 1198 ClinVar
323486 1227 ClinVar
323485 1237 ClinVar
323484 1273 ClinVar
323483 1274 ClinVar
892510 1305 ClinVar
323482 1316 ClinVar
891315 1393 ClinVar
891314 1409 ClinVar
323481 1568 ClinVar
323480 1596 ClinVar
323477 1609 ClinVar
323478 1609 ClinVar
323479 1609 ClinVar
889776 1609 ClinVar
323476 1676 ClinVar
889077 1693 ClinVar
323475 1721 ClinVar
892458 1766 ClinVar
892457 1791 ClinVar
891263 1792 ClinVar
323474 1832 ClinVar
891262 1933 ClinVar
COSN30543922 28 COSMIC
COSN31501030 28 COSMIC
COSN30543872 29 COSMIC
COSN8603210 45 COSMIC
COSN26635113 46 COSMIC
COSN30505877 53 COSMIC
COSN31495219 71 COSMIC
COSN30516335 104 COSMIC
COSN30156018 110 COSMIC
COSN28843629 133 COSMIC
COSN31483883 142 COSMIC
COSN5416847 256 COSMIC
COSN8837051 480 COSMIC
COSN6104460 648 COSMIC
COSN29174452 691 COSMIC
COSN9669451 852 COSMIC
COSN7435867 933 COSMIC
COSN27973601 990 COSMIC
COSN20093280 1237 COSMIC
COSN31966675 1247 COSMIC
COSM9562017 1272 COSMIC
COSM9838884 1318 COSMIC
COSM9892534 1321 COSMIC
COSM4388131 1339 COSMIC
COSN7052450 1408 COSMIC
COSN19703911 1442 COSMIC
COSN31924687 1603 COSMIC
rs2072081 333 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs950554077 2 dbSNP
rs751511171 3 dbSNP
rs748428663 5 dbSNP
rs758199798 6 dbSNP
rs1416512201 7 dbSNP
rs752552308 8 dbSNP
rs1196755527 10 dbSNP
rs765505487 13 dbSNP
rs759706586 16 dbSNP
rs886038284 18 dbSNP
rs369197646 20 dbSNP
rs1263683356 21 dbSNP
rs761226615 22 dbSNP
rs964390755 23 dbSNP
rs1254937528 28 dbSNP
rs772584578 30 dbSNP
rs1452123864 34 dbSNP
rs762119714 38 dbSNP
rs774731313 43 dbSNP
rs376557742 48 dbSNP
rs758901858 54 dbSNP
rs1008846860 62 dbSNP
rs1361389182 65 dbSNP
rs1184125605 66 dbSNP
rs1020527255 68 dbSNP
rs1472784134 69 dbSNP
rs1302301453 84 dbSNP
rs890376532 86 dbSNP
rs1385803785 92 dbSNP
rs1266306656 98 dbSNP
rs1402026732 107 dbSNP
rs544701285 112 dbSNP
rs1276556377 132 dbSNP
rs566741511 135 dbSNP
rs1217784268 137 dbSNP
rs1283755666 140 dbSNP
rs957908083 141 dbSNP
rs1313860979 143 dbSNP
rs1009412413 144 dbSNP
rs149588284 147 dbSNP
rs1002359554 148 dbSNP
rs1485923993 148 dbSNP
rs533974396 155 dbSNP
rs566850650 174 dbSNP
rs774807597 178 dbSNP
rs905233969 182 dbSNP
rs1024692528 186 dbSNP
rs1046365753 196 dbSNP
rs949674829 202 dbSNP
rs185591115 203 dbSNP
rs983403120 205 dbSNP
rs1364396208 207 dbSNP
rs931500305 210 dbSNP
rs1330876451 214 dbSNP
rs898485165 215 dbSNP
rs540128188 219 dbSNP
rs753118012 223 dbSNP
rs1293867621 224 dbSNP
rs1039728476 227 dbSNP
rs193117979 236 dbSNP
rs1353722213 237 dbSNP
rs550850720 239 dbSNP
rs912622820 257 dbSNP
rs1352484600 258 dbSNP
rs1051201200 259 dbSNP
rs749819011 269 dbSNP
rs5027 270 dbSNP
rs1191055112 271 dbSNP
rs913411825 280 dbSNP
rs1017304846 292 dbSNP
rs987126599 301 dbSNP
rs1455680748 306 dbSNP
rs5028 309 dbSNP
rs2072081 333 dbSNP
rs13306777 335 dbSNP
rs1009876630 342 dbSNP
rs1457633991 343 dbSNP
rs527314306 345 dbSNP
rs1196326704 348 dbSNP
rs1465204 349 dbSNP
rs138242019 351 dbSNP
rs571581247 353 dbSNP
rs1046413791 356 dbSNP
rs1463148417 359 dbSNP
rs949394005 371 dbSNP
rs1209828844 375 dbSNP
rs2521614 378 dbSNP
rs1228479366 381 dbSNP
rs1291584203 384 dbSNP
rs1319621416 385 dbSNP
rs1344762108 391 dbSNP
rs45555735 408 dbSNP
rs1459459896 409 dbSNP
rs1177349036 411 dbSNP
rs1235736967 416 dbSNP
rs1445332656 425 dbSNP
rs951207868 431 dbSNP
rs1047328218 434 dbSNP
rs1433065923 443 dbSNP
rs1163768340 451 dbSNP
rs931527093 453 dbSNP
rs995808391 467 dbSNP
rs1329244105 478 dbSNP
rs920134500 478 dbSNP
rs1398836551 480 dbSNP
rs757534437 487 dbSNP
rs1330358746 492 dbSNP
rs943134638 517 dbSNP
rs1040041744 519 dbSNP
rs1320470788 541 dbSNP
rs910311843 544 dbSNP
rs1257987133 545 dbSNP
rs1443568852 549 dbSNP
rs987180494 556 dbSNP
rs1212323537 566 dbSNP
rs1382655729 573 dbSNP
rs954422238 574 dbSNP
rs1472567191 576 dbSNP
rs13306778 580 dbSNP
rs1423994379 581 dbSNP
rs891135888 582 dbSNP
rs1168354752 584 dbSNP
rs1399439339 592 dbSNP
rs1467363925 601 dbSNP
rs1377899287 602 dbSNP
rs1356963937 605 dbSNP
rs573764217 611 dbSNP
rs1298446597 619 dbSNP
rs538590630 623 dbSNP
rs988105334 624 dbSNP
rs562069741 625 dbSNP
rs946147680 626 dbSNP
rs540728481 648 dbSNP
rs1054653641 649 dbSNP
rs573316369 657 dbSNP
rs1441926296 664 dbSNP
rs1189797650 683 dbSNP
rs1032218553 686 dbSNP
rs1265605369 692 dbSNP
rs13306779 701 dbSNP
rs1442308823 706 dbSNP
rs751266166 717 dbSNP
rs1487463213 734 dbSNP
rs904998323 735 dbSNP
rs773162738 738 dbSNP
rs558145756 739 dbSNP
rs1013598951 740 dbSNP
rs1174269872 745 dbSNP
rs763961316 753 dbSNP
rs374250507 756 dbSNP
rs1047492242 764 dbSNP
rs995796367 773 dbSNP
rs898740309 780 dbSNP
rs969047228 789 dbSNP
rs1297925886 791 dbSNP
rs45515496 795 dbSNP
rs991866185 795 dbSNP
rs1226375384 804 dbSNP
rs1345006640 809 dbSNP
rs951155367 820 dbSNP
rs1288308208 821 dbSNP
rs1039945782 828 dbSNP
rs942848982 832 dbSNP
rs1344427014 840 dbSNP
rs1298365433 855 dbSNP
rs1451980631 865 dbSNP
rs1228108762 867 dbSNP
rs886052994 872 dbSNP
rs1025416997 880 dbSNP
rs1244909573 881 dbSNP
rs5029 881 dbSNP
rs962883678 885 dbSNP
rs752623308 896 dbSNP
rs5030 897 dbSNP
rs759024661 900 dbSNP
rs1407430774 901 dbSNP
rs1322053390 902 dbSNP
rs1331007511 910 dbSNP
rs988212067 922 dbSNP
rs1307037599 927 dbSNP
rs958012250 932 dbSNP
rs1427363987 933 dbSNP
rs776244639 934 dbSNP
rs891125408 935 dbSNP
rs1051135906 936 dbSNP
rs1287529757 938 dbSNP
rs1467953997 939 dbSNP
rs572736552 940 dbSNP
rs925209011 944 dbSNP
rs368389948 947 dbSNP
rs1190219017 954 dbSNP
rs1443360942 966 dbSNP
rs1251475077 967 dbSNP
rs1203307915 968 dbSNP
rs1484138098 969 dbSNP
rs1275586652 972 dbSNP
rs1209371981 974 dbSNP
rs147995414 975 dbSNP
rs45557044 975 dbSNP
rs866360817 976 dbSNP
rs886052993 977 dbSNP
rs1054676644 980 dbSNP
rs878998198 984 dbSNP
rs1355874615 989 dbSNP
rs1333969515 990 dbSNP
rs1287441273 993 dbSNP
rs1446127168 996 dbSNP
rs1407733726 998 dbSNP
rs1242937185 999 dbSNP
rs891915151 1001 dbSNP
rs1054965743 1006 dbSNP
rs1199117407 1009 dbSNP
rs980614952 1013 dbSNP
rs1372074512 1021 dbSNP
rs936144448 1028 dbSNP
rs557549888 1032 dbSNP
rs765906243 1033 dbSNP
rs1404316816 1041 dbSNP
rs1387870643 1051 dbSNP
rs1417520743 1055 dbSNP
rs1478355684 1063 dbSNP
rs1044643592 1078 dbSNP
rs1422096896 1081 dbSNP
rs1165524790 1095 dbSNP
rs950340707 1097 dbSNP
rs5031 1103 dbSNP
rs111655803 1104 dbSNP
rs1013651513 1127 dbSNP
rs951526800 1128 dbSNP
rs1333756196 1129 dbSNP
rs1341431219 1131 dbSNP
rs1218996439 1149 dbSNP
rs1025682873 1151 dbSNP
rs995921132 1157 dbSNP
rs1315952234 1160 dbSNP
rs991812540 1179 dbSNP
rs898456645 1180 dbSNP
rs1039998603 1193 dbSNP
rs1007121116 1195 dbSNP
rs535702536 1197 dbSNP
rs886052992 1198 dbSNP
rs974235517 1209 dbSNP
rs1324351103 1212 dbSNP
rs891330487 1213 dbSNP
rs1257897382 1214 dbSNP
rs1488446724 1215 dbSNP
rs1369028631 1218 dbSNP
rs1302780318 1223 dbSNP
rs1330747031 1225 dbSNP
rs141425539 1227 dbSNP
rs1448749736 1236 dbSNP
rs774513767 1237 dbSNP
rs1316797097 1238 dbSNP
rs955299700 1244 dbSNP
rs1330568307 1246 dbSNP
rs1400618165 1247 dbSNP
rs1386187211 1255 dbSNP
rs1160819819 1256 dbSNP
rs1470295735 1257 dbSNP
rs1403710494 1261 dbSNP
rs1170298283 1264 dbSNP
rs772978455 1264 dbSNP
rs1392815891 1265 dbSNP
rs769140134 1273 dbSNP
rs768606768 1274 dbSNP
rs1247923934 1276 dbSNP
rs548849419 1278 dbSNP
rs1359631653 1289 dbSNP
rs1381522764 1294 dbSNP
rs936334860 1295 dbSNP
rs1313950291 1296 dbSNP
rs142587809 1296 dbSNP
rs1230423610 1301 dbSNP
rs533631187 1302 dbSNP
rs566138996 1305 dbSNP
rs1353937654 1311 dbSNP
rs980667176 1312 dbSNP
rs891803423 1313 dbSNP
rs886052991 1316 dbSNP
rs1279830748 1317 dbSNP
rs1219912336 1318 dbSNP
rs1369884898 1319 dbSNP
rs1268465162 1320 dbSNP
rs1430733288 1322 dbSNP
rs1485746663 1326 dbSNP
rs1192200490 1329 dbSNP
rs1033064799 1331 dbSNP
rs1327518452 1332 dbSNP
rs1300448263 1333 dbSNP
rs917772299 1334 dbSNP
rs770415235 1336 dbSNP
rs1381033780 1338 dbSNP
rs951529200 1341 dbSNP
rs1414648927 1342 dbSNP
rs1026153044 1344 dbSNP
rs1426736505 1347 dbSNP
rs1165633762 1351 dbSNP
rs1475050901 1353 dbSNP
rs749729080 1354 dbSNP
rs906028021 1357 dbSNP
rs1195614552 1358 dbSNP
rs1484541088 1360 dbSNP
rs1293955003 1363 dbSNP
rs1044979647 1365 dbSNP
rs1438677180 1367 dbSNP
rs1302017019 1369 dbSNP
rs1211136736 1372 dbSNP
rs1314160152 1376 dbSNP
rs1271047830 1381 dbSNP
rs550914663 1382 dbSNP
rs962718832 1390 dbSNP
rs139308660 1393 dbSNP
rs1261499020 1395 dbSNP
rs1242645813 1396 dbSNP
rs1351214885 1400 dbSNP
rs1007173680 1405 dbSNP
rs1280609035 1407 dbSNP
rs1413448344 1408 dbSNP
rs891382961 1409 dbSNP
rs1342206425 1411 dbSNP
rs1029872400 1413 dbSNP
rs1047987691 1415 dbSNP
rs1176923166 1421 dbSNP
rs1407517323 1424 dbSNP
rs5032 1431 dbSNP
rs1424666872 1436 dbSNP
rs1010826661 1444 dbSNP
rs1351438248 1445 dbSNP
rs1459768622 1448 dbSNP
rs1284635709 1452 dbSNP
rs1325158764 1461 dbSNP
rs1218311891 1462 dbSNP
rs1401022279 1469 dbSNP
rs1277312829 1470 dbSNP
rs1372114846 1475 dbSNP
rs776118982 1482 dbSNP
rs1342493409 1484 dbSNP
rs1315213729 1497 dbSNP
rs929607534 1511 dbSNP
rs891920821 1512 dbSNP
rs1052630095 1516 dbSNP
rs936404213 1529 dbSNP
rs1276233534 1535 dbSNP
rs1441081934 1538 dbSNP
rs918256663 1539 dbSNP
rs1363828420 1552 dbSNP
rs1319142335 1558 dbSNP
rs903557040 1559 dbSNP
rs1232416686 1564 dbSNP
rs1483680330 1566 dbSNP
rs1183842180 1567 dbSNP
rs5033 1568 dbSNP
rs1346189316 1570 dbSNP
rs1164019957 1576 dbSNP
rs1175842417 1578 dbSNP
rs1422705032 1578 dbSNP
rs1413793289 1579 dbSNP
rs1184758920 1580 dbSNP
rs1326231564 1581 dbSNP
rs1353436783 1585 dbSNP
rs1448226601 1591 dbSNP
rs1304232386 1593 dbSNP
rs941148131 1594 dbSNP
rs973844054 1594 dbSNP
rs1279290559 1595 dbSNP
rs886052990 1596 dbSNP
rs1213362063 1597 dbSNP
rs917824715 1598 dbSNP
rs1448942391 1599 dbSNP
rs992050160 1601 dbSNP
rs929817457 1602 dbSNP
rs955205649 1604 dbSNP
rs1246206877 1605 dbSNP
rs1186918219 1606 dbSNP
rs12945753 1608 dbSNP
rs1029546540 1609 dbSNP
rs1039193295 1609 dbSNP
rs1166098300 1609 dbSNP
rs1177679871 1609 dbSNP
rs1220990496 1609 dbSNP
rs1270136834 1609 dbSNP
rs1278330964 1609 dbSNP
rs1299146177 1609 dbSNP
rs1342801669 1609 dbSNP
rs1347373345 1609 dbSNP
rs1369006717 1609 dbSNP
rs1373216757 1609 dbSNP
rs1413833651 1609 dbSNP
rs1414538843 1609 dbSNP
rs1418082567 1609 dbSNP
rs1429171782 1609 dbSNP
rs57466226 1609 dbSNP
rs71361565 1609 dbSNP
rs869183959 1609 dbSNP
rs886052989 1609 dbSNP
rs1362776628 1610 dbSNP
rs12945748 1613 dbSNP
rs2857079 1618 dbSNP
rs1318125797 1630 dbSNP
rs956015593 1639 dbSNP
rs1439255958 1643 dbSNP
rs1301274428 1655 dbSNP
rs1370354426 1657 dbSNP
rs1241056914 1658 dbSNP
rs1311735031 1658 dbSNP
rs1348880277 1669 dbSNP
rs1033466377 1672 dbSNP
rs745898810 1676 dbSNP
rs775255045 1677 dbSNP
rs1452069822 1685 dbSNP
rs529123295 1688 dbSNP
rs1018328339 1697 dbSNP
rs1453275074 1704 dbSNP
rs1178788360 1712 dbSNP
rs1365172856 1717 dbSNP
rs142658017 1720 dbSNP
rs62078947 1721 dbSNP
rs552957248 1740 dbSNP
rs1030326867 1747 dbSNP
rs1340868776 1747 dbSNP
rs1047934762 1748 dbSNP
rs993747410 1749 dbSNP
rs1294711443 1752 dbSNP
rs1333501905 1752 dbSNP
rs1334174812 1758 dbSNP
rs896817763 1766 dbSNP
rs1038468485 1767 dbSNP
rs530745076 1768 dbSNP
rs1234994516 1772 dbSNP
rs941106311 1791 dbSNP
rs143785442 1792 dbSNP
rs1033169344 1795 dbSNP
rs1252083885 1796 dbSNP
rs1049523281 1798 dbSNP
rs933777334 1799 dbSNP
rs1361194466 1802 dbSNP
rs1369344439 1805 dbSNP
rs1313730088 1806 dbSNP
rs1476387584 1810 dbSNP
rs184368107 1812 dbSNP
rs988724356 1821 dbSNP
rs575581395 1824 dbSNP
rs1000596266 1827 dbSNP
rs956174392 1828 dbSNP
rs886052988 1832 dbSNP
rs557394668 1833 dbSNP
rs1394450270 1845 dbSNP
rs1390983810 1849 dbSNP
rs903611069 1858 dbSNP
rs1044744025 1859 dbSNP
rs925960999 1865 dbSNP
rs1429179888 1870 dbSNP
rs536140689 1888 dbSNP
rs947731952 1891 dbSNP
rs1219193008 1895 dbSNP
rs896131728 1896 dbSNP
rs747256866 1900 dbSNP
rs1056797220 1902 dbSNP
rs1181206314 1911 dbSNP
rs1471692470 1927 dbSNP
rs565128885 1933 dbSNP
rs1257297684 1938 dbSNP
rs758172759 1950 dbSNP
rs973929212 1952 dbSNP
rs1478407702 1978 dbSNP
rs1211192376 2001 dbSNP
rs3169716 2005 dbSNP
rs1371343259 2007 dbSNP
rs941458302 2017 dbSNP
rs1014302038 2020 dbSNP
rs1377484474 2024 dbSNP
rs911315317 2029 dbSNP
rs1354592966 2039 dbSNP
rs1400460872 2039 dbSNP
rs553108948 2040 dbSNP
rs1272010000 2045 dbSNP
rs1297630853 2054 dbSNP
rs960192857 2055 dbSNP
rs1226030093 2063 dbSNP
rs1026482117 2064 dbSNP
rs985506236 2066 dbSNP
rs533644288 2067 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine, RNase T1 ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guuugugguaacaguGUGAGGu 5'
Target 5' ---------------CACUCCa 3'
1 - 7
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000262418.6 | 3UTR | CACUCCAGCCUGGGCAACAGAGCGAGACCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*